Incidental Mutation 'R4679:Sorcs1'
ID349966
Institutional Source Beutler Lab
Gene Symbol Sorcs1
Ensembl Gene ENSMUSG00000043531
Gene Namesortilin-related VPS10 domain containing receptor 1
Synonyms
MMRRC Submission 041932-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R4679 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location50143299-50678646 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 50182669 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 927 (Y927F)
Ref Sequence ENSEMBL: ENSMUSP00000147591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072685] [ENSMUST00000111756] [ENSMUST00000164039] [ENSMUST00000209413] [ENSMUST00000209783] [ENSMUST00000211008] [ENSMUST00000211687]
Predicted Effect probably benign
Transcript: ENSMUST00000072685
AA Change: Y927F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000072472
Gene: ENSMUSG00000043531
AA Change: Y927F

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111756
AA Change: Y927F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107386
Gene: ENSMUSG00000043531
AA Change: Y927F

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164039
AA Change: Y927F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132615
Gene: ENSMUSG00000043531
AA Change: Y927F

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
low complexity region 1129 1142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168357
SMART Domains Protein: ENSMUSP00000129190
Gene: ENSMUSG00000043531

DomainStartEndE-ValueType
VPS10 1 320 6.99e-58 SMART
PKD 322 412 3.84e-1 SMART
PKD 420 498 8.63e-1 SMART
transmembrane domain 621 643 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209413
AA Change: Y927F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000209783
AA Change: Y927F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000211008
AA Change: Y927F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000211687
AA Change: Y927F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0606 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 98% (112/114)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. Two of the five family members (sortilin and sortilin-related receptor) are synthesized as preproproteins; it is not yet known if this encoded protein is also a preproprotein. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Female mice homozygous for a null allele have abnormal amyloid beta levels in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik C T 4: 35,226,033 probably benign Het
AA986860 T A 1: 130,742,403 S121T possibly damaging Het
Abcb9 A G 5: 124,078,804 V450A probably benign Het
Abcg1 A T 17: 31,114,261 R659S probably benign Het
Acad9 A T 3: 36,088,840 N508I possibly damaging Het
Acrbp T A 6: 125,060,918 C393S probably damaging Het
Adcy7 T C 8: 88,317,937 V486A probably benign Het
Adgrf1 G T 17: 43,310,493 L540F probably damaging Het
Ap5m1 T C 14: 49,078,828 I285T probably benign Het
Arhgap27 G T 11: 103,360,949 probably benign Het
Armc5 A T 7: 128,240,104 E198V possibly damaging Het
Atp8b5 A T 4: 43,365,955 K742M probably benign Het
Atp9a T G 2: 168,661,964 T603P possibly damaging Het
Bsn A G 9: 108,110,130 S2808P unknown Het
Catsper4 T C 4: 134,226,605 N81S probably damaging Het
Ccl17 C G 8: 94,810,500 T10S probably benign Het
Cdc123 A T 2: 5,844,892 V6D probably damaging Het
Cdca2 T C 14: 67,714,966 K14E possibly damaging Het
Cdh3 C A 8: 106,539,856 T302K probably damaging Het
Cdh9 A G 15: 16,850,959 M605V probably benign Het
Cdk4 A G 10: 127,064,911 E144G possibly damaging Het
Clasp1 C T 1: 118,543,271 A879V probably damaging Het
Cldn8 G A 16: 88,562,408 H210Y probably benign Het
Cntn5 T C 9: 9,970,531 D518G probably benign Het
Cog1 C T 11: 113,652,290 A208V probably damaging Het
Col4a2 T A 8: 11,431,337 H836Q possibly damaging Het
Copb1 T C 7: 114,248,976 D108G probably damaging Het
Csmd3 A T 15: 48,161,083 Y600* probably null Het
Cyb5r1 T A 1: 134,407,833 H164Q probably benign Het
Dkc1 A G X: 75,100,992 I215V probably benign Het
Enpep A G 3: 129,303,713 probably null Het
Fam71b T A 11: 46,404,813 M4K possibly damaging Het
Fbln7 A G 2: 128,894,886 Y311C probably damaging Het
Fign A C 2: 63,979,261 L555R probably damaging Het
