Incidental Mutation 'R5187:Ryr2'
ID 397977
Institutional Source Beutler Lab
Gene Symbol Ryr2
Ensembl Gene ENSMUSG00000021313
Gene Name ryanodine receptor 2, cardiac
Synonyms 9330127I20Rik
MMRRC Submission 042766-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5187 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 11567988-12121831 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 11787338 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1012 (I1012F)
Ref Sequence ENSEMBL: ENSMUSP00000127991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021750] [ENSMUST00000170156] [ENSMUST00000220597]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000021750
AA Change: I1012F

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021750
Gene: ENSMUSG00000021313
AA Change: I1012F

DomainStartEndE-ValueType
MIR 110 165 4.19e-2 SMART
MIR 172 217 9.25e-4 SMART
MIR 225 280 1.8e-1 SMART
MIR 286 376 2.22e-24 SMART
Pfam:RYDR_ITPR 454 648 3.1e-65 PFAM
SPRY 670 808 1.56e-30 SMART
Pfam:RyR 862 952 1.8e-36 PFAM
Pfam:RyR 976 1066 1.1e-32 PFAM
SPRY 1098 1221 5.07e-39 SMART
SPRY 1423 1562 7.47e-28 SMART
low complexity region 1643 1653 N/A INTRINSIC
low complexity region 1872 1891 N/A INTRINSIC
Pfam:RYDR_ITPR 2122 2331 1.2e-71 PFAM
low complexity region 2372 2379 N/A INTRINSIC
low complexity region 2416 2426 N/A INTRINSIC
low complexity region 2497 2510 N/A INTRINSIC
Pfam:RyR 2700 2790 1.1e-33 PFAM
Pfam:RyR 2820 2904 7.1e-27 PFAM
PDB:2BCX|B 3580 3609 9e-12 PDB
low complexity region 3700 3720 N/A INTRINSIC
Pfam:RIH_assoc 3829 3947 3.1e-36 PFAM
EFh 4026 4054 1.36e0 SMART
EFh 4061 4089 5.92e1 SMART
low complexity region 4218 4227 N/A INTRINSIC
low complexity region 4256 4273 N/A INTRINSIC
transmembrane domain 4278 4300 N/A INTRINSIC
low complexity region 4309 4317 N/A INTRINSIC
Pfam:RR_TM4-6 4332 4598 5.7e-96 PFAM
Pfam:Ion_trans 4710 4877 8e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170156
AA Change: I1012F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127991
Gene: ENSMUSG00000021313
AA Change: I1012F

DomainStartEndE-ValueType
MIR 110 165 4.19e-2 SMART
MIR 172 217 9.25e-4 SMART
MIR 225 280 1.8e-1 SMART
MIR 286 376 2.22e-24 SMART
Pfam:RYDR_ITPR 451 655 3.5e-73 PFAM
SPRY 670 808 1.56e-30 SMART
Pfam:RyR 861 955 1.4e-33 PFAM
Pfam:RyR 975 1069 9.2e-34 PFAM
SPRY 1098 1221 5.07e-39 SMART
SPRY 1423 1562 7.47e-28 SMART
low complexity region 1643 1653 N/A INTRINSIC
low complexity region 1872 1891 N/A INTRINSIC
Pfam:RYDR_ITPR 2120 2331 3.9e-65 PFAM
low complexity region 2372 2379 N/A INTRINSIC
low complexity region 2416 2426 N/A INTRINSIC
low complexity region 2497 2510 N/A INTRINSIC
Pfam:RyR 2699 2793 1.1e-37 PFAM
Pfam:RyR 2819 2907 9.4e-34 PFAM
PDB:2BCX|B 3580 3609 9e-12 PDB
low complexity region 3700 3720 N/A INTRINSIC
Pfam:RIH_assoc 3825 3958 2.3e-42 PFAM
EFh 4026 4054 1.36e0 SMART
EFh 4061 4089 5.92e1 SMART
low complexity region 4218 4227 N/A INTRINSIC
low complexity region 4256 4273 N/A INTRINSIC
transmembrane domain 4278 4300 N/A INTRINSIC
low complexity region 4309 4317 N/A INTRINSIC
Pfam:RR_TM4-6 4332 4598 5.1e-93 PFAM
Pfam:Ion_trans 4705 4865 9.3e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000220597
AA Change: I1005F

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222386
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in cardiac muscle sarcoplasmic reticulum. The encoded protein is one of the components of a calcium channel, composed of a tetramer of the ryanodine receptor proteins and a tetramer of FK506 binding protein 1B proteins, that supplies calcium to cardiac muscle. Mutations in this gene are associated with stress-induced polymorphic ventricular tachycardia and arrhythmogenic right ventricular dysplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice show embryonic lethality during organogenesis and altered cardiomyocyte morphology. Homozygotes for a phosphorylation defective allele show decreased susceptibility to myocardial infarction-induced heart failure. Homozygotes for the R420W allele show lymphoid organ hypertrophy. [provided by MGI curators]
Allele List at MGI

All alleles(44) : Targeted(17) Gene trapped(27)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,376,349 (GRCm39) V173M probably damaging Het
Abcg5 A G 17: 84,965,992 (GRCm39) L628S probably damaging Het
Acbd3 C T 1: 180,564,297 (GRCm39) R201* probably null Het
