Incidental Mutation 'R1936:Sorcs1'
ID215858
Institutional Source Beutler Lab
Gene Symbol Sorcs1
Ensembl Gene ENSMUSG00000043531
Gene Namesortilin-related VPS10 domain containing receptor 1
Synonyms
MMRRC Submission 039954-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R1936 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location50143299-50678646 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50232644 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 545 (D545G)
Ref Sequence ENSEMBL: ENSMUSP00000072472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072685] [ENSMUST00000111756] [ENSMUST00000164039] [ENSMUST00000209413] [ENSMUST00000209783] [ENSMUST00000211008] [ENSMUST00000211687]
Predicted Effect probably damaging
Transcript: ENSMUST00000072685
AA Change: D545G

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000072472
Gene: ENSMUSG00000043531
AA Change: D545G

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111756
AA Change: D545G

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107386
Gene: ENSMUSG00000043531
AA Change: D545G

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164039
AA Change: D545G

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132615
Gene: ENSMUSG00000043531
AA Change: D545G

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
low complexity region 1129 1142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168357
SMART Domains Protein: ENSMUSP00000129190
Gene: ENSMUSG00000043531

DomainStartEndE-ValueType
VPS10 1 320 6.99e-58 SMART
PKD 322 412 3.84e-1 SMART
PKD 420 498 8.63e-1 SMART
transmembrane domain 621 643 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000209413
AA Change: D545G

