Mutagenetix > Incidental Mutation

Incidental Mutation 'R5069:Actn2'

388565

Institutional Source

Beutler Lab

Gene Symbol

Actn2

Ensembl Gene

ENSMUSG00000052374

Gene Name

actinin alpha 2

Synonyms

MMRRC Submission

042659-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.526) question?

Stock #

R5069 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

12269426-12340760 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 12288522 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 464 (I464T)

Ref Sequence

ENSEMBL: ENSMUSP00000129609 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064204] [ENSMUST00000168193]

AlphaFold

Q9JI91

Predicted Effect

possibly damaging
Transcript: ENSMUST00000064204
AA Change: I464T

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000067708
Gene: ENSMUSG00000052374
AA Change: I464T

Domain	Start	End	E-Value	Type
CH	40	140	5.22e-23	SMART
CH	153	252	1.77e-25	SMART
low complexity region	255	266	N/A	INTRINSIC
Pfam:Spectrin	281	391	2e-16	PFAM
SPEC	404	505	5.81e-24	SMART
SPEC	519	626	6.75e-11	SMART
SPEC	640	739	1.26e0	SMART
EFh	757	785	8.16e-1	SMART
EFh	793	821	7.7e-3	SMART
efhand_Ca_insen	824	890	3.9e-37	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000168193
AA Change: I464T

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000129609
Gene: ENSMUSG00000052374
AA Change: I464T