Adsl A G 15: 80,833,106 (GRCm39) probably benign Het
Asic1 GCACC GCACCACC 15: 99,596,684 (GRCm39) probably benign Het
Cachd1 T C 4: 100,823,397 (GRCm39) V483A possibly damaging Het
Calm1 T C 12: 100,166,472 (GRCm39) S19P probably benign Het
Casq1 T C 1: 172,040,641 (GRCm39) N313S possibly damaging Het
Cav2 G T 6: 17,286,935 (GRCm39) A64S possibly damaging Het
Ccdc167 C A 17: 29,924,485 (GRCm39) A39S possibly damaging Het
Cd274 T C 19: 29,359,936 (GRCm39) L247P probably benign Het
Cdhr5 T C 7: 140,854,361 (GRCm39) E138G probably damaging Het
Cltb C T 13: 54,741,693 (GRCm39) C81Y probably benign Het
Clvs1 T C 4: 9,281,865 (GRCm39) L103P possibly damaging Het
Cntrob G T 11: 69,212,717 (GRCm39) Q106K possibly damaging Het
Ctsh T C 9: 89,936,643 (GRCm39) L14P probably damaging Het
Cubn T C 2: 13,292,379 (GRCm39) N3268S probably damaging Het
Cyb5r4 T C 9: 86,909,001 (GRCm39) V26A possibly damaging Het
Ddx18 A G 1: 121,489,857 (GRCm39) I184T probably damaging Het
Ddx60 T A 8: 62,427,222 (GRCm39) W766R probably damaging Het
Dnah2 C T 11: 69,349,746 (GRCm39) R2399Q probably benign Het
Dnah5 G A 15: 28,272,318 (GRCm39) V1041I probably benign Het
Dnajc21 A T 15: 10,464,050 (GRCm39) N38K probably benign Het
Ermap T C 4: 119,043,015 (GRCm39) probably null Het
Fryl A G 5: 73,243,943 (GRCm39) L1209P possibly damaging Het
Gm5093 T C 17: 46,750,799 (GRCm39) E76G possibly damaging Het
Grk6 T C 13: 55,599,519 (GRCm39) C169R probably damaging Het
Hmgn1 A T 16: 95,923,627 (GRCm39) probably null Het
Lpcat2b T A 5: 107,582,001 (GRCm39) Y443* probably null Het
Macf1 T A 4: 123,365,882 (GRCm39) M1395L probably benign Het
Mllt10 C T 2: 18,213,585 (GRCm39) Q997* probably null Het
Mocos T A 18: 24,825,611 (GRCm39) V722E probably damaging Het
Moxd2 A T 6: 40,856,271 (GRCm39) L534M probably benign Het
Mphosph10 T C 7: 64,035,568 (GRCm39) M368V possibly damaging Het
Myo15a G A 11: 60,394,440 (GRCm39) G2383D probably damaging Het
Myo5b T C 18: 74,834,745 (GRCm39) I935T possibly damaging Het
Ndst4 T A 3: 125,231,560 (GRCm39) L43H probably damaging Het
Niban1 T A 1: 151,579,580 (GRCm39) L433Q possibly damaging Het
Nsl1 A G 1: 190,807,387 (GRCm39) N189D probably benign Het
Odad1 A G 7: 45,578,540 (GRCm39) I77V probably damaging Het
Or51e1 A T 7: 102,358,868 (GRCm39) H134L probably damaging Het
Pcdh8 T C 14: 80,007,594 (GRCm39) D323G probably damaging Het
Pkhd1 A G 1: 20,279,448 (GRCm39) S2957P possibly damaging Het
Prdm9 T G 17: 15,783,155 (GRCm39) E42D probably damaging Het
Rasal1 C A 5: 120,813,460 (GRCm39) H611Q probably benign Het
Relch T A 1: 105,646,534 (GRCm39) L620* probably null Het
Rif1 T A 2: 51,971,301 (GRCm39) W260R probably damaging Het
Rpain A G 11: 70,864,658 (GRCm39) D115G probably benign Het
Rpl3l T C 17: 24,951,429 (GRCm39) V110A possibly damaging Het
Sema4f A G 6: 82,894,631 (GRCm39) V480A probably benign Het
Slc35a3 T A 3: 116,474,794 (GRCm39) K199N probably damaging Het
Slc5a6 T C 5: 31,200,322 (GRCm39) Y121C probably damaging Het
Slc7a14 T C 3: 31,291,514 (GRCm39) probably null Het
Sort1 T A 3: 108,231,992 (GRCm39) I172N probably damaging Het
Spink5 C A 18: 44,122,518 (GRCm39) H328N probably damaging Het
Tbl1xr1 A G 3: 22,263,770 (GRCm39) D504G probably damaging Het
Tcaf3 C T 6: 42,573,954 (GRCm39) C86Y possibly damaging Het
Tfap2e T C 4: 126,628,434 (GRCm39) D174G probably benign Het
Tmem42 T C 9: 122,851,232 (GRCm39) V65A probably damaging Het
Vmn1r225 C G 17: 20,723,177 (GRCm39) T206R probably damaging Het
Vmn2r38 A G 7: 9,100,571 (GRCm39) F65S probably benign Het
Vmn2r87 A T 10: 130,333,208 (GRCm39) L14Q probably null Het
Xirp2 T C 2: 67,345,711 (GRCm39) S2651P probably benign Het
Zfp429 G A 13: 67,538,959 (GRCm39) L162F probably damaging Het
Zhx1 A T 15: 57,915,819 (GRCm39) M809K probably damaging Het
Other mutations in Ryr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Ryr2 APN 13 11,848,978 (GRCm39) splice site probably benign
IGL00757:Ryr2 APN 13 11,633,490 (GRCm39) splice site probably null
IGL00838:Ryr2 APN 13 11,583,389 (GRCm39) missense probably damaging 0.98
IGL00849:Ryr2 APN 13 11,600,364 (GRCm39) missense possibly damaging 0.91
IGL00987:Ryr2 APN 13 11,750,388 (GRCm39) missense probably damaging 0.99
IGL01096:Ryr2 APN 13 11,718,430 (GRCm39) missense probably damaging 1.00
IGL01313:Ryr2 APN 13 11,653,371 (GRCm39) critical splice acceptor site probably null