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000209783
AA Change: D545G

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000211008
AA Change: D545G

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000211687
AA Change: D545G

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.1473 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.7%
  • 20x: 93.5%
Validation Efficiency 99% (98/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. Two of the five family members (sortilin and sortilin-related receptor) are synthesized as preproproteins; it is not yet known if this encoded protein is also a preproprotein. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Female mice homozygous for a null allele have abnormal amyloid beta levels in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,917,080 Q226R possibly damaging Het
9930021J03Rik A G 19: 29,753,677 F712S possibly damaging Het
Abca13 G A 11: 9,293,595 M1819I probably benign Het
Abca4 G A 3: 122,052,923 V30M probably benign Het
Ablim1 T A 19: 57,215,965 probably null Het
Adgrf3 A T 5: 30,202,306 N207K probably benign Het
Anapc4 T A 5: 52,839,668 D94E probably damaging Het
Arfgef2 A G 2: 166,863,603 N918S probably benign Het
Arhgap45 A G 10: 80,030,954 N1097S probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
AU016765 G A 17: 64,519,878 noncoding transcript Het
Cacna2d2 T C 9: 107,509,256 F194S probably damaging Het
Cacna2d4 A G 6: 119,270,761 D341G possibly damaging Het
Ccdc129 G T 6: 55,897,681 L205F probably damaging Het
Cdc42bpg A G 19: 6,310,309 Y175C probably damaging Het
Cep170b G T 12: 112,735,738 D322Y probably damaging Het
Cflar T A 1: 58,752,625 Y362* probably null Het
Chml A T 1: 175,687,259 C365* probably null Het
Clrn3 A C 7: 135,514,024 I199S possibly damaging Het
Crtam G C 9: 41,004,550 P13A probably benign Het
Defb26 T A 2: 152,508,275 K28N possibly damaging Het
Dennd1c G A 17: 57,073,889 probably benign Het
Dgkz A T 2: 91,937,978 M761K possibly damaging Het
Dnhd1 A T 7: 105,673,976 M564L probably benign Het
Dusp15 A G 2: 152,945,421 probably benign Het
Dync2h1 A G 9: 7,139,159 probably null Het
Eapp A T 12: 54,673,728 M234K probably benign Het
Epha8 T C 4: 136,940,243 D309G probably benign Het
Gfi1b T C 2: 28,610,113 K302R possibly damaging Het
Gimap3 A T 6: 48,765,749 F82L probably damaging Het
Gm4862 T C 3: 139,128,492 noncoding transcript Het
Gpatch1 A G 7: 35,295,522 S440P probably damaging Het
Gpr152 A G 19: 4,142,532 D24G probably damaging Het
Gpr6 T C 10: 41,071,481 E35G probably benign Het
Hip1r T A 5: 123,996,071 M270K probably damaging Het
Hk3 C T 13: 55,011,391 V451I probably damaging Het
Jag1 C G 2: 137,083,473 V1070L possibly damaging Het
Klf16 G A 10: 80,576,905 A99V probably benign Het
Lama5 T C 2: 180,190,921 N1646S probably benign Het
Lvrn A T 18: 46,878,320 Y448F probably benign Het
Mark3 A G 12: 111,618,365 M132V probably damaging Het
Mast3 A G 8: 70,784,800 Y577H probably damaging Het
Med24 A T 11: 98,718,816 probably null Het
Mif G T 10: 75,859,847 H41N possibly damaging Het
Myo18b T C 5: 112,760,356 N2017S probably benign Het
Neurl4 C T 11: 69,907,133 R740C probably damaging Het
Nlgn1 G T 3: 26,331,790 probably benign Het
Olfr1095 A G 2: 86,851,401 M99T probably benign Het
Olfr288 T A 15: 98,187,581 H72L probably benign Het
Olfr319 T A 11: 58,702,346 L215Q probably damaging Het
Olfr870 A G 9: 20,171,181 L130P probably damaging Het
Paip1 T A 13: 119,457,014 M463K probably damaging Het
Parp3 T A 9: 106,474,732 Y147F probably damaging Het
Pgrmc2 C A 3: 41,083,038 probably benign Het
Phldb3 G A 7: 24,617,407 A278T probably benign Het
Plxnb1 T C 9: 109,095,647 probably null Het
Pphln1 A G 15: 93,488,987 D234G possibly damaging Het
