Mutagenetix > Incidental Mutation

Incidental Mutation 'R8063:Sorcs1'

619880

Institutional Source

Beutler Lab

Gene Symbol

Sorcs1

Ensembl Gene

ENSMUSG00000043531

Gene Name

sortilin-related VPS10 domain containing receptor 1

Synonyms

MMRRC Submission

067499-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.094) question?

Stock #

R8063 (G1)

Quality Score

111.008

Status

Validated

Chromosome

Chromosomal Location

50131737-50667084 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 50132415 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 1181 (D1181V)

Ref Sequence

ENSEMBL: ENSMUSP00000147463 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072685] [ENSMUST00000164039] [ENSMUST00000209413] [ENSMUST00000211687]

AlphaFold

no structure available at present

Predicted Effect

unknown
Transcript: ENSMUST00000072685
AA Change: D1181V

SMART Domains

Protein: ENSMUSP00000072472
Gene: ENSMUSG00000043531
AA Change: D1181V

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	94	113	N/A	INTRINSIC
VPS10	196	797	N/A	SMART
PKD	799	889	3.84e-1	SMART
PKD	897	975	8.63e-1	SMART
transmembrane domain	1098	1120	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000164039

SMART Domains

Protein: ENSMUSP00000132615
Gene: ENSMUSG00000043531

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	94	113	N/A	INTRINSIC
VPS10	196	797	N/A	SMART
PKD	799	889	3.84e-1	SMART
PKD	897	975	8.63e-1	SMART
transmembrane domain	1098	1120	N/A	INTRINSIC
low complexity region	1129	1142	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000209413
AA Change: D1181V

Predicted Effect

probably benign
Transcript: ENSMUST00000211687

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

98% (53/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. Two of the five family members (sortilin and sortilin-related receptor) are synthesized as preproproteins; it is not yet known if this encoded protein is also a preproprotein. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Female mice homozygous for a null allele have abnormal amyloid beta levels in the brain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ace	T	A	11: 105,862,190 (GRCm39)	I248N	possibly damaging	Het
Agk	T	A	6: 40,306,490 (GRCm39)	C20S	possibly damaging	Het
Alpk2	G	A	18: 65,483,417 (GRCm39)	S197L	probably benign	Het
Armc10	T	C	5: 21,853,768 (GRCm39)		probably null	Het
Asxl2	A	G	12: 3,550,768 (GRCm39)	T837A	probably benign	Het
Atp12a	A	G	14: 56,603,545 (GRCm39)	E50G	probably damaging	Het
Bend5	G	T	4: 111,317,031 (GRCm39)	C398F	probably damaging	Het
Bicra	A	G	7: 15,712,969 (GRCm39)	V1026A	probably benign	Het
Canx	A	T	11: 50,199,173 (GRCm39)	Y165*	probably null	Het