IGL01349:Ryr2 APN 13 11,602,125 (GRCm39) missense possibly damaging 0.93
IGL01391:Ryr2 APN 13 11,571,571 (GRCm39) missense possibly damaging 0.96
IGL01401:Ryr2 APN 13 11,606,238 (GRCm39) missense possibly damaging 0.80
IGL01412:Ryr2 APN 13 11,756,922 (GRCm39) missense probably benign 0.10
IGL01419:Ryr2 APN 13 11,814,723 (GRCm39) missense possibly damaging 0.51
IGL01432:Ryr2 APN 13 11,866,090 (GRCm39) missense possibly damaging 0.63
IGL01533:Ryr2 APN 13 11,736,676 (GRCm39) missense probably damaging 1.00
IGL01571:Ryr2 APN 13 11,736,647 (GRCm39) missense probably damaging 1.00
IGL01584:Ryr2 APN 13 11,616,644 (GRCm39) critical splice donor site probably null
IGL01611:Ryr2 APN 13 11,606,202 (GRCm39) missense possibly damaging 0.67
IGL01632:Ryr2 APN 13 11,609,854 (GRCm39) missense probably damaging 0.97
IGL01643:Ryr2 APN 13 11,707,563 (GRCm39) missense possibly damaging 0.94
IGL01647:Ryr2 APN 13 11,600,366 (GRCm39) missense probably damaging 1.00
IGL01730:Ryr2 APN 13 11,616,728 (GRCm39) missense possibly damaging 0.86
IGL01834:Ryr2 APN 13 11,610,311 (GRCm39) missense possibly damaging 0.71
IGL01921:Ryr2 APN 13 11,569,436 (GRCm39) missense possibly damaging 0.96
IGL01937:Ryr2 APN 13 11,805,249 (GRCm39) missense probably damaging 1.00
IGL01945:Ryr2 APN 13 11,805,249 (GRCm39) missense probably damaging 1.00
IGL02027:Ryr2 APN 13 11,611,998 (GRCm39) missense probably damaging 1.00
IGL02060:Ryr2 APN 13 11,762,450 (GRCm39) missense probably damaging 1.00
IGL02065:Ryr2 APN 13 11,587,143 (GRCm39) missense possibly damaging 0.92
IGL02084:Ryr2 APN 13 11,807,648 (GRCm39) nonsense probably null
IGL02086:Ryr2 APN 13 11,750,442 (GRCm39) missense probably damaging 1.00
IGL02095:Ryr2 APN 13 11,774,645 (GRCm39) missense probably damaging 0.98
IGL02100:Ryr2 APN 13 11,752,759 (GRCm39) missense possibly damaging 0.92
IGL02122:Ryr2 APN 13 11,756,755 (GRCm39) missense probably damaging 1.00
IGL02202:Ryr2 APN 13 11,745,274 (GRCm39) missense probably damaging 0.97
IGL02202:Ryr2 APN 13 11,762,544 (GRCm39) splice site probably benign
IGL02369:Ryr2 APN 13 11,634,382 (GRCm39) missense possibly damaging 0.68
IGL02383:Ryr2 APN 13 11,737,607 (GRCm39) splice site probably benign
IGL02400:Ryr2 APN 13 11,620,130 (GRCm39) splice site probably benign
IGL02423:Ryr2 APN 13 11,760,084 (GRCm39) missense probably damaging 1.00
IGL02425:Ryr2 APN 13 11,760,560 (GRCm39) missense probably damaging 0.99
IGL02458:Ryr2 APN 13 11,720,585 (GRCm39) missense probably benign 0.15
IGL02602:Ryr2 APN 13 11,569,397 (GRCm39) utr 3 prime probably benign
IGL02694:Ryr2 APN 13 11,620,075 (GRCm39) missense probably damaging 1.00
IGL02726:Ryr2 APN 13 11,753,206 (GRCm39) missense probably damaging 1.00
IGL02747:Ryr2 APN 13 11,670,563 (GRCm39) missense probably damaging 1.00
IGL02795:Ryr2 APN 13 11,610,076 (GRCm39) missense probably benign 0.21
IGL02876:Ryr2 APN 13 11,722,679 (GRCm39) missense probably benign 0.39
IGL02878:Ryr2 APN 13 11,933,205 (GRCm39) missense probably benign 0.10
IGL02887:Ryr2 APN 13 11,606,155 (GRCm39) missense probably damaging 0.97
IGL02926:Ryr2 APN 13 11,774,721 (GRCm39) missense probably damaging 0.99
IGL03030:Ryr2 APN 13 11,699,365 (GRCm39) missense probably damaging 0.99
IGL03064:Ryr2 APN 13 11,658,788 (GRCm39) critical splice acceptor site probably null
IGL03102:Ryr2 APN 13 11,650,468 (GRCm39) splice site probably benign
IGL03152:Ryr2 APN 13 11,868,036 (GRCm39) missense probably damaging 1.00
IGL03176:Ryr2 APN 13 11,756,909 (GRCm39) nonsense probably null
IGL03180:Ryr2 APN 13 11,583,449 (GRCm39) missense possibly damaging 0.95
IGL03213:Ryr2 APN 13 11,739,273 (GRCm39) splice site probably benign
IGL03390:Ryr2 APN 13 11,787,302 (GRCm39) missense probably benign
IGL03410:Ryr2 APN 13 11,603,033 (GRCm39) missense probably damaging 0.99
Arruda UTSW 13 11,658,781 (GRCm39) missense probably damaging 1.00
Arruda2 UTSW 13 11,894,382 (GRCm39) missense probably damaging 1.00
Arruda3 UTSW 13 11,570,334 (GRCm39) missense possibly damaging 0.91
barricuda UTSW 13 11,609,900 (GRCm39) missense probably benign 0.06
BB006:Ryr2 UTSW 13 11,705,181 (GRCm39) nonsense probably null
BB006:Ryr2 UTSW 13 11,609,680 (GRCm39) missense probably damaging 1.00
BB016:Ryr2 UTSW 13 11,705,181 (GRCm39) nonsense probably null
BB016:Ryr2 UTSW 13 11,609,680 (GRCm39) missense probably damaging 1.00
H8562:Ryr2 UTSW 13 11,732,027 (GRCm39) splice site probably benign