Prdm2 T C 4: 143,134,462 S753G probably benign Het
Prss32 A G 17: 23,856,050 R125G possibly damaging Het
Psg22 A T 7: 18,719,710 N149I probably damaging Het
Psmd11 T C 11: 80,428,744 L20P probably damaging Het
Recql5 T C 11: 115,897,191 Y434C probably benign Het
Rexo1 A G 10: 80,550,469 S252P probably benign Het
Sdr9c7 A G 10: 127,903,634 K206R probably benign Het
Slc17a8 T C 10: 89,577,915 M484V probably benign Het
Slc1a2 A G 2: 102,777,605 N530D probably benign Het
Slc25a14 G A X: 48,651,963 V210I probably benign Het
Slc25a24 A T 3: 109,136,265 E79D probably damaging Het
Smchd1 T C 17: 71,463,791 Y132C probably damaging Het
Sorcs2 A G 5: 36,071,387 S104P possibly damaging Het
Speg C T 1: 75,431,408 T3249I possibly damaging Het
Spry4 A G 18: 38,590,089 I207T possibly damaging Het
Srsf6 C T 2: 162,934,483 probably benign Het
Tdrd6 A G 17: 43,626,467 L1230P probably damaging Het
Tesk2 A G 4: 116,741,824 Y43C probably benign Het
Tex101 A G 7: 24,668,225 V234A probably benign Het
Tmem161b T A 13: 84,293,466 L210Q probably damaging Het
Tmprss11f T A 5: 86,544,864 Q67L probably benign Het
Tnfrsf23 A G 7: 143,668,554 F174L probably benign Het
Tnrc6c A G 11: 117,756,023 D1450G possibly damaging Het
Trdmt1 A G 2: 13,511,609 L386P probably damaging Het
Trim25 A T 11: 89,004,750 T206S probably benign Het
Trit1 T C 4: 123,054,240 I451T probably benign Het
Trpc4 T A 3: 54,279,890 M421K probably damaging Het
Ttc34 G A 4: 154,865,682 A1031T possibly damaging Het
Ttn T A 2: 76,747,178 D24457V probably damaging Het
Ttn A C 2: 76,885,490 probably benign Het
Ubiad1 A G 4: 148,444,011 L147P probably damaging Het
Vmn2r94 G A 17: 18,244,292 R579* probably null Het
Vps72 T A 3: 95,122,540 V290D probably benign Het
Wipf2 C T 11: 98,892,410 R221* probably null Het
Zfp26 A G 9: 20,437,553 Y572H probably benign Het
Zfp292 A G 4: 34,807,452 V1864A probably benign Het
Zfp952 A T 17: 33,003,669 H374L possibly damaging Het
Zfy2 C A Y: 2,121,496 M132I probably benign Het
Other mutations in Sorcs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Sorcs1 APN 19 50190054 missense probably damaging 1.00
IGL00983:Sorcs1 APN 19 50176128 missense probably damaging 0.98
IGL01125:Sorcs1 APN 19 50228201 missense probably damaging 1.00
IGL01320:Sorcs1 APN 19 50288079 splice site probably benign
IGL01445:Sorcs1 APN 19 50153066 missense probably damaging 1.00
IGL01682:Sorcs1 APN 19 50181506 missense probably benign 0.43
IGL01799:Sorcs1 APN 19 50230209 critical splice donor site probably null
IGL02044:Sorcs1 APN 19 50288159 splice site probably benign
IGL02111:Sorcs1 APN 19 50230245 missense probably benign 0.00
IGL02364:Sorcs1 APN 19 50333598 missense probably damaging 1.00
IGL02378:Sorcs1 APN 19 50182671 nonsense probably null
IGL02498:Sorcs1 APN 19 50678168 missense probably benign
IGL02658:Sorcs1 APN 19 50190092 missense probably damaging 1.00
IGL02939:Sorcs1 APN 19 50677930 nonsense probably null
IGL02942:Sorcs1 APN 19 50475437 missense probably damaging 1.00
IGL03057:Sorcs1 APN 19 50259756 nonsense probably null
IGL03230:Sorcs1 APN 19 50242093 missense probably damaging 1.00
P0033:Sorcs1 UTSW 19 50152907 missense probably damaging 0.98
R0109:Sorcs1 UTSW 19 50378891 splice site probably benign
R0115:Sorcs1 UTSW 19 50636453 intron probably benign
R0242:Sorcs1 UTSW 19 50228221 missense probably damaging 1.00
R0242:Sorcs1 UTSW 19 50228221 missense probably damaging 1.00
R0325:Sorcs1 UTSW 19 50313042 splice site probably null
R0481:Sorcs1 UTSW 19 50636453 intron probably benign
R0581:Sorcs1 UTSW 19 50252701 missense possibly damaging 0.70
R0669:Sorcs1 UTSW 19 50241942 splice site probably benign
R0980:Sorcs1 UTSW 19 50232323 missense probably benign 0.04