Casp14	A	G	10: 78,549,865 (GRCm39)	F210L	probably damaging	Het
Cep70	T	A	9: 99,178,175 (GRCm39)	D458E	probably benign	Het
Cisd3	T	C	11: 97,576,710 (GRCm39)	V12A	probably benign	Het
Cnot4	A	T	6: 35,045,578 (GRCm39)	M211K	probably damaging	Het
Cyp4f18	A	G	8: 72,752,075 (GRCm39)	L197P	probably damaging	Het
Dnah5	T	A	15: 28,230,729 (GRCm39)	I209N	probably benign	Het
Dsc2	C	T	18: 20,165,331 (GRCm39)	G881R	possibly damaging	Het
Edem2	A	T	2: 155,544,376 (GRCm39)	M458K	probably benign	Het
Eif2ak4	G	A	2: 118,241,382 (GRCm39)	E178K	possibly damaging	Het
Fars2	G	A	13: 36,388,880 (GRCm39)	W123*	probably null	Het
Ighv1-20	T	C	12: 114,687,405 (GRCm39)	Y113C	probably damaging	Het
Il18r1	T	A	1: 40,526,198 (GRCm39)	I248N	probably benign	Het
Impg2	T	A	16: 56,081,819 (GRCm39)		probably benign	Het
Kcnh2	T	C	5: 24,526,670 (GRCm39)	E1042G	probably benign	Het
Krt42	G	C	11: 100,155,865 (GRCm39)	R294G	possibly damaging	Het
Lasp1	T	C	11: 97,724,957 (GRCm39)	Y188H	probably benign	Het
Lrrc37	T	C	11: 103,433,087 (GRCm39)	T3361A	unknown	Het
Lrrc52	A	G	1: 167,294,090 (GRCm39)	I65T	probably damaging	Het
Megf9	A	G	4: 70,406,495 (GRCm39)	C224R	probably damaging	Het
Ms4a10	T	C	19: 10,942,136 (GRCm39)	T162A	probably benign	Het
Mstn	T	A	1: 53,105,607 (GRCm39)	F316L	probably benign	Het
Ndufs8	T	C	19: 3,961,019 (GRCm39)	Y86C	probably damaging	Het
Or10d4b	A	T	9: 39,534,823 (GRCm39)	I133F	probably damaging	Het
Pappa2	C	T	1: 158,764,126 (GRCm39)	D462N	possibly damaging	Het
Rad51d	A	G	11: 82,780,597 (GRCm39)	S62P	probably benign	Het
Ralgapa2	A	G	2: 146,285,775 (GRCm39)	Y388H	probably damaging	Het
Rdm1	C	A	11: 101,521,694 (GRCm39)	Q150K	probably benign	Het
Rictor	C	T	15: 6,801,635 (GRCm39)	S441L	probably benign	Het
Sctr	T	C	1: 119,991,005 (GRCm39)	V446A	probably benign	Het
Sin3b	G	A	8: 73,452,169 (GRCm39)	D71N	probably damaging	Het
Sirt5	A	T	13: 43,524,323 (GRCm39)	T32S	probably benign	Het
Slc17a1	T	C	13: 24,059,524 (GRCm39)	V85A	probably benign	Het
Snx1	C	T	9: 66,004,676 (GRCm39)		probably benign	Het
Tcof1	A	G	18: 60,971,834 (GRCm39)	S158P	probably damaging	Het
Tet3	T	C	6: 83,379,723 (GRCm39)	D815G	probably damaging	Het
Tnfsf11	A	T	14: 78,516,098 (GRCm39)	I290N	probably damaging	Het
Uba6	A	T	5: 86,300,544 (GRCm39)	N225K	probably benign	Het
Usp30	A	G	5: 114,238,524 (GRCm39)	T11A	probably benign	Het
Vmn1r5	T	G	6: 56,962,583 (GRCm39)	M86R	probably damaging	Het
Vmn2r26	T	A	6: 124,001,914 (GRCm39)	H66Q	probably benign	Het
Vps13d	T	C	4: 144,841,327 (GRCm39)	E2647G		Het
Wdr5b	T	A	16: 35,862,158 (GRCm39)	D92E	possibly damaging	Het
Zfp960	C	A	17: 17,308,623 (GRCm39)	R446S	probably benign	Het
Zscan20	C	T	4: 128,480,028 (GRCm39)	S821N	probably benign	Het