IGL02799:Ryr2 UTSW 13 11,680,848 (GRCm39) missense probably damaging 1.00
IGL02991:Ryr2 UTSW 13 11,776,192 (GRCm39) missense probably damaging 0.99
PIT4142001:Ryr2 UTSW 13 11,722,682 (GRCm39) missense probably damaging 0.97
PIT4260001:Ryr2 UTSW 13 11,609,641 (GRCm39) missense possibly damaging 0.93
PIT4458001:Ryr2 UTSW 13 11,570,334 (GRCm39) missense probably benign 0.29
R0003:Ryr2 UTSW 13 11,839,265 (GRCm39) missense probably damaging 1.00
R0004:Ryr2 UTSW 13 11,680,805 (GRCm39) missense probably benign
R0018:Ryr2 UTSW 13 11,610,109 (GRCm39) missense possibly damaging 0.94
R0048:Ryr2 UTSW 13 11,610,670 (GRCm39) missense probably damaging 1.00
R0048:Ryr2 UTSW 13 11,610,670 (GRCm39) missense probably damaging 1.00
R0056:Ryr2 UTSW 13 11,683,924 (GRCm39) missense probably damaging 0.97
R0062:Ryr2 UTSW 13 11,884,002 (GRCm39) critical splice donor site probably null
R0062:Ryr2 UTSW 13 11,884,002 (GRCm39) critical splice donor site probably null
R0080:Ryr2 UTSW 13 11,583,361 (GRCm39) missense probably damaging 0.98
R0116:Ryr2 UTSW 13 11,724,807 (GRCm39) missense probably damaging 1.00
R0148:Ryr2 UTSW 13 11,729,434 (GRCm39) missense probably damaging 1.00
R0206:Ryr2 UTSW 13 11,691,137 (GRCm39) splice site probably benign
R0226:Ryr2 UTSW 13 11,787,442 (GRCm39) missense probably damaging 1.00
R0285:Ryr2 UTSW 13 11,731,863 (GRCm39) missense probably damaging 1.00
R0365:Ryr2 UTSW 13 11,683,725 (GRCm39) missense possibly damaging 0.90
R0401:Ryr2 UTSW 13 11,720,570 (GRCm39) missense probably benign 0.45
R0415:Ryr2 UTSW 13 11,884,042 (GRCm39) missense probably damaging 0.97
R0418:Ryr2 UTSW 13 11,848,981 (GRCm39) splice site probably benign
R0558:Ryr2 UTSW 13 11,814,747 (GRCm39) missense probably damaging 1.00
R0558:Ryr2 UTSW 13 11,653,329 (GRCm39) missense probably damaging 1.00
R0574:Ryr2 UTSW 13 11,746,555 (GRCm39) missense probably benign 0.02
R0586:Ryr2 UTSW 13 11,650,445 (GRCm39) missense probably null
R0601:Ryr2 UTSW 13 11,720,519 (GRCm39) critical splice donor site probably null
R0610:Ryr2 UTSW 13 11,637,838 (GRCm39) missense probably damaging 1.00
R0648:Ryr2 UTSW 13 11,739,219 (GRCm39) missense possibly damaging 0.86
R0727:Ryr2 UTSW 13 11,581,771 (GRCm39) missense probably damaging 1.00
R0743:Ryr2 UTSW 13 11,569,415 (GRCm39) missense probably damaging 0.99
R0821:Ryr2 UTSW 13 11,753,012 (GRCm39) missense probably benign 0.35
R0884:Ryr2 UTSW 13 11,569,415 (GRCm39) missense probably damaging 0.99
R1104:Ryr2 UTSW 13 11,684,855 (GRCm39) missense probably damaging 0.99
R1114:Ryr2 UTSW 13 11,960,867 (GRCm39) missense probably damaging 0.98
R1167:Ryr2 UTSW 13 11,674,999 (GRCm39) missense possibly damaging 0.94
R1238:Ryr2 UTSW 13 11,774,589 (GRCm39) missense probably damaging 1.00
R1239:Ryr2 UTSW 13 11,897,929 (GRCm39) critical splice donor site probably null
R1296:Ryr2 UTSW 13 11,702,765 (GRCm39) splice site probably benign
R1400:Ryr2 UTSW 13 11,609,962 (GRCm39) missense probably benign 0.08
R1439:Ryr2 UTSW 13 11,729,389 (GRCm39) splice site probably benign
R1443:Ryr2 UTSW 13 11,794,152 (GRCm39) missense probably benign 0.19
R1446:Ryr2 UTSW 13 11,753,035 (GRCm39) missense probably benign 0.09
R1458:Ryr2 UTSW 13 11,741,908 (GRCm39) missense probably damaging 0.97
R1497:Ryr2 UTSW 13 11,616,727 (GRCm39) missense probably damaging 0.99
R1505:Ryr2 UTSW 13 11,569,478 (GRCm39) missense possibly damaging 0.84
R1548:Ryr2 UTSW 13 11,569,435 (GRCm39) nonsense probably null
R1551:Ryr2 UTSW 13 11,800,029 (GRCm39) critical splice acceptor site probably null
R1567:Ryr2 UTSW 13 11,774,563 (GRCm39) missense possibly damaging 0.87
R1581:Ryr2 UTSW 13 11,809,449 (GRCm39) missense probably benign 0.01
R1645:Ryr2 UTSW 13 11,733,368 (GRCm39) nonsense probably null
R1686:Ryr2 UTSW 13 11,618,665 (GRCm39) splice site probably benign
R1696:Ryr2 UTSW 13 11,746,543 (GRCm39) missense probably benign 0.02
R1708:Ryr2 UTSW 13 11,602,328 (GRCm39) splice site probably null
R1728:Ryr2 UTSW 13 11,602,308 (GRCm39) missense possibly damaging 0.94
R1745:Ryr2 UTSW 13 11,805,153 (GRCm39) missense probably damaging 1.00
R1771:Ryr2 UTSW 13 11,760,062 (GRCm39) critical splice donor site probably null
R1776:Ryr2 UTSW 13 11,760,062 (GRCm39) critical splice donor site probably null
R1783:Ryr2 UTSW 13 11,715,257 (GRCm39) nonsense probably null
R1801:Ryr2 UTSW 13 11,610,167 (GRCm39) missense probably benign 0.01
R1812:Ryr2 UTSW 13 11,575,472 (GRCm39) missense probably damaging 0.97
