Mutagenetix > Incidental Mutation

Incidental Mutation 'R5076:Zfyve1'

395786

Institutional Source

Beutler Lab

Gene Symbol

Zfyve1

Ensembl Gene

ENSMUSG00000042628

Gene Name

zinc finger, FYVE domain containing 1

Synonyms

MMRRC Submission

042665-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5076 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

83546558-83597222 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 83555647 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 458 (R458H)

Ref Sequence

ENSEMBL: ENSMUSP00000152501 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048319] [ENSMUST00000221919] [ENSMUST00000222448]

AlphaFold

Q810J8

Predicted Effect

probably damaging
Transcript: ENSMUST00000048319
AA Change: R458H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000042224
Gene: ENSMUSG00000042628
AA Change: R458H

Domain	Start	End	E-Value	Type
low complexity region	429	436	N/A	INTRINSIC
FYVE	590	660	8.36e-13	SMART
FYVE	707	776	1.15e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221228

Predicted Effect

probably damaging
Transcript: ENSMUST00000221919
AA Change: R458H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000222448
AA Change: R43H

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)

Meta Mutation Damage Score

0.1088

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.0%

Validation Efficiency

97% (66/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The FYVE domain mediates the recruitment of proteins involved in membrane trafficking and cell signaling to phosphatidylinositol 3-phosphate-containing membranes. This protein contains two zinc-binding FYVE domains in tandem and is reported to localize to the Golgi apparatus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933434E20Rik	A	G	3: 90,056,252	I72V	probably benign	Het
Aadacl3	G	A	4: 144,456,070	P276L	possibly damaging	Het
Acp6	T	A	3: 97,167,989	S180T	probably benign	Het
Adgrd1	A	T	5: 129,143,989	R449*	probably null	Het
Ak1	T	C	2: 32,633,448	V176A	probably damaging	Het
Capzb	A	T	4: 139,287,814	D226V	possibly damaging	Het
Cd34	A	T	1: 194,948,030		probably benign	Het
Cdh15	C	A	8: 122,864,348	D445E	possibly damaging	Het
Chil4	A	G	3: 106,202,597	F367L	probably damaging	Het
Clstn2	T	C	9: 97,483,079	Y458C	probably damaging	Het
Ctsw	T	C	19: 5,468,458	Y9C	probably benign	Het
Dhrs7	T	C	12: 72,659,481	D50G	probably benign	Het
Dnah14	A	G	1: 181,757,234	K3177E	probably benign	Het
Ehd1	T	C	19: 6,277,221	F83L	probably benign	Het
Eif5a2	G	A	3: 28,782,737	V59I	possibly damaging	Het
Emilin3	T	A	2: 160,909,318		probably null	Het
Entpd8	A	G	2: 25,085,054	S426G	possibly damaging	Het
Epb41l4b	C	T	4: 57,040,984	G493D	probably damaging	Het
Fam208b	C	T	13: 3,576,357	V1198I	probably benign	Het
Gm11596	C	T	11: 99,792,872	G141R	unknown	Het
Gm1840	T	G	8: 5,640,130		noncoding transcript	Het
H2-Q4	T	C	17: 35,380,441	Y167H	probably damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Itpr1	A	G	6: 108,405,529		probably null	Het
Kif2c	A	T	4: 117,174,869		probably benign	Het
Klrb1-ps1	C	T	6: 129,119,788		noncoding transcript	Het
Krtap9-5	A	T	11: 99,949,468	T332S	unknown	Het
Lrrc39	A	T	3: 116,579,540	E283V	probably benign	Het
Mdga1	A	G	17: 29,850,554	S447P	possibly damaging	Het
Mindy1	G	A	3: 95,295,399	V425M	probably benign	Het
Mllt6	G	A	11: 97,669,500	S210N	possibly damaging	Het
Mrps5	T	A	2: 127,600,852	Y280*	probably null	Het
Muc3a	T	A	5: 137,210,540	T159S	probably damaging	Het
Olfr1252	T	A	2: 89,721,401	T237S	probably damaging	Het
Olfr1310	A	T	2: 112,008,592	M198K	probably damaging	Het
Olfr286	T	A	15: 98,226,761	I295F	probably damaging	Het
Pcdhga4	G	A	18: 37,685,595	V66I	probably benign	Het
Pdhx	T	C	2: 103,041,077	T203A	probably damaging	Het
Pdss1	A	G	2: 22,899,917		probably null	Het
Pdxk	G	T	10: 78,450,307	Q103K	probably benign	Het
Peg3	A	G	7: 6,708,420	C1268R	probably damaging	Het
Pitpnc1	A	T	11: 107,296,267	S77T	probably damaging	Het
Pnisr	T	A	4: 21,874,990		probably benign	Het
Poc1b	C	T	10: 99,107,841	T22I	probably damaging	Het
Ppfia1	G	A	7: 144,506,264	R604W	probably damaging	Het
Ppp1r3a	A	G	6: 14,754,681	F189S	probably damaging	Het
Rbks	T	A	5: 31,650,451	Y99*	probably null	Het
Rsg1	A	G	4: 141,217,385	I82M	probably benign	Het
Sh3rf2	G	T	18: 42,053,924	C36F	probably damaging	Het
Spock3	T	A	8: 63,345,855	N303K	probably damaging	Het
Tcaf2	T	C	6: 42,629,467	T518A	probably benign	Het
Tmem163	A	T	1: 127,500,276	V191D	probably damaging	Het
Trappc6b	A	G	12: 59,050,308	V76A	probably damaging	Het
Ube2nl	A	G	7: 61,549,532		noncoding transcript	Het
Unc5d	C	T	8: 28,694,676	V599M	possibly damaging	Het
Vmn1r184	A	T	7: 26,266,921	M31L	probably benign	Het
Vrtn	C	A	12: 84,649,474	Q333K	probably damaging	Het
Zfp788	T	A	7: 41,648,584	F163I	possibly damaging	Het