Other mutations in Sorcs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Sorcs1	APN	19	50,178,492 (GRCm39)	missense	probably damaging	1.00
IGL00983:Sorcs1	APN	19	50,164,566 (GRCm39)	missense	probably damaging	0.98
IGL01125:Sorcs1	APN	19	50,216,639 (GRCm39)	missense	probably damaging	1.00
IGL01320:Sorcs1	APN	19	50,276,517 (GRCm39)	splice site	probably benign
IGL01445:Sorcs1	APN	19	50,141,504 (GRCm39)	missense	probably damaging	1.00
IGL01682:Sorcs1	APN	19	50,169,944 (GRCm39)	missense	probably benign	0.43
IGL01799:Sorcs1	APN	19	50,218,647 (GRCm39)	critical splice donor site	probably null
IGL02044:Sorcs1	APN	19	50,276,597 (GRCm39)	splice site	probably benign
IGL02111:Sorcs1	APN	19	50,218,683 (GRCm39)	missense	probably benign	0.00
IGL02364:Sorcs1	APN	19	50,322,036 (GRCm39)	missense	probably damaging	1.00
IGL02378:Sorcs1	APN	19	50,171,109 (GRCm39)	nonsense	probably null
IGL02498:Sorcs1	APN	19	50,666,606 (GRCm39)	missense	probably benign
IGL02658:Sorcs1	APN	19	50,178,530 (GRCm39)	missense	probably damaging	1.00
IGL02939:Sorcs1	APN	19	50,666,368 (GRCm39)	nonsense	probably null
IGL02942:Sorcs1	APN	19	50,463,875 (GRCm39)	missense	probably damaging	1.00
IGL03057:Sorcs1	APN	19	50,248,194 (GRCm39)	nonsense	probably null
IGL03230:Sorcs1	APN	19	50,230,531 (GRCm39)	missense	probably damaging	1.00
P0033:Sorcs1	UTSW	19	50,141,345 (GRCm39)	missense	probably damaging	0.98
R0109:Sorcs1	UTSW	19	50,367,329 (GRCm39)	splice site	probably benign
R0115:Sorcs1	UTSW	19	50,624,891 (GRCm39)	intron	probably benign
R0242:Sorcs1	UTSW	19	50,216,659 (GRCm39)	missense	probably damaging	1.00
R0242:Sorcs1	UTSW	19	50,216,659 (GRCm39)	missense	probably damaging	1.00
R0325:Sorcs1	UTSW	19	50,301,480 (GRCm39)	splice site	probably null
R0481:Sorcs1	UTSW	19	50,624,891 (GRCm39)	intron	probably benign
R0581:Sorcs1	UTSW	19	50,241,139 (GRCm39)	missense	possibly damaging	0.70
R0669:Sorcs1	UTSW	19	50,230,380 (GRCm39)	splice site	probably benign
R0980:Sorcs1	UTSW	19	50,220,761 (GRCm39)	missense	probably benign	0.04
R1158:Sorcs1	UTSW	19	50,132,598 (GRCm39)	unclassified	probably benign
R1519:Sorcs1	UTSW	19	50,241,025 (GRCm39)	missense	probably benign	0.05
R1669:Sorcs1	UTSW	19	50,463,860 (GRCm39)	missense	probably damaging	0.99
R1779:Sorcs1	UTSW	19	50,163,481 (GRCm39)	splice site	probably benign
R1783:Sorcs1	UTSW	19	50,216,747 (GRCm39)	critical splice acceptor site	probably null
R1927:Sorcs1	UTSW	19	50,210,633 (GRCm39)	missense	probably damaging	1.00
R1935:Sorcs1	UTSW	19	50,221,082 (GRCm39)	missense	probably damaging	0.96
R1936:Sorcs1	UTSW	19	50,221,082 (GRCm39)	missense	probably damaging	0.96
R2109:Sorcs1	UTSW	19	50,666,630 (GRCm39)	missense	probably benign
R2206:Sorcs1	UTSW	19	50,218,655 (GRCm39)	missense	possibly damaging	0.81
R2207:Sorcs1	UTSW	19	50,218,655 (GRCm39)	missense	possibly damaging	0.81
R3031:Sorcs1	UTSW	19	50,213,613 (GRCm39)	missense	probably damaging	0.98
R3032:Sorcs1	UTSW	19	50,213,613 (GRCm39)	missense	probably damaging	0.98
R3107:Sorcs1	UTSW	19	50,199,088 (GRCm39)	missense	possibly damaging	0.83
R3508:Sorcs1	UTSW	19	50,213,613 (GRCm39)	missense	probably damaging	0.98
R3738:Sorcs1	UTSW	19	50,139,659 (GRCm39)	missense	probably benign	0.03
R4127:Sorcs1	UTSW	19	50,210,597 (GRCm39)	missense	probably benign	0.29
R4212:Sorcs1	UTSW	19	50,213,613 (GRCm39)	missense	probably damaging	0.98
R4213:Sorcs1	UTSW	19	50,213,613 (GRCm39)	missense	probably damaging	0.98
R4385:Sorcs1	UTSW	19	50,178,599 (GRCm39)	missense	probably benign	0.01
R4424:Sorcs1	UTSW	19	50,367,379 (GRCm39)	missense	probably damaging	0.97
R4603:Sorcs1	UTSW	19	50,301,402 (GRCm39)	critical splice donor site	probably null
R4679:Sorcs1	UTSW	19	50,171,107 (GRCm39)	missense	probably benign