R1820:Ryr2 UTSW 13 11,602,202 (GRCm39) missense probably damaging 0.99
R1835:Ryr2 UTSW 13 11,784,764 (GRCm39) missense probably benign 0.06
R1868:Ryr2 UTSW 13 11,746,586 (GRCm39) missense probably benign 0.02
R1869:Ryr2 UTSW 13 11,676,961 (GRCm39) missense probably damaging 0.98
R1884:Ryr2 UTSW 13 11,753,242 (GRCm39) missense probably damaging 0.97
R1892:Ryr2 UTSW 13 11,673,844 (GRCm39) nonsense probably null
R1897:Ryr2 UTSW 13 11,765,818 (GRCm39) missense probably benign 0.09
R1899:Ryr2 UTSW 13 11,606,222 (GRCm39) missense probably benign
R1909:Ryr2 UTSW 13 11,715,235 (GRCm39) missense probably damaging 1.00
R1918:Ryr2 UTSW 13 11,571,584 (GRCm39) missense possibly damaging 0.91
R1937:Ryr2 UTSW 13 11,683,848 (GRCm39) missense probably damaging 1.00
R1943:Ryr2 UTSW 13 11,746,609 (GRCm39) missense probably benign 0.10
R1956:Ryr2 UTSW 13 11,695,966 (GRCm39) missense probably damaging 1.00
R1983:Ryr2 UTSW 13 11,600,288 (GRCm39) splice site probably null
R2018:Ryr2 UTSW 13 11,866,074 (GRCm39) missense possibly damaging 0.59
R2019:Ryr2 UTSW 13 11,866,074 (GRCm39) missense possibly damaging 0.59
R2060:Ryr2 UTSW 13 11,610,622 (GRCm39) missense probably damaging 1.00
R2061:Ryr2 UTSW 13 11,680,764 (GRCm39) splice site probably null
R2088:Ryr2 UTSW 13 11,677,115 (GRCm39) missense probably benign 0.04
R2089:Ryr2 UTSW 13 11,960,863 (GRCm39) missense probably benign 0.23
R2091:Ryr2 UTSW 13 11,960,863 (GRCm39) missense probably benign 0.23
R2091:Ryr2 UTSW 13 11,960,863 (GRCm39) missense probably benign 0.23
R2127:Ryr2 UTSW 13 11,727,081 (GRCm39) missense probably damaging 1.00
R2140:Ryr2 UTSW 13 11,575,493 (GRCm39) missense probably damaging 1.00
R2153:Ryr2 UTSW 13 11,592,759 (GRCm39) missense possibly damaging 0.86
R2179:Ryr2 UTSW 13 11,720,679 (GRCm39) nonsense probably null
R2207:Ryr2 UTSW 13 11,825,823 (GRCm39) missense probably damaging 1.00
R2237:Ryr2 UTSW 13 11,677,146 (GRCm39) missense probably benign 0.18
R2258:Ryr2 UTSW 13 11,753,102 (GRCm39) missense possibly damaging 0.94
R2312:Ryr2 UTSW 13 11,753,128 (GRCm39) missense probably damaging 1.00
R2421:Ryr2 UTSW 13 11,606,123 (GRCm39) missense probably damaging 0.98
R2438:Ryr2 UTSW 13 11,816,734 (GRCm39) missense probably damaging 1.00
R2483:Ryr2 UTSW 13 11,774,589 (GRCm39) missense probably damaging 1.00
R2860:Ryr2 UTSW 13 11,607,979 (GRCm39) missense probably damaging 0.98
R2861:Ryr2 UTSW 13 11,607,979 (GRCm39) missense probably damaging 0.98
R2867:Ryr2 UTSW 13 11,776,235 (GRCm39) missense probably damaging 1.00
R2867:Ryr2 UTSW 13 11,776,235 (GRCm39) missense probably damaging 1.00
R3618:Ryr2 UTSW 13 11,787,466 (GRCm39) critical splice acceptor site probably null
R3876:Ryr2 UTSW 13 11,603,045 (GRCm39) missense probably damaging 0.99
R3906:Ryr2 UTSW 13 11,753,095 (GRCm39) missense possibly damaging 0.87
R3912:Ryr2 UTSW 13 11,787,313 (GRCm39) missense probably damaging 0.99
R4018:Ryr2 UTSW 13 11,933,300 (GRCm39) missense probably damaging 1.00
R4114:Ryr2 UTSW 13 11,707,568 (GRCm39) missense probably damaging 1.00
R4119:Ryr2 UTSW 13 11,794,153 (GRCm39) missense probably benign 0.22
R4127:Ryr2 UTSW 13 11,602,323 (GRCm39) missense possibly damaging 0.91
R4222:Ryr2 UTSW 13 11,752,759 (GRCm39) missense possibly damaging 0.92
R4233:Ryr2 UTSW 13 11,765,611 (GRCm39) missense probably benign 0.20
R4355:Ryr2 UTSW 13 11,664,698 (GRCm39) missense probably benign 0.05
R4384:Ryr2 UTSW 13 11,620,119 (GRCm39) missense probably damaging 0.99
R4422:Ryr2 UTSW 13 11,731,952 (GRCm39) nonsense probably null
R4430:Ryr2 UTSW 13 11,750,413 (GRCm39) missense probably damaging 0.98
R4624:Ryr2 UTSW 13 12,121,301 (GRCm39) missense possibly damaging 0.47
R4663:Ryr2 UTSW 13 11,764,395 (GRCm39) missense possibly damaging 0.47
R4665:Ryr2 UTSW 13 11,765,571 (GRCm39) splice site probably null
R4668:Ryr2 UTSW 13 11,608,003 (GRCm39) missense probably benign
R4677:Ryr2 UTSW 13 11,721,553 (GRCm39) missense probably damaging 0.98
R4679:Ryr2 UTSW 13 11,839,255 (GRCm39) missense probably benign 0.34
R4680:Ryr2 UTSW 13 11,610,119 (GRCm39) missense probably benign 0.04
R4685:Ryr2 UTSW 13 11,707,532 (GRCm39) missense probably damaging 1.00
R4709:Ryr2 UTSW 13 11,731,884 (GRCm39) missense probably damaging 1.00
R4731:Ryr2 UTSW 13 11,592,795 (GRCm39) missense possibly damaging 0.53
R4732:Ryr2 UTSW 13 11,592,795 (GRCm39) missense possibly damaging 0.53
