Incidental Mutation 'R5069:Sidt2'
ID388554
Institutional Source Beutler Lab
Gene Symbol Sidt2
Ensembl Gene ENSMUSG00000034908
Gene NameSID1 transmembrane family, member 2
SynonymsCGI-40
MMRRC Submission 042659-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.240) question?
Stock #R5069 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location45937857-45955258 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 45939461 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034590] [ENSMUST00000038488] [ENSMUST00000114573] [ENSMUST00000160618] [ENSMUST00000215509]
Predicted Effect probably null
Transcript: ENSMUST00000034590
SMART Domains Protein: ENSMUSP00000034590
Gene: ENSMUSG00000032085

DomainStartEndE-ValueType
CH 26 133 1.53e-20 SMART
Pfam:Calponin 175 199 5.5e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000038488
AA Change: D794E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000044290
Gene: ENSMUSG00000034908
AA Change: D794E

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:SID-1_RNA_chan 169 832 8.5e-214 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114573
AA Change: D815E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110220
Gene: ENSMUSG00000034908
AA Change: D815E

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:SID-1_RNA_chan 169 853 9e-290 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000159033
AA Change: D51E
SMART Domains Protein: ENSMUSP00000125273
Gene: ENSMUSG00000034908
AA Change: D51E

DomainStartEndE-ValueType
low complexity region 12 29 N/A INTRINSIC
Pfam:SID-1_RNA_chan 30 74 1e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160598
Predicted Effect probably benign
Transcript: ENSMUST00000160618
SMART Domains Protein: ENSMUSP00000125037
Gene: ENSMUSG00000034908