R1158:Sorcs1 UTSW 19 50144160 unclassified probably benign
R1519:Sorcs1 UTSW 19 50252587 missense probably benign 0.05
R1669:Sorcs1 UTSW 19 50475422 missense probably damaging 0.99
R1779:Sorcs1 UTSW 19 50175043 splice site probably benign
R1783:Sorcs1 UTSW 19 50228309 critical splice acceptor site probably null
R1927:Sorcs1 UTSW 19 50222195 missense probably damaging 1.00
R1935:Sorcs1 UTSW 19 50232644 missense probably damaging 0.96
R2109:Sorcs1 UTSW 19 50678192 missense probably benign
R2206:Sorcs1 UTSW 19 50230217 missense possibly damaging 0.81
R2207:Sorcs1 UTSW 19 50230217 missense possibly damaging 0.81
R3031:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R3032:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R3107:Sorcs1 UTSW 19 50210650 missense possibly damaging 0.83
R3508:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R3738:Sorcs1 UTSW 19 50151221 missense probably benign 0.03
R4127:Sorcs1 UTSW 19 50222159 missense probably benign 0.29
R4212:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R4213:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R4385:Sorcs1 UTSW 19 50190161 missense probably benign 0.01
R4424:Sorcs1 UTSW 19 50378941 missense probably damaging 0.97
R4603:Sorcs1 UTSW 19 50312964 critical splice donor site probably null
R4679:Sorcs1 UTSW 19 50182669 missense probably benign
R4780:Sorcs1 UTSW 19 50143981 unclassified probably benign
R4781:Sorcs1 UTSW 19 50182681 missense probably damaging 1.00
R4823:Sorcs1 UTSW 19 50678140 missense possibly damaging 0.92
R4823:Sorcs1 UTSW 19 50230302 missense possibly damaging 0.87
R4883:Sorcs1 UTSW 19 50232303 missense probably benign 0.00
R5091:Sorcs1 UTSW 19 50259752 critical splice donor site probably null
R5105:Sorcs1 UTSW 19 50225141 missense possibly damaging 0.57
R5437:Sorcs1 UTSW 19 50252602 missense probably benign 0.19
R5574:Sorcs1 UTSW 19 50222133 missense probably damaging 1.00
R5734:Sorcs1 UTSW 19 50182775 missense probably benign 0.04
R6045:Sorcs1 UTSW 19 50190117 nonsense probably null
R6091:Sorcs1 UTSW 19 50288101 missense possibly damaging 0.64
R6119:Sorcs1 UTSW 19 50288094 missense probably damaging 0.98
R6226:Sorcs1 UTSW 19 50181414 missense probably damaging 1.00
R6337:Sorcs1 UTSW 19 50144124 missense probably benign 0.00
R6378:Sorcs1 UTSW 19 50225177 missense possibly damaging 0.57
R6782:Sorcs1 UTSW 19 50176122 nonsense probably null
R6792:Sorcs1 UTSW 19 50678168 missense probably benign
R6891:Sorcs1 UTSW 19 50225119 nonsense probably null
R7151:Sorcs1 UTSW 19 50312982 missense probably damaging 1.00
R7223:Sorcs1 UTSW 19 50190042 missense probably benign 0.06
R7356:Sorcs1 UTSW 19 50175157 missense possibly damaging 0.86
R7471:Sorcs1 UTSW 19 50262263 missense probably damaging 1.00
R7474:Sorcs1 UTSW 19 50153112 missense possibly damaging 0.65
R7503:Sorcs1 UTSW 19 50153052 missense probably benign
R7506:Sorcs1 UTSW 19 50182674 nonsense probably null
R7573:Sorcs1 UTSW 19 50152796 nonsense probably null
R7867:Sorcs1 UTSW 19 50230260 nonsense probably null
R7911:Sorcs1 UTSW 19 50144032 missense unknown
R7950:Sorcs1 UTSW 19 50230260 nonsense probably null
R7992:Sorcs1 UTSW 19 50144032 missense unknown
R8032:Sorcs1 UTSW 19 50475408 missense probably benign 0.28
R8063:Sorcs1 UTSW 19 50143977 missense unknown
X0024:Sorcs1 UTSW 19 50182763 missense possibly damaging 0.92
Z1088:Sorcs1 UTSW 19 50222143 missense probably benign 0.16
Z1177:Sorcs1 UTSW 19 50226742 missense probably null 1.00
Z1177:Sorcs1 UTSW 19 50333599 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTCAACTGCAAACATTCTG -3'
(R):5'- CCTCAGAACTTACAGTACAAAGTTG -3'

Sequencing Primer
(F):5'- TCAACTGCAAACATTCTGTCTAAAC -3'
(R):5'- GATCTAATCTTGTAGGCAACGTGC -3'
Posted On2014-07-14