R4733:Ryr2 UTSW 13 11,592,795 (GRCm39) missense possibly damaging 0.53
R4734:Ryr2 UTSW 13 11,752,639 (GRCm39) missense probably damaging 0.99
R4740:Ryr2 UTSW 13 11,671,933 (GRCm39) missense possibly damaging 0.95
R4801:Ryr2 UTSW 13 11,723,113 (GRCm39) missense probably damaging 1.00
R4801:Ryr2 UTSW 13 11,702,818 (GRCm39) missense probably damaging 1.00
R4802:Ryr2 UTSW 13 11,702,818 (GRCm39) missense probably damaging 1.00
R4802:Ryr2 UTSW 13 11,723,113 (GRCm39) missense probably damaging 1.00
R4804:Ryr2 UTSW 13 11,731,983 (GRCm39) missense probably damaging 1.00
R4811:Ryr2 UTSW 13 11,670,584 (GRCm39) missense probably damaging 0.97
R4850:Ryr2 UTSW 13 11,760,638 (GRCm39) missense probably damaging 1.00
R4850:Ryr2 UTSW 13 11,683,706 (GRCm39) missense probably damaging 0.99
R4880:Ryr2 UTSW 13 11,767,104 (GRCm39) missense probably damaging 1.00
R4917:Ryr2 UTSW 13 11,609,872 (GRCm39) missense probably damaging 0.96
R4918:Ryr2 UTSW 13 11,609,872 (GRCm39) missense probably damaging 0.96
R4922:Ryr2 UTSW 13 11,724,849 (GRCm39) missense probably damaging 0.99
R4933:Ryr2 UTSW 13 11,960,831 (GRCm39) missense probably damaging 0.96
R4950:Ryr2 UTSW 13 11,756,897 (GRCm39) missense probably damaging 1.00
R4957:Ryr2 UTSW 13 11,799,966 (GRCm39) missense probably damaging 0.97
R4964:Ryr2 UTSW 13 11,848,878 (GRCm39) missense probably benign 0.00
R4964:Ryr2 UTSW 13 11,729,497 (GRCm39) missense possibly damaging 0.49
R4966:Ryr2 UTSW 13 11,729,497 (GRCm39) missense possibly damaging 0.49
R4966:Ryr2 UTSW 13 11,848,878 (GRCm39) missense probably benign 0.00
R4997:Ryr2 UTSW 13 11,610,192 (GRCm39) missense probably benign 0.09
R4998:Ryr2 UTSW 13 11,658,781 (GRCm39) missense probably damaging 1.00
R5033:Ryr2 UTSW 13 11,602,140 (GRCm39) missense possibly damaging 0.93
R5061:Ryr2 UTSW 13 11,650,422 (GRCm39) missense possibly damaging 0.74
R5062:Ryr2 UTSW 13 11,715,240 (GRCm39) missense probably damaging 0.97
R5088:Ryr2 UTSW 13 11,727,129 (GRCm39) nonsense probably null
R5135:Ryr2 UTSW 13 11,677,016 (GRCm39) missense probably benign 0.05
R5138:Ryr2 UTSW 13 11,675,175 (GRCm39) missense probably damaging 1.00
R5168:Ryr2 UTSW 13 11,767,207 (GRCm39) missense probably benign
R5197:Ryr2 UTSW 13 11,653,316 (GRCm39) critical splice donor site probably null
R5262:Ryr2 UTSW 13 11,787,323 (GRCm39) missense probably damaging 0.99
R5325:Ryr2 UTSW 13 11,705,249 (GRCm39) missense probably damaging 0.97
R5381:Ryr2 UTSW 13 11,571,544 (GRCm39) missense probably damaging 1.00
R5437:Ryr2 UTSW 13 11,670,599 (GRCm39) missense probably damaging 1.00
R5477:Ryr2 UTSW 13 11,720,542 (GRCm39) missense probably damaging 1.00
R5497:Ryr2 UTSW 13 11,720,587 (GRCm39) missense probably null 0.15
R5509:Ryr2 UTSW 13 11,760,487 (GRCm39) missense probably damaging 0.98
R5518:Ryr2 UTSW 13 11,702,795 (GRCm39) missense probably benign 0.01
R5571:Ryr2 UTSW 13 11,570,334 (GRCm39) missense possibly damaging 0.91
R5591:Ryr2 UTSW 13 11,609,900 (GRCm39) missense probably benign 0.06
R5619:Ryr2 UTSW 13 11,723,088 (GRCm39) missense probably damaging 1.00
R5630:Ryr2 UTSW 13 11,616,691 (GRCm39) missense probably damaging 1.00
R5644:Ryr2 UTSW 13 11,610,468 (GRCm39) missense probably damaging 0.99
R5667:Ryr2 UTSW 13 11,774,722 (GRCm39) missense probably damaging 1.00
R5775:Ryr2 UTSW 13 11,784,848 (GRCm39) missense probably damaging 1.00
R5836:Ryr2 UTSW 13 11,618,618 (GRCm39) missense probably damaging 1.00
R5858:Ryr2 UTSW 13 11,575,460 (GRCm39) missense probably damaging 0.99
R5934:Ryr2 UTSW 13 11,599,040 (GRCm39) missense probably damaging 0.96
R5939:Ryr2 UTSW 13 11,805,218 (GRCm39) missense probably damaging 0.99
R5941:Ryr2 UTSW 13 11,702,788 (GRCm39) missense probably damaging 1.00
R5945:Ryr2 UTSW 13 11,675,008 (GRCm39) missense probably damaging 1.00
R5946:Ryr2 UTSW 13 11,741,839 (GRCm39) missense probably damaging 1.00
R5966:Ryr2 UTSW 13 11,677,124 (GRCm39) nonsense probably null
R5974:Ryr2 UTSW 13 11,729,397 (GRCm39) splice site probably null
R6104:Ryr2 UTSW 13 11,814,711 (GRCm39) missense probably damaging 1.00
R6118:Ryr2 UTSW 13 11,807,575 (GRCm39) missense possibly damaging 0.69
R6149:Ryr2 UTSW 13 11,683,903 (GRCm39) missense probably benign
R6208:Ryr2 UTSW 13 11,910,106 (GRCm39) missense probably benign 0.04
R6217:Ryr2 UTSW 13 11,848,964 (GRCm39) missense probably damaging 1.00
R6230:Ryr2 UTSW 13 11,674,993 (GRCm39) missense probably damaging 0.99