Domain	Start	End	E-Value	Type
CH	40	140	5.22e-23	SMART
CH	153	252	1.77e-25	SMART
low complexity region	255	266	N/A	INTRINSIC
Pfam:Spectrin	281	391	7e-18	PFAM
SPEC	404	505	5.81e-24	SMART
SPEC	519	626	6.75e-11	SMART
SPEC	640	739	1.26e0	SMART
EFh	757	785	8.16e-1	SMART
EFh	793	821	7.7e-3	SMART
efhand_Ca_insen	824	890	3.9e-37	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha actinins belong to the spectrin gene superfamily which represents a diverse group of cytoskeletal proteins, including the alpha and beta spectrins and dystrophins. Alpha actinin is an actin-binding protein with multiple roles in different cell types. In nonmuscle cells, the cytoskeletal isoform is found along microfilament bundles and adherens-type junctions, where it is involved in binding actin to the membrane. In contrast, skeletal, cardiac, and smooth muscle isoforms are localized to the Z-disc and analogous dense bodies, where they help anchor the myofibrillar actin filaments. This gene encodes a muscle-specific, alpha actinin isoform that is expressed in both skeletal and cardiac muscles. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2013]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	A	G	14: 32,661,792	S739P	possibly damaging	Het
9330182L06Rik	T	A	5: 9,440,897	C636S	probably damaging	Het
Adcy7	T	C	8: 88,327,697	L1060P	probably damaging	Het
Aff3	A	G	1: 38,181,613		probably null	Het
Ankar	T	C	1: 72,680,210		probably null	Het
Ankrd27	A	T	7: 35,628,435	K793N	probably damaging	Het
Arhgef28	T	C	13: 98,075,206	T90A	probably damaging	Het
Armc9	A	T	1: 86,257,237	H670L	probably benign	Het
Arvcf	A	G	16: 18,398,986	Y412C	probably damaging	Het
Ass1	C	T	2: 31,510,173	T301M	probably damaging	Het
Baiap3	A	T	17: 25,249,108	C283S	probably damaging	Het
BC055324	T	C	1: 163,987,674	T93A	possibly damaging	Het
Birc6	C	T	17: 74,565,972	R409C	probably damaging	Het
Calcoco1	A	G	15: 102,711,092	L354P	probably damaging	Het
Cdh3	A	G	8: 106,536,826	N126S	probably benign	Het
Cfap54	A	C	10: 92,937,774	F135L	probably benign	Het
Dlg1	G	T	16: 31,684,295		probably null	Het
Dnah3	T	C	7: 120,032,790	H1314R	probably benign	Het
Dsp	A	C	13: 38,197,123	T2615P	possibly damaging	Het
Enpp2	T	C	15: 54,864,054	Y513C	probably damaging	Het
Ercc6	T	C	14: 32,570,063	V1128A	probably benign	Het
Gipc2	A	G	3: 152,094,248	F282L	probably benign	Het
Gm1043	T	G	5: 37,187,236	L231R	probably damaging	Het
Gm13178	T	A	4: 144,703,867	D184V	probably damaging	Het
Gm14085	A	T	2: 122,494,373	N142I	possibly damaging	Het
Gm14685	T	C	X: 73,127,971	I323T	probably damaging	Het
Gpr153	T	A	4: 152,279,883	M132K	probably damaging	Het
Hbs1l	T	A	10: 21,354,647	S496T	probably damaging	Het
Inpp5f	A	G	7: 128,676,727		probably null	Het
Kat6a	G	A	8: 22,903,133	C209Y	probably damaging	Het
Kcna2	T	A	3: 107,104,637	V178D	probably damaging	Het
Krt75	A	G	15: 101,566,238		probably null	Het
Letm2	G	A	8: 25,593,964	Q84*	probably null	Het
Mib1	A	G	18: 10,793,002	E646G	probably damaging	Het
Mmp14	T	A	14: 54,439,113	Y372N	probably damaging	Het
Muc6	A	G	7: 141,651,299	C218R	probably damaging	Het
Myof	A	T	19: 37,905,325	I1130N	possibly damaging	Het
Neil3	A	G	8: 53,601,041	S318P	possibly damaging	Het
Nhlh1	A	G	1: 172,053,900	V133A	probably benign	Het
Nup153	A	C	13: 46,709,792	S331A	probably benign	Het
Nup98	T	C	7: 102,145,655	T882A	probably benign	Het
Olfr1413	T	A	1: 92,573,413	S81T	probably damaging	Het
Olfr599	A	T	7: 103,338,022		probably null	Het
Olfr744	T	A	14: 50,618,740	C173S	probably damaging	Het
Olfr749	C	A	14: 50,737,074	L29F	probably benign	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pald1	A	T	10: 61,341,246	M675K	possibly damaging	Het
Pex5	A	G	6: 124,413,596	S97P	probably benign	Het
Pitpnm1	C	T	19: 4,111,140	A897V	probably benign	Het
Plxnd1	A	T	6: 115,965,901	V1274E	probably damaging	Het
Polr2a	T	C	11: 69,736,735		probably null	Het
Ppfia1	G	A	7: 144,514,473	Q446*	probably null	Het
Psma2	G	A	13: 14,616,028	V20I	probably benign	Het
Rhbdl2	T	A	4: 123,817,917	L149*	probably null	Het
Rnf17	T	C	14: 56,505,928	V1317A	probably damaging	Het
Rtel1	G	A	2: 181,355,492	V1042M	probably benign	Het
Sidt2	A	T	9: 45,939,461		probably null	Het
Slc11a1	G	A	1: 74,385,184	A434T	probably damaging	Het
Slc4a10	G	A	2: 62,267,571	R508H	probably benign	Het
Slc5a8	A	T	10: 88,886,598	I98F	possibly damaging	Het
Slf2	T	A	19: 44,935,253	S169T	possibly damaging	Het
Snx33	A	T	9: 56,926,191	I198N	probably damaging	Het
Spock3	A	G	8: 63,355,265	T396A	probably benign	Het
Sva	A	T	6: 42,038,417		probably benign	Het
Syt7	A	G	19: 10,439,237	N261S	probably benign	Het
Taar7b	T	G	10: 24,000,461	S175A	probably benign	Het
Thoc2	C	T	X: 41,806,693	E1491K	probably damaging	Het
Tlr1	T	C	5: 64,926,400	Y278C	probably benign	Het
Tph2	T	A	10: 115,151,174	Y237F	probably benign	Het
Trim35	C	T	14: 66,308,972		probably benign	Het
Trpm4	T	G	7: 45,310,469	Y667S	probably damaging	Het
Ttc27	T	A	17: 74,799,342	H541Q	probably damaging	Het
Ube4a	T	C	9: 44,940,089	H709R	probably damaging	Het
Vwa7	G	A	17: 35,024,190	V615I	probably benign	Het
Wars2	A	G	3: 99,187,533	H48R	probably damaging	Het
Xlr4c	T	A	X: 73,238,684	K121M	probably damaging	Het
Zfc3h1	T	A	10: 115,418,783	C1427*	probably null	Het