Fkbp7 A T 2: 76,671,688 probably benign Het
Fmn2 T C 1: 174,503,162 S373P unknown Het
Frmd4b C T 6: 97,295,666 D868N possibly damaging Het
Gfpt2 A G 11: 49,823,737 N321S probably benign Het
Glmn G T 5: 107,561,075 T372K probably damaging Het
Gm26602 C T 10: 79,910,974 probably benign Het
Gm6797 A G X: 8,639,694 noncoding transcript Het
Gpat3 T A 5: 100,893,456 F383L probably damaging Het
Grrp1 A G 4: 134,251,436 S244P probably damaging Het
H2-M11 C T 17: 36,548,150 T194I possibly damaging Het
Hcn1 C T 13: 117,657,015 H268Y probably benign Het
Hectd4 G T 5: 121,325,251 C2345F possibly damaging Het
Htt A G 5: 34,820,080 D770G probably benign Het
Ints3 T C 3: 90,408,510 T316A possibly damaging Het
Ipo9 A G 1: 135,394,169 F608L probably benign Het
Irak1 A C X: 74,022,389 probably benign Het
Jam2 G A 16: 84,812,952 V151M probably damaging Het
Lag3 T A 6: 124,904,545 Q488L possibly damaging Het
Large2 A T 2: 92,367,558 L266Q probably benign Het
Lrp3 T G 7: 35,203,940 D327A probably damaging Het
Mamstr C A 7: 45,644,692 probably benign Het
Mettl14 G A 3: 123,369,414 probably benign Het
Miga1 A G 3: 152,322,475 V139A probably damaging Het
Mthfd2l A C 5: 90,948,911 R130S probably benign Het
Myo1b A G 1: 51,757,973 I970T possibly damaging Het
Nat10 C A 2: 103,732,170 W607L probably damaging Het
Nop56 A G 2: 130,278,273 T183A probably benign Het
Olfr1258 A G 2: 89,930,664 Y285C possibly damaging Het
Olfr239 A G 17: 33,199,393 H115R probably benign Het
Olfr291 T A 7: 84,856,904 Y178* probably null Het
Olfr464 T A 11: 87,914,310 M199L probably benign Het
Olfr592 A G 7: 103,187,102 Y167C probably benign Het
Olfr710 A T 7: 106,944,945 S19T probably benign Het
Pcdhb12 T C 18: 37,436,949 F383L probably damaging Het
Pde4dip C A 3: 97,695,005 D2252Y probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Plscr2 T G 9: 92,287,770 L91R probably benign Het
Plxnc1 T A 10: 94,794,444 Y1531F probably damaging Het
Ptprq A T 10: 107,685,182 F710I probably benign Het
Rad51ap2 A G 12: 11,456,551 E158G probably damaging Het
Rasip1 T A 7: 45,627,823 H18Q possibly damaging Het
Rcsd1 T A 1: 165,655,924 N166I probably damaging Het
Ripor1 T A 8: 105,617,785 I517K possibly damaging Het
Ryr2 T A 13: 11,824,369 H506L probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sept14 T C 5: 129,693,026 D202G possibly damaging Het
Siglec1 A T 2: 131,073,411 L1420Q possibly damaging Het
Slc22a29 T A 19: 8,161,584 I505F possibly damaging Het
Spats2 T G 15: 99,180,722 M191R possibly damaging Het
Sycp1 C T 3: 102,922,462 probably null Het
T2 A G 17: 8,391,016 E99G possibly damaging Het
Taf3 G A 2: 10,048,564 probably benign Het
Tnfsf10 A T 3: 27,335,579 N263I probably damaging Het
Treml2 A T 17: 48,308,175 R229S probably benign Het
Trmt13 T C 3: 116,589,755 K125E probably damaging Het
Ttc9 G T 12: 81,631,601 C66F probably damaging Het
Vmn2r63 C T 7: 42,928,120 M331I probably benign Het
Zfp353-ps T C 8: 42,082,214 noncoding transcript Het
Zfp932 A T 5: 110,009,894 H486L probably damaging Het
Other mutations in Sorcs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Sorcs1 APN 19 50190054 missense probably damaging 1.00
IGL00983:Sorcs1 APN 19 50176128 missense probably damaging 0.98
IGL01125:Sorcs1 APN 19 50228201 missense probably damaging 1.00
IGL01320:Sorcs1 APN 19 50288079 splice site probably benign
IGL01445:Sorcs1 APN 19 50153066 missense probably damaging 1.00
IGL01682:Sorcs1 APN 19 50181506 missense probably benign 0.43
IGL01799:Sorcs1 APN 19 50230209 critical splice donor site probably null
IGL02044:Sorcs1 APN 19 50288159 splice site probably benign
IGL02111:Sorcs1 APN 19 50230245 missense probably benign 0.00
IGL02364:Sorcs1 APN 19 50333598 missense probably damaging 1.00
IGL02378:Sorcs1 APN 19 50182671 nonsense probably null
IGL02498:Sorcs1 APN 19 50678168 missense probably benign
IGL02658:Sorcs1 APN 19 50190092 missense probably damaging 1.00
IGL02939:Sorcs1 APN 19 50677930 nonsense probably null
IGL02942:Sorcs1 APN 19 50475437 missense probably damaging 1.00
IGL03057:Sorcs1 APN 19 50259756 nonsense probably null
IGL03230:Sorcs1 APN 19 50242093 missense probably damaging 1.00
P0033:Sorcs1 UTSW 19 50152907 missense probably damaging 0.98
