Incidental Mutation 'R5069:Actn2'
ID388565
Institutional Source Beutler Lab
Gene Symbol Actn2
Ensembl Gene ENSMUSG00000052374
Gene Nameactinin alpha 2
Synonyms
MMRRC Submission 042659-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.600) question?
Stock #R5069 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location12269426-12340760 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12288522 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 464 (I464T)
Ref Sequence ENSEMBL: ENSMUSP00000129609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064204] [ENSMUST00000168193]
Predicted Effect possibly damaging
Transcript: ENSMUST00000064204
AA Change: I464T

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000067708
Gene: ENSMUSG00000052374
AA Change: I464T

DomainStartEndE-ValueType
CH 40 140 5.22e-23 SMART
CH 153 252 1.77e-25 SMART
low complexity region 255 266 N/A INTRINSIC
Pfam:Spectrin 281 391 2e-16 PFAM
SPEC 404 505 5.81e-24 SMART
SPEC 519 626 6.75e-11 SMART
SPEC 640 739 1.26e0 SMART
EFh 757 785 8.16e-1 SMART
EFh 793 821 7.7e-3 SMART
efhand_Ca_insen 824 890 3.9e-37 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168193
AA Change: I464T

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129609
Gene: ENSMUSG00000052374
AA Change: I464T