Other mutations in Actn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01469:Actn2	APN	13	12310910	missense	possibly damaging	0.50
IGL01909:Actn2	APN	13	12309593	critical splice donor site	probably null
IGL01994:Actn2	APN	13	12290677	missense	probably benign	0.26
IGL02118:Actn2	APN	13	12276547	intron	probably benign
IGL02480:Actn2	APN	13	12276478	missense	probably benign	0.02
IGL02827:Actn2	APN	13	12275199	missense	probably damaging	1.00
IGL03110:Actn2	APN	13	12309607	missense	probably benign	0.02
R0044:Actn2	UTSW	13	12275127	missense	possibly damaging	0.51
R0512:Actn2	UTSW	13	12277415	missense	probably damaging	1.00
R1623:Actn2	UTSW	13	12340439	missense	probably benign
R1983:Actn2	UTSW	13	12278810	missense	probably benign	0.00
R1989:Actn2	UTSW	13	12340395	missense	probably benign	0.38
R2148:Actn2	UTSW	13	12300949	missense	probably damaging	0.99
R2196:Actn2	UTSW	13	12275179	missense	probably damaging	0.99
R2254:Actn2	UTSW	13	12296479	missense	probably benign	0.20
R2850:Actn2	UTSW	13	12275179	missense	probably damaging	0.99
R4391:Actn2	UTSW	13	12290748	missense	probably damaging	0.99
R4396:Actn2	UTSW	13	12310879	missense	probably damaging	1.00
R4758:Actn2	UTSW	13	12288586	nonsense	probably null
R5068:Actn2	UTSW	13	12288522	missense	possibly damaging	0.78
R5070:Actn2	UTSW	13	12288522	missense	possibly damaging	0.78
R5228:Actn2	UTSW	13	12288659	critical splice acceptor site	probably null
R5382:Actn2	UTSW	13	12308951	missense	probably benign	0.37
R5408:Actn2	UTSW	13	12270795	missense	probably benign	0.41
R5975:Actn2	UTSW	13	12340497	missense	probably benign	0.43
R6189:Actn2	UTSW	13	12276440	missense	probably damaging	1.00
R6226:Actn2	UTSW	13	12278967	missense	probably benign
R6498:Actn2	UTSW	13	12276473	missense	probably damaging	1.00
R7094:Actn2	UTSW	13	12309657	missense	probably damaging	1.00
R7164:Actn2	UTSW	13	12278961	missense	probably damaging	1.00
R7218:Actn2	UTSW	13	12278913	missense	probably benign	0.33
R7260:Actn2	UTSW	13	12276490	missense	probably benign	0.00
R7768:Actn2	UTSW	13	12282594	missense	possibly damaging	0.72
R7896:Actn2	UTSW	13	12294317	missense	possibly damaging	0.76
R8141:Actn2	UTSW	13	12288630	missense	probably damaging	1.00
R8702:Actn2	UTSW	13	12282529	missense	probably damaging	1.00
R8785:Actn2	UTSW	13	12277431	missense	probably benign	0.02
R9028:Actn2	UTSW	13	12300978	missense	possibly damaging	0.90
R9099:Actn2	UTSW	13	12288630	missense	probably damaging	1.00
R9517:Actn2	UTSW	13	12280431	missense	probably damaging	0.97
X0018:Actn2	UTSW	13	12269645	missense	probably damaging	1.00
Z1177:Actn2	UTSW	13	12288562	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATCATCATCCCTAGGGGCAG -3'
(R):5'- TACATCCTAGGCAAGCCCTC -3'

Sequencing Primer
(F):5'- AGCAGCCTGACCCTTTGAG -3'
(R):5'- CCAGGCTGTCCTTGAACTGTAG -3'

Posted On

2016-06-06