R6279:Ryr2 UTSW 13 11,695,885 (GRCm39) missense probably damaging 0.97
R6294:Ryr2 UTSW 13 11,894,382 (GRCm39) missense probably damaging 1.00
R6300:Ryr2 UTSW 13 11,695,885 (GRCm39) missense probably damaging 0.97
R6350:Ryr2 UTSW 13 11,776,282 (GRCm39) missense probably damaging 0.98
R6484:Ryr2 UTSW 13 11,677,269 (GRCm39) missense possibly damaging 0.90
R6489:Ryr2 UTSW 13 11,848,893 (GRCm39) missense probably benign 0.29
R6548:Ryr2 UTSW 13 11,683,707 (GRCm39) missense probably damaging 1.00
R6591:Ryr2 UTSW 13 11,609,609 (GRCm39) missense probably benign 0.01
R6623:Ryr2 UTSW 13 11,724,951 (GRCm39) missense probably damaging 1.00
R6649:Ryr2 UTSW 13 11,610,529 (GRCm39) missense probably damaging 0.99
R6691:Ryr2 UTSW 13 11,609,609 (GRCm39) missense probably benign 0.01
R6770:Ryr2 UTSW 13 11,753,348 (GRCm39) missense probably damaging 1.00
R6802:Ryr2 UTSW 13 11,701,852 (GRCm39) missense probably damaging 1.00
R6809:Ryr2 UTSW 13 11,741,816 (GRCm39) missense probably damaging 1.00
R6893:Ryr2 UTSW 13 11,844,540 (GRCm39) missense possibly damaging 0.75
R6911:Ryr2 UTSW 13 11,842,445 (GRCm39) missense possibly damaging 0.50
R6915:Ryr2 UTSW 13 11,760,487 (GRCm39) missense probably damaging 1.00
R6943:Ryr2 UTSW 13 11,581,834 (GRCm39) missense possibly damaging 0.92
R6960:Ryr2 UTSW 13 11,816,129 (GRCm39) missense probably benign 0.28
R6997:Ryr2 UTSW 13 11,669,266 (GRCm39) missense possibly damaging 0.88
R6998:Ryr2 UTSW 13 11,727,052 (GRCm39) missense probably damaging 0.99
R7001:Ryr2 UTSW 13 11,809,491 (GRCm39) missense probably damaging 0.98
R7047:Ryr2 UTSW 13 11,839,286 (GRCm39) missense possibly damaging 0.64
R7089:Ryr2 UTSW 13 11,664,662 (GRCm39) missense probably benign 0.10
R7125:Ryr2 UTSW 13 11,684,873 (GRCm39) missense probably damaging 0.99
R7127:Ryr2 UTSW 13 11,670,599 (GRCm39) missense probably damaging 1.00
R7131:Ryr2 UTSW 13 11,683,697 (GRCm39) critical splice donor site probably null
R7131:Ryr2 UTSW 13 11,655,213 (GRCm39) missense possibly damaging 0.63
R7159:Ryr2 UTSW 13 11,825,794 (GRCm39) missense probably damaging 0.99
R7174:Ryr2 UTSW 13 11,816,063 (GRCm39) missense possibly damaging 0.81
R7180:Ryr2 UTSW 13 11,701,864 (GRCm39) missense probably damaging 1.00
R7182:Ryr2 UTSW 13 11,774,643 (GRCm39) missense probably benign
R7189:Ryr2 UTSW 13 11,898,009 (GRCm39) missense probably damaging 1.00
R7241:Ryr2 UTSW 13 11,680,799 (GRCm39) missense possibly damaging 0.71
R7244:Ryr2 UTSW 13 11,612,032 (GRCm39) missense probably damaging 1.00
R7326:Ryr2 UTSW 13 11,753,080 (GRCm39) missense possibly damaging 0.95
R7331:Ryr2 UTSW 13 11,760,517 (GRCm39) missense probably benign
R7365:Ryr2 UTSW 13 11,655,161 (GRCm39) missense probably damaging 0.99
R7372:Ryr2 UTSW 13 11,695,885 (GRCm39) missense probably damaging 0.97
R7395:Ryr2 UTSW 13 11,799,997 (GRCm39) missense probably damaging 0.98
R7404:Ryr2 UTSW 13 11,750,506 (GRCm39) missense probably damaging 0.97
R7417:Ryr2 UTSW 13 11,571,634 (GRCm39) splice site probably null
R7425:Ryr2 UTSW 13 11,720,530 (GRCm39) missense probably benign 0.20
R7444:Ryr2 UTSW 13 11,570,349 (GRCm39) missense probably benign 0.25
R7456:Ryr2 UTSW 13 11,767,168 (GRCm39) missense probably benign
R7460:Ryr2 UTSW 13 11,720,596 (GRCm39) missense probably benign 0.10
R7474:Ryr2 UTSW 13 11,609,762 (GRCm39) missense probably benign 0.04
R7543:Ryr2 UTSW 13 11,653,317 (GRCm39) critical splice donor site probably null
R7549:Ryr2 UTSW 13 11,752,871 (GRCm39) missense probably benign 0.15
R7558:Ryr2 UTSW 13 11,814,711 (GRCm39) missense probably damaging 1.00
R7565:Ryr2 UTSW 13 11,575,539 (GRCm39) missense possibly damaging 0.84
R7627:Ryr2 UTSW 13 11,776,213 (GRCm39) missense possibly damaging 0.65
R7698:Ryr2 UTSW 13 11,776,201 (GRCm39) missense possibly damaging 0.94
R7702:Ryr2 UTSW 13 11,705,219 (GRCm39) missense probably damaging 0.99
R7719:Ryr2 UTSW 13 11,745,229 (GRCm39) missense possibly damaging 0.94
R7772:Ryr2 UTSW 13 11,765,897 (GRCm39) missense probably benign
R7797:Ryr2 UTSW 13 11,816,066 (GRCm39) missense probably damaging 0.99
R7829:Ryr2 UTSW 13 11,842,493 (GRCm39) missense possibly damaging 0.81
R7855:Ryr2 UTSW 13 11,721,509 (GRCm39) nonsense probably null
R7872:Ryr2 UTSW 13 11,610,610 (GRCm39) missense probably damaging 1.00
R7908:Ryr2 UTSW 13 11,807,634 (GRCm39) missense probably benign 0.01
R7929:Ryr2 UTSW 13 11,609,680 (GRCm39) missense probably damaging 1.00