R4780:Sorcs1	UTSW	19	50,132,419 (GRCm39)	unclassified	probably benign
R4781:Sorcs1	UTSW	19	50,171,119 (GRCm39)	missense	probably damaging	1.00
R4823:Sorcs1	UTSW	19	50,218,740 (GRCm39)	missense	possibly damaging	0.87
R4823:Sorcs1	UTSW	19	50,666,578 (GRCm39)	missense	possibly damaging	0.92
R4883:Sorcs1	UTSW	19	50,220,741 (GRCm39)	missense	probably benign	0.00
R5091:Sorcs1	UTSW	19	50,248,190 (GRCm39)	critical splice donor site	probably null
R5105:Sorcs1	UTSW	19	50,213,579 (GRCm39)	missense	possibly damaging	0.57
R5437:Sorcs1	UTSW	19	50,241,040 (GRCm39)	missense	probably benign	0.19
R5574:Sorcs1	UTSW	19	50,210,571 (GRCm39)	missense	probably damaging	1.00
R5734:Sorcs1	UTSW	19	50,171,213 (GRCm39)	missense	probably benign	0.04
R6045:Sorcs1	UTSW	19	50,178,555 (GRCm39)	nonsense	probably null
R6091:Sorcs1	UTSW	19	50,276,539 (GRCm39)	missense	possibly damaging	0.64
R6119:Sorcs1	UTSW	19	50,276,532 (GRCm39)	missense	probably damaging	0.98
R6226:Sorcs1	UTSW	19	50,169,852 (GRCm39)	missense	probably damaging	1.00
R6337:Sorcs1	UTSW	19	50,132,562 (GRCm39)	missense	probably benign	0.00
R6378:Sorcs1	UTSW	19	50,213,615 (GRCm39)	missense	possibly damaging	0.57
R6782:Sorcs1	UTSW	19	50,164,560 (GRCm39)	nonsense	probably null
R6792:Sorcs1	UTSW	19	50,666,606 (GRCm39)	missense	probably benign
R6891:Sorcs1	UTSW	19	50,213,557 (GRCm39)	nonsense	probably null
R7151:Sorcs1	UTSW	19	50,301,420 (GRCm39)	missense	probably damaging	1.00
R7223:Sorcs1	UTSW	19	50,178,480 (GRCm39)	missense	probably benign	0.06
R7356:Sorcs1	UTSW	19	50,163,595 (GRCm39)	missense	possibly damaging	0.86
R7471:Sorcs1	UTSW	19	50,250,701 (GRCm39)	missense	probably damaging	1.00
R7474:Sorcs1	UTSW	19	50,141,550 (GRCm39)	missense	possibly damaging	0.65
R7503:Sorcs1	UTSW	19	50,141,490 (GRCm39)	missense	probably benign
R7506:Sorcs1	UTSW	19	50,171,112 (GRCm39)	nonsense	probably null
R7573:Sorcs1	UTSW	19	50,141,234 (GRCm39)	nonsense	probably null
R7867:Sorcs1	UTSW	19	50,218,698 (GRCm39)	nonsense	probably null
R7911:Sorcs1	UTSW	19	50,132,470 (GRCm39)	missense	unknown
R8032:Sorcs1	UTSW	19	50,463,846 (GRCm39)	missense	probably benign	0.28
R8463:Sorcs1	UTSW	19	50,248,248 (GRCm39)	missense	probably damaging	1.00
R8682:Sorcs1	UTSW	19	50,367,398 (GRCm39)	missense	probably damaging	0.99
R8724:Sorcs1	UTSW	19	50,139,658 (GRCm39)	missense	probably benign	0.33
R8926:Sorcs1	UTSW	19	50,241,096 (GRCm39)	missense	possibly damaging	0.94
R9160:Sorcs1	UTSW	19	50,213,658 (GRCm39)	missense	probably damaging	1.00
R9173:Sorcs1	UTSW	19	50,220,753 (GRCm39)	missense	possibly damaging	0.92
R9203:Sorcs1	UTSW	19	50,250,733 (GRCm39)	missense	probably damaging	1.00
R9229:Sorcs1	UTSW	19	50,141,300 (GRCm39)	missense	probably benign	0.17
R9398:Sorcs1	UTSW	19	50,213,651 (GRCm39)	missense	possibly damaging	0.90
R9430:Sorcs1	UTSW	19	50,199,208 (GRCm39)	missense	probably damaging	1.00
R9510:Sorcs1	UTSW	19	50,666,521 (GRCm39)	missense	probably benign	0.04
R9511:Sorcs1	UTSW	19	50,666,521 (GRCm39)	missense	probably benign	0.04
R9744:Sorcs1	UTSW	19	50,215,275 (GRCm39)	missense	probably damaging	1.00
R9777:Sorcs1	UTSW	19	50,248,190 (GRCm39)	critical splice donor site	probably null
X0024:Sorcs1	UTSW	19	50,171,201 (GRCm39)	missense	possibly damaging	0.92
Z1088:Sorcs1	UTSW	19	50,210,581 (GRCm39)	missense	probably benign	0.16
Z1177:Sorcs1	UTSW	19	50,322,037 (GRCm39)	missense	probably damaging	1.00
Z1177:Sorcs1	UTSW	19	50,215,180 (GRCm39)	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- GTCCAAGTGTATGAGGACTACATG -3'
(R):5'- GCAGCTTTTAGGTGTAAAGAAAGAC -3'

Sequencing Primer
(F):5'- TTAGAGGCCTACCACTGAGATGTTC -3'
(R):5'- TATTTTTCTAGAGGCTGGAGAGATC -3'

Posted On

2020-01-23