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160670
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160927
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184840
Predicted Effect probably null
Transcript: ENSMUST00000215509
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216035
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit male-specific decreased body weight and size, impaired glucose tolerance, increased serum glucose, decreased serum insulin and decreased insule granule release from beta cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,661,792 S739P possibly damaging Het
9330182L06Rik T A 5: 9,440,897 C636S probably damaging Het
Actn2 A G 13: 12,288,522 I464T possibly damaging Het
Adcy7 T C 8: 88,327,697 L1060P probably damaging Het
Aff3 A G 1: 38,181,613 probably null Het
Ankar T C 1: 72,680,210 probably null Het
Ankrd27 A T 7: 35,628,435 K793N probably damaging Het
Arhgef28 T C 13: 98,075,206 T90A probably damaging Het
Armc9 A T 1: 86,257,237 H670L probably benign Het
Arvcf A G 16: 18,398,986 Y412C probably damaging Het
Ass1 C T 2: 31,510,173 T301M probably damaging Het
Baiap3 A T 17: 25,249,108 C283S probably damaging Het
BC055324 T C 1: 163,987,674 T93A possibly damaging Het
Birc6 C T 17: 74,565,972 R409C probably damaging Het
Calcoco1 A G 15: 102,711,092 L354P probably damaging Het
Cdh3 A G 8: 106,536,826 N126S probably benign Het
Cfap54 A C 10: 92,937,774 F135L probably benign Het
Dlg1 G T 16: 31,684,295 probably null Het
Dnah3 T C 7: 120,032,790 H1314R probably benign Het
Dsp A C 13: 38,197,123 T2615P possibly damaging Het
Enpp2 T C 15: 54,864,054 Y513C probably damaging Het
Ercc6 T C 14: 32,570,063 V1128A probably benign Het
Gipc2 A G 3: 152,094,248 F282L probably benign Het
Gm1043 T G 5: 37,187,236 L231R probably damaging Het
Gm13178 T A 4: 144,703,867 D184V probably damaging Het
Gm14085 A T 2: 122,494,373 N142I possibly damaging Het
Gm14685 T C X: 73,127,971 I323T probably damaging Het
Gpr153 T A 4: 152,279,883 M132K probably damaging Het
Hbs1l T A 10: 21,354,647 S496T probably damaging Het
Inpp5f A G 7: 128,676,727 probably null Het
Kat6a G A 8: 22,903,133 C209Y probably damaging Het
Kcna2 T A 3: 107,104,637 V178D probably damaging Het
Krt75 A G 15: 101,566,238 probably null Het
Letm2 G A 8: 25,593,964 Q84* probably null Het
Mib1 A G 18: 10,793,002 E646G probably damaging Het
Mmp14 T A 14: 54,439,113 Y372N probably damaging Het
Muc6 A G 7: 141,651,299 C218R probably damaging Het
Myof A T 19: 37,905,325 I1130N possibly damaging Het
Neil3 A G 8: 53,601,041 S318P possibly damaging Het
Nhlh1 A G 1: 172,053,900 V133A probably benign Het
Nup153 A C 13: 46,709,792 S331A probably benign Het
Nup98 T C 7: 102,145,655 T882A probably benign Het
Olfr1413 T A 1: 92,573,413 S81T probably damaging Het
Olfr599 A T 7: 103,338,022 probably null Het
Olfr744 T A 14: 50,618,740 C173S probably damaging Het
Olfr749 C A 14: 50,737,074 L29F probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pald1 A T 10: 61,341,246 M675K possibly damaging Het
Pex5 A G 6: 124,413,596 S97P probably benign Het
Pitpnm1 C T 19: 4,111,140 A897V probably benign Het
Plxnd1 A T 6: 115,965,901 V1274E probably damaging Het
Polr2a T C 11: 69,736,735 probably null Het
Ppfia1 G A 7: 144,514,473 Q446* probably null Het
Psma2 G A 13: 14,616,028 V20I probably benign Het
Rhbdl2 T A 4: 123,817,917 L149* probably null Het
Rnf17 T C 14: 56,505,928 V1317A probably damaging Het
Rtel1 G A 2: 181,355,492 V1042M probably benign Het
Slc11a1 G A 1: 74,385,184 A434T probably damaging Het
Slc4a10 G A 2: 62,267,571 R508H probably benign Het
Slc5a8 A T 10: 88,886,598 I98F possibly damaging Het
Slf2 T A 19: 44,935,253 S169T possibly damaging Het
Snx33 A T 9: 56,926,191 I198N probably damaging Het
Spock3 A G 8: 63,355,265 T396A probably benign Het
Sva A T 6: 42,038,417 probably benign Het
Syt7 A G 19: 10,439,237 N261S probably benign Het
Taar7b T G 10: 24,000,461 S175A probably benign Het
Thoc2 C T X: 41,806,693 E1491K probably damaging Het
Tlr1 T C 5: 64,926,400 Y278C probably benign Het
Tph2 T A 10: 115,151,174 Y237F probably benign Het
Trim35 C T 14: 66,308,972 probably benign Het
Trpm4 T G 7: 45,310,469 Y667S probably damaging Het
Ttc27 T A 17: 74,799,342 H541Q probably damaging Het
Ube4a T C 9: 44,940,089 H709R probably damaging Het
Vwa7 G A 17: 35,024,190 V615I probably benign Het
Wars2 A G 3: 99,187,533 H48R probably damaging Het
Xlr4c T A X: 73,238,684 K121M probably damaging Het
Zfc3h1 T A 10: 115,418,783 C1427* probably null Het
Other mutations in Sidt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Sidt2 APN 9 45942236 missense possibly damaging 0.84
IGL00586:Sidt2 APN 9 45943052 missense possibly damaging 0.78
IGL00786:Sidt2 APN 9 45949803 missense possibly damaging 0.69
IGL01069:Sidt2 APN 9 45943077 missense possibly damaging 0.73
IGL01160:Sidt2 APN 9 45942726 missense probably damaging 1.00
IGL01474:Sidt2 APN 9 45946982 critical splice donor site probably null
IGL02068:Sidt2 APN 9 45945664 critical splice donor site probably null
IGL02171:Sidt2 APN 9 45952770 missense possibly damaging 0.81
IGL02312:Sidt2 APN 9 45947001 missense probably benign 0.27
IGL02344:Sidt2 APN 9 45945292 missense probably null 1.00
IGL03030:Sidt2 APN 9 45939505 missense probably damaging 1.00
IGL03062:Sidt2 APN 9 45942683 critical splice donor site probably null
R0157:Sidt2 UTSW 9 45939267 missense probably damaging 1.00
R0330:Sidt2 UTSW 9 45954902 missense probably benign 0.09
R0549:Sidt2 UTSW 9 45953119 splice site probably null
R0714:Sidt2 UTSW 9 45947060 splice site probably benign
R1241:Sidt2 UTSW 9 45945704 missense probably damaging 0.97
R1511:Sidt2 UTSW 9 45950089 missense probably damaging 1.00
R1558:Sidt2 UTSW 9 45951800 missense probably damaging 1.00
R1677:Sidt2 UTSW 9 45953219 missense probably benign 0.01
R2152:Sidt2 UTSW 9 45945340 missense probably damaging 1.00
R2153:Sidt2 UTSW 9 45945340 missense probably damaging 1.00
R2154:Sidt2 UTSW 9 45945340 missense probably damaging 1.00
R4210:Sidt2 UTSW 9 45942775 missense probably benign 0.00
R4349:Sidt2 UTSW 9 45945713 missense possibly damaging 0.94
R4855:Sidt2 UTSW 9 45952029 missense probably benign
R5175:Sidt2 UTSW 9 45951788 missense probably damaging 1.00
R5276:Sidt2 UTSW 9 45954777 missense probably damaging 0.97
R5544:Sidt2 UTSW 9 45944455 missense probably damaging 1.00
R5805:Sidt2 UTSW 9 45942199 missense probably damaging 0.97
R5927:Sidt2 UTSW 9 45944454 missense probably damaging 1.00
R6954:Sidt2 UTSW 9 45952850 missense probably benign 0.01
R7060:Sidt2 UTSW 9 45953246 missense possibly damaging 0.91
R7117:Sidt2 UTSW 9 45953219 missense probably benign 0.01
R7207:Sidt2 UTSW 9 45945151 missense probably damaging 1.00
R7317:Sidt2 UTSW 9 45943690 nonsense probably null
X0026:Sidt2 UTSW 9 45939299 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCGTCATCCAACGTCAGC -3'
(R):5'- TGCCCACATCTCTAAAGGGAAG -3'

Sequencing Primer
(F):5'- CGTCAGCAAAACCTAAGGGTG -3'
(R):5'- CCACATCTCTAAAGGGAAGATGGGTC -3'
Posted On2016-06-06