DomainStartEndE-ValueType
CH 40 140 5.22e-23 SMART
CH 153 252 1.77e-25 SMART
low complexity region 255 266 N/A INTRINSIC
Pfam:Spectrin 281 391 7e-18 PFAM
SPEC 404 505 5.81e-24 SMART
SPEC 519 626 6.75e-11 SMART
SPEC 640 739 1.26e0 SMART
EFh 757 785 8.16e-1 SMART
EFh 793 821 7.7e-3 SMART
efhand_Ca_insen 824 890 3.9e-37 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha actinins belong to the spectrin gene superfamily which represents a diverse group of cytoskeletal proteins, including the alpha and beta spectrins and dystrophins. Alpha actinin is an actin-binding protein with multiple roles in different cell types. In nonmuscle cells, the cytoskeletal isoform is found along microfilament bundles and adherens-type junctions, where it is involved in binding actin to the membrane. In contrast, skeletal, cardiac, and smooth muscle isoforms are localized to the Z-disc and analogous dense bodies, where they help anchor the myofibrillar actin filaments. This gene encodes a muscle-specific, alpha actinin isoform that is expressed in both skeletal and cardiac muscles. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,661,792 S739P possibly damaging Het
9330182L06Rik T A 5: 9,440,897 C636S probably damaging Het
Adcy7 T C 8: 88,327,697 L1060P probably damaging Het
Aff3 A G 1: 38,181,613 probably null Het
Ankar T C 1: 72,680,210 probably null Het
Ankrd27 A T 7: 35,628,435 K793N probably damaging Het
Arhgef28 T C 13: 98,075,206 T90A probably damaging Het
Armc9 A T 1: 86,257,237 H670L probably benign Het
Arvcf A G 16: 18,398,986 Y412C probably damaging Het
Ass1 C T 2: 31,510,173 T301M probably damaging Het
Baiap3 A T 17: 25,249,108 C283S probably damaging Het
BC055324 T C 1: 163,987,674 T93A possibly damaging Het
Birc6 C T 17: 74,565,972 R409C probably damaging Het
Calcoco1 A G 15: 102,711,092 L354P probably damaging Het
Cdh3 A G 8: 106,536,826 N126S probably benign Het
Cfap54 A C 10: 92,937,774 F135L probably benign Het
Dlg1 G T 16: 31,684,295 probably null Het
Dnah3 T C 7: 120,032,790 H1314R probably benign Het
Dsp A C 13: 38,197,123 T2615P possibly damaging Het
Enpp2 T C 15: 54,864,054 Y513C probably damaging Het
Ercc6 T C 14: 32,570,063 V1128A probably benign Het
Gipc2 A G 3: 152,094,248 F282L probably benign Het
Gm1043 T G 5: 37,187,236 L231R probably damaging Het
Gm13178 T A 4: 144,703,867 D184V probably damaging Het
Gm14085 A T 2: 122,494,373 N142I possibly damaging Het
Gm14685 T C X: 73,127,971 I323T probably damaging Het
Gpr153 T A 4: 152,279,883 M132K probably damaging Het
Hbs1l T A 10: 21,354,647 S496T probably damaging Het
Inpp5f A G 7: 128,676,727 probably null Het
Kat6a G A 8: 22,903,133 C209Y probably damaging Het
Kcna2 T A 3: 107,104,637 V178D probably damaging Het
Krt75 A G 15: 101,566,238 probably null Het
Letm2 G A 8: 25,593,964 Q84* probably null Het
Mib1 A G 18: 10,793,002 E646G probably damaging Het
Mmp14 T A 14: 54,439,113 Y372N probably damaging Het
Muc6 A G 7: 141,651,299 C218R probably damaging Het
Myof A T 19: 37,905,325 I1130N possibly damaging Het
Neil3 A G 8: 53,601,041 S318P possibly damaging Het
Nhlh1 A G 1: 172,053,900 V133A probably benign Het
Nup153 A C 13: 46,709,792 S331A probably benign Het
Nup98 T C 7: 102,145,655 T882A probably benign Het
Olfr1413 T A 1: 92,573,413 S81T probably damaging Het
Olfr599 A T 7: 103,338,022 probably null Het
Olfr744 T A 14: 50,618,740 C173S probably damaging Het
Olfr749 C A 14: 50,737,074 L29F probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pald1 A T 10: 61,341,246 M675K possibly damaging Het
Pex5 A G 6: 124,413,596 S97P probably benign Het
Pitpnm1 C T 19: 4,111,140 A897V probably benign Het
Plxnd1 A T 6: 115,965,901 V1274E probably damaging Het
Polr2a T C 11: 69,736,735 probably null Het
Ppfia1 G A 7: 144,514,473 Q446* probably null Het
Psma2 G A 13: 14,616,028 V20I probably benign Het
Rhbdl2 T A 4: 123,817,917 L149* probably null Het
Rnf17 T C 14: 56,505,928 V1317A probably damaging Het
Rtel1 G A 2: 181,355,492 V1042M probably benign Het
Sidt2 A T 9: 45,939,461 probably null Het
Slc11a1 G A 1: 74,385,184 A434T probably damaging Het
Slc4a10 G A 2: 62,267,571 R508H probably benign Het
Slc5a8 A T 10: 88,886,598 I98F possibly damaging Het
Slf2 T A 19: 44,935,253 S169T possibly damaging Het
Snx33 A T 9: 56,926,191 I198N probably damaging Het
Spock3 A G 8: 63,355,265 T396A probably benign Het
Sva A T 6: 42,038,417 probably benign Het
Syt7 A G 19: 10,439,237 N261S probably benign Het
Taar7b T G 10: 24,000,461 S175A probably benign Het
Thoc2 C T X: 41,806,693 E1491K probably damaging Het
Tlr1 T C 5: 64,926,400 Y278C probably benign Het
Tph2 T A 10: 115,151,174 Y237F probably benign Het
Trim35 C T 14: 66,308,972 probably benign Het
Trpm4 T G 7: 45,310,469 Y667S probably damaging Het
Ttc27 T A 17: 74,799,342 H541Q probably damaging Het
Ube4a T C 9: 44,940,089 H709R probably damaging Het
Vwa7 G A 17: 35,024,190 V615I probably benign Het
Wars2 A G 3: 99,187,533 H48R probably damaging Het
Xlr4c T A X: 73,238,684 K121M probably damaging Het
Zfc3h1 T A 10: 115,418,783 C1427* probably null Het
Other mutations in Actn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01469:Actn2 APN 13 12310910 missense possibly damaging 0.50
IGL01909:Actn2 APN 13 12309593 critical splice donor site probably null
IGL01994:Actn2 APN 13 12290677 missense probably benign 0.26
IGL02118:Actn2 APN 13 12276547 intron probably benign
IGL02480:Actn2 APN 13 12276478 missense probably benign 0.02
IGL02827:Actn2 APN 13 12275199 missense probably damaging 1.00
IGL03110:Actn2 APN 13 12309607 missense probably benign 0.02
R0044:Actn2 UTSW 13 12275127 missense possibly damaging 0.51
R0512:Actn2 UTSW 13 12277415 missense probably damaging 1.00
R1623:Actn2 UTSW 13 12340439 missense probably benign
R1983:Actn2 UTSW 13 12278810 missense probably benign 0.00
R1989:Actn2 UTSW 13 12340395 missense probably benign 0.38
R2148:Actn2 UTSW 13 12300949 missense probably damaging 0.99
R2196:Actn2 UTSW 13 12275179 missense probably damaging 0.99
R2254:Actn2 UTSW 13 12296479 missense probably benign 0.20
R2850:Actn2 UTSW 13 12275179 missense probably damaging 0.99
R4391:Actn2 UTSW 13 12290748 missense probably damaging 0.99
R4396:Actn2 UTSW 13 12310879 missense probably damaging 1.00
R4758:Actn2 UTSW 13 12288586 nonsense probably null
R5068:Actn2 UTSW 13 12288522 missense possibly damaging 0.78
R5070:Actn2 UTSW 13 12288522 missense possibly damaging 0.78
R5228:Actn2 UTSW 13 12288659 critical splice acceptor site probably null
R5382:Actn2 UTSW 13 12308951 missense probably benign 0.37
R5408:Actn2 UTSW 13 12270795 missense probably benign 0.41
R5975:Actn2 UTSW 13 12340497 missense probably benign 0.43
R6189:Actn2 UTSW 13 12276440 missense probably damaging 1.00
R6226:Actn2 UTSW 13 12278967 missense probably benign
R6498:Actn2 UTSW 13 12276473 missense probably damaging 1.00
R7094:Actn2 UTSW 13 12309657 missense probably damaging 1.00
R7164:Actn2 UTSW 13 12278961 missense probably damaging 1.00
R7218:Actn2 UTSW 13 12278913 missense probably benign 0.33
R7260:Actn2 UTSW 13 12276490 missense probably benign 0.00
R7768:Actn2 UTSW 13 12282594 missense possibly damaging 0.72
R7896:Actn2 UTSW 13 12294317 missense possibly damaging 0.76
R8141:Actn2 UTSW 13 12288630 missense probably damaging 1.00
R8702:Actn2 UTSW 13 12282529 missense probably damaging 1.00
R8785:Actn2 UTSW 13 12277431 missense probably benign 0.02
X0018:Actn2 UTSW 13 12269645 missense probably damaging 1.00
Z1177:Actn2 UTSW 13 12288562 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCATCATCCCTAGGGGCAG -3'
(R):5'- TACATCCTAGGCAAGCCCTC -3'

Sequencing Primer
(F):5'- AGCAGCCTGACCCTTTGAG -3'
(R):5'- CCAGGCTGTCCTTGAACTGTAG -3'
Posted On2016-06-06