Other mutations in Zfyve1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00334:Zfyve1	APN	12	83574798	missense	probably benign	0.09
IGL00475:Zfyve1	APN	12	83555711	critical splice acceptor site	probably null
IGL01291:Zfyve1	APN	12	83555005	missense	probably benign	0.04
IGL01380:Zfyve1	APN	12	83552507	missense	probably damaging	1.00
IGL02037:Zfyve1	APN	12	83547920	missense	probably damaging	1.00
IGL02184:Zfyve1	APN	12	83558693	missense	probably benign	0.29
IGL02619:Zfyve1	APN	12	83550944	unclassified	probably benign
IGL03031:Zfyve1	APN	12	83574821	missense	probably damaging	0.99
IGL03105:Zfyve1	APN	12	83558639	missense	probably damaging	1.00
sasso	UTSW	12	83575056	missense	probably damaging	1.00
ANU05:Zfyve1	UTSW	12	83555005	missense	probably benign	0.04
R0123:Zfyve1	UTSW	12	83555073	splice site	probably benign
R0225:Zfyve1	UTSW	12	83555073	splice site	probably benign
R0468:Zfyve1	UTSW	12	83555274	splice site	probably benign
R1218:Zfyve1	UTSW	12	83548051	missense	possibly damaging	0.79
R1896:Zfyve1	UTSW	12	83555614	missense	probably damaging	0.99
R2291:Zfyve1	UTSW	12	83547931	missense	probably damaging	0.99
R4023:Zfyve1	UTSW	12	83594522	missense	probably benign
R4026:Zfyve1	UTSW	12	83594522	missense	probably benign
R4209:Zfyve1	UTSW	12	83575135	missense	probably damaging	1.00
R4211:Zfyve1	UTSW	12	83575135	missense	probably damaging	1.00
R4780:Zfyve1	UTSW	12	83558647	missense	probably damaging	1.00
R4907:Zfyve1	UTSW	12	83574872	missense	probably damaging	0.96
R4908:Zfyve1	UTSW	12	83551571	missense	probably damaging	1.00
R4998:Zfyve1	UTSW	12	83548065	missense	possibly damaging	0.69
R5303:Zfyve1	UTSW	12	83575056	missense	probably damaging	1.00
R5628:Zfyve1	UTSW	12	83574889	missense	probably benign	0.00
R5739:Zfyve1	UTSW	12	83575136	missense	possibly damaging	0.61
R6007:Zfyve1	UTSW	12	83558704	missense	probably damaging	1.00
R6355:Zfyve1	UTSW	12	83594641	missense	probably benign	0.01
R6641:Zfyve1	UTSW	12	83594496	missense	probably benign
R6735:Zfyve1	UTSW	12	83594844	missense	possibly damaging	0.90
R7222:Zfyve1	UTSW	12	83555005	missense	probably benign
R7278:Zfyve1	UTSW	12	83551540	missense	probably damaging	1.00
R7464:Zfyve1	UTSW	12	83551487	missense	probably benign	0.00
R8690:Zfyve1	UTSW	12	83550907	missense	probably damaging	1.00
R8857:Zfyve1	UTSW	12	83551600	missense	probably damaging	1.00
R8948:Zfyve1	UTSW	12	83548028	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGGGACCCAGAACTATGCTC -3'
(R):5'- AATCGCGTGTAAGTCAGGG -3'

Sequencing Primer
(F):5'- GGGACCCAGAACTATGCTCTAAATTC -3'
(R):5'- TGTAAGTCAGGGGCCACTC -3'

Posted On

2016-06-21