R0109:Sorcs1 UTSW 19 50378891 splice site probably benign
R0115:Sorcs1 UTSW 19 50636453 intron probably benign
R0242:Sorcs1 UTSW 19 50228221 missense probably damaging 1.00
R0242:Sorcs1 UTSW 19 50228221 missense probably damaging 1.00
R0325:Sorcs1 UTSW 19 50313042 splice site probably null
R0481:Sorcs1 UTSW 19 50636453 intron probably benign
R0581:Sorcs1 UTSW 19 50252701 missense possibly damaging 0.70
R0669:Sorcs1 UTSW 19 50241942 splice site probably benign
R0980:Sorcs1 UTSW 19 50232323 missense probably benign 0.04
R1158:Sorcs1 UTSW 19 50144160 unclassified probably benign
R1519:Sorcs1 UTSW 19 50252587 missense probably benign 0.05
R1669:Sorcs1 UTSW 19 50475422 missense probably damaging 0.99
R1779:Sorcs1 UTSW 19 50175043 splice site probably benign
R1783:Sorcs1 UTSW 19 50228309 critical splice acceptor site probably null
R1927:Sorcs1 UTSW 19 50222195 missense probably damaging 1.00
R1935:Sorcs1 UTSW 19 50232644 missense probably damaging 0.96
R1936:Sorcs1 UTSW 19 50232644 missense probably damaging 0.96
R2109:Sorcs1 UTSW 19 50678192 missense probably benign
R2206:Sorcs1 UTSW 19 50230217 missense possibly damaging 0.81
R2207:Sorcs1 UTSW 19 50230217 missense possibly damaging 0.81
R3031:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R3032:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R3107:Sorcs1 UTSW 19 50210650 missense possibly damaging 0.83
R3508:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R3738:Sorcs1 UTSW 19 50151221 missense probably benign 0.03
R4127:Sorcs1 UTSW 19 50222159 missense probably benign 0.29
R4212:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R4213:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R4385:Sorcs1 UTSW 19 50190161 missense probably benign 0.01
R4424:Sorcs1 UTSW 19 50378941 missense probably damaging 0.97
R4603:Sorcs1 UTSW 19 50312964 critical splice donor site probably null
R4780:Sorcs1 UTSW 19 50143981 unclassified probably benign
R4781:Sorcs1 UTSW 19 50182681 missense probably damaging 1.00
R4823:Sorcs1 UTSW 19 50678140 missense possibly damaging 0.92
R4823:Sorcs1 UTSW 19 50230302 missense possibly damaging 0.87
R4883:Sorcs1 UTSW 19 50232303 missense probably benign 0.00
R5091:Sorcs1 UTSW 19 50259752 critical splice donor site probably null
R5105:Sorcs1 UTSW 19 50225141 missense possibly damaging 0.57
R5437:Sorcs1 UTSW 19 50252602 missense probably benign 0.19
R5574:Sorcs1 UTSW 19 50222133 missense probably damaging 1.00
R5734:Sorcs1 UTSW 19 50182775 missense probably benign 0.04
R6045:Sorcs1 UTSW 19 50190117 nonsense probably null
R6091:Sorcs1 UTSW 19 50288101 missense possibly damaging 0.64
R6119:Sorcs1 UTSW 19 50288094 missense probably damaging 0.98
R6226:Sorcs1 UTSW 19 50181414 missense probably damaging 1.00
R6337:Sorcs1 UTSW 19 50144124 missense probably benign 0.00
R6378:Sorcs1 UTSW 19 50225177 missense possibly damaging 0.57
R6782:Sorcs1 UTSW 19 50176122 nonsense probably null
R6792:Sorcs1 UTSW 19 50678168 missense probably benign
R6891:Sorcs1 UTSW 19 50225119 nonsense probably null
R7151:Sorcs1 UTSW 19 50312982 missense probably damaging 1.00
R7223:Sorcs1 UTSW 19 50190042 missense probably benign 0.06
R7356:Sorcs1 UTSW 19 50175157 missense possibly damaging 0.86
R7471:Sorcs1 UTSW 19 50262263 missense probably damaging 1.00
R7474:Sorcs1 UTSW 19 50153112 missense possibly damaging 0.65
R7503:Sorcs1 UTSW 19 50153052 missense probably benign
R7506:Sorcs1 UTSW 19 50182674 nonsense probably null
R7573:Sorcs1 UTSW 19 50152796 nonsense probably null
R7867:Sorcs1 UTSW 19 50230260 nonsense probably null
R7911:Sorcs1 UTSW 19 50144032 missense unknown
R7950:Sorcs1 UTSW 19 50230260 nonsense probably null
R7992:Sorcs1 UTSW 19 50144032 missense unknown
R8032:Sorcs1 UTSW 19 50475408 missense probably benign 0.28
R8063:Sorcs1 UTSW 19 50143977 missense unknown
X0024:Sorcs1 UTSW 19 50182763 missense possibly damaging 0.92
Z1088:Sorcs1 UTSW 19 50222143 missense probably benign 0.16
Z1177:Sorcs1 UTSW 19 50226742 missense probably null 1.00
Z1177:Sorcs1 UTSW 19 50333599 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGATGCATCACATGAGGTTAC -3'
(R):5'- ACAGTACAATGTCCCTTCTTTACAG -3'

Sequencing Primer
(F):5'- TACTGAGCACATATGGCCTG -3'
(R):5'- TCACAATCTTGGGGTTCACAG -3'
Posted On2015-10-08