R7929:Ryr2 UTSW 13 11,705,181 (GRCm39) nonsense probably null
R7952:Ryr2 UTSW 13 11,661,313 (GRCm39) splice site probably null
R8008:Ryr2 UTSW 13 11,671,980 (GRCm39) missense probably benign 0.30
R8011:Ryr2 UTSW 13 11,603,026 (GRCm39) critical splice donor site probably null
R8097:Ryr2 UTSW 13 11,960,881 (GRCm39) missense probably damaging 0.98
R8133:Ryr2 UTSW 13 11,618,584 (GRCm39) missense probably damaging 1.00
R8253:Ryr2 UTSW 13 11,842,439 (GRCm39) missense possibly damaging 0.94
R8278:Ryr2 UTSW 13 11,610,392 (GRCm39) nonsense probably null
R8351:Ryr2 UTSW 13 11,814,718 (GRCm39) missense probably damaging 0.98
R8401:Ryr2 UTSW 13 11,683,821 (GRCm39) missense possibly damaging 0.95
R8403:Ryr2 UTSW 13 11,699,364 (GRCm39) missense possibly damaging 0.95
R8431:Ryr2 UTSW 13 11,673,894 (GRCm39) missense probably benign 0.00
R8509:Ryr2 UTSW 13 11,592,664 (GRCm39) critical splice donor site probably null
R8551:Ryr2 UTSW 13 11,575,479 (GRCm39) missense possibly damaging 0.93
R8684:Ryr2 UTSW 13 11,702,875 (GRCm39) missense probably damaging 0.99
R8735:Ryr2 UTSW 13 11,701,833 (GRCm39) missense probably damaging 0.97
R8766:Ryr2 UTSW 13 11,683,855 (GRCm39) missense probably damaging 0.97
R8817:Ryr2 UTSW 13 11,750,509 (GRCm39) missense possibly damaging 0.95
R8827:Ryr2 UTSW 13 11,572,934 (GRCm39) missense possibly damaging 0.80
R8884:Ryr2 UTSW 13 11,794,152 (GRCm39) missense probably benign 0.19
R8889:Ryr2 UTSW 13 11,799,990 (GRCm39) missense probably damaging 0.99
R8891:Ryr2 UTSW 13 11,814,768 (GRCm39) missense probably damaging 1.00
R8979:Ryr2 UTSW 13 11,609,924 (GRCm39) missense probably benign 0.00
R9013:Ryr2 UTSW 13 11,618,618 (GRCm39) missense probably damaging 0.98
R9040:Ryr2 UTSW 13 11,609,672 (GRCm39) missense probably damaging 0.97
R9044:Ryr2 UTSW 13 11,752,989 (GRCm39) nonsense probably null
R9056:Ryr2 UTSW 13 11,610,817 (GRCm39) missense possibly damaging 0.94
R9084:Ryr2 UTSW 13 11,616,724 (GRCm39) missense probably damaging 1.00
R9113:Ryr2 UTSW 13 11,618,741 (GRCm39) intron probably benign
R9116:Ryr2 UTSW 13 11,587,185 (GRCm39) missense possibly damaging 0.93
R9125:Ryr2 UTSW 13 11,669,292 (GRCm39) missense probably benign 0.28
R9148:Ryr2 UTSW 13 11,900,424 (GRCm39) missense probably benign 0.02
R9210:Ryr2 UTSW 13 11,844,560 (GRCm39) missense probably damaging 0.99
R9212:Ryr2 UTSW 13 11,844,560 (GRCm39) missense probably damaging 0.99
R9233:Ryr2 UTSW 13 11,610,772 (GRCm39) missense possibly damaging 0.77
R9254:Ryr2 UTSW 13 11,898,002 (GRCm39) missense probably damaging 1.00
R9262:Ryr2 UTSW 13 11,765,854 (GRCm39) missense probably damaging 0.97
R9275:Ryr2 UTSW 13 11,897,976 (GRCm39) missense probably benign 0.10
R9278:Ryr2 UTSW 13 11,897,976 (GRCm39) missense probably benign 0.10
R9309:Ryr2 UTSW 13 11,721,578 (GRCm39) missense probably damaging 0.99
R9379:Ryr2 UTSW 13 11,898,002 (GRCm39) missense probably damaging 1.00
R9409:Ryr2 UTSW 13 11,695,973 (GRCm39) missense probably damaging 0.99
R9429:Ryr2 UTSW 13 11,809,459 (GRCm39) missense probably damaging 0.97
R9445:Ryr2 UTSW 13 11,787,463 (GRCm39) missense probably damaging 1.00
R9464:Ryr2 UTSW 13 11,752,680 (GRCm39) missense probably benign 0.00
R9467:Ryr2 UTSW 13 11,571,490 (GRCm39) missense possibly damaging 0.70
R9546:Ryr2 UTSW 13 11,602,101 (GRCm39) critical splice donor site probably null
R9562:Ryr2 UTSW 13 11,760,104 (GRCm39) missense probably damaging 1.00
R9609:Ryr2 UTSW 13 11,683,848 (GRCm39) missense probably damaging 1.00
R9704:Ryr2 UTSW 13 11,737,646 (GRCm39) missense probably damaging 1.00
R9764:Ryr2 UTSW 13 11,701,935 (GRCm39) missense possibly damaging 0.67
R9772:Ryr2 UTSW 13 11,609,785 (GRCm39) missense probably benign 0.13
R9776:Ryr2 UTSW 13 11,707,599 (GRCm39) missense probably damaging 0.98
S24628:Ryr2 UTSW 13 11,884,042 (GRCm39) missense probably damaging 0.97
X0019:Ryr2 UTSW 13 11,718,387 (GRCm39) missense probably benign 0.04
Z1176:Ryr2 UTSW 13 11,658,689 (GRCm39) critical splice donor site probably null
Z1176:Ryr2 UTSW 13 11,613,497 (GRCm39) critical splice acceptor site probably null
Z1176:Ryr2 UTSW 13 11,809,435 (GRCm39) nonsense probably null
Z1177:Ryr2 UTSW 13 11,765,759 (GRCm39) missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TATGGTTGGAGGCAGAGCAC -3'
(R):5'- AGGACTGTCACAGGACTTCAAC -3'

Sequencing Primer
(F):5'- CAGCTCAGGTGGTGAAACTTG -3'
(R):5'- GGACTTCAACAAAAAGACCAATTTG -3'
Posted On 2016-07-06