Mutagenetix > Incidental Mutations

Incidental Mutation 'R5297:Atp1a1'

405457

Institutional Source

Beutler Lab

Gene Symbol

Atp1a1

Ensembl Gene

ENSMUSG00000033161

Gene Name

ATPase, Na+/K+ transporting, alpha 1 polypeptide

Synonyms

Atpa-1

MMRRC Submission

042880-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5297 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

101576219-101604684 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 101591127 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 250 (V250M)

Ref Sequence

ENSEMBL: ENSMUSP00000039657 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036493]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000036493
AA Change: V250M

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000039657
Gene: ENSMUSG00000033161
AA Change: V250M

Domain	Start	End	E-Value	Type
low complexity region	21	28	N/A	INTRINSIC
Cation_ATPase_N	42	116	5e-20	SMART
Pfam:E1-E2_ATPase	134	365	1.6e-59	PFAM
Pfam:Hydrolase	370	729	2.7e-19	PFAM
Pfam:HAD	373	726	1.3e-18	PFAM
Pfam:Cation_ATPase	426	521	2.2e-25	PFAM
Pfam:Cation_ATPase_C	799	1008	1.2e-46	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136340

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200347

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 1 subunit. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene have a lethal phenotype. Heterozygotes display increased anxiety and decreased exploratory behavior in a new environment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acbd6	G	T	1: 155,587,458	A135S	probably benign	Het
Agbl4	A	G	4: 111,566,698	K307R	possibly damaging	Het
AI481877	A	G	4: 59,047,543	W1359R	probably benign	Het
Akna	T	C	4: 63,381,846	E653G	possibly damaging	Het
Arhgap26	T	C	18: 39,121,888	Y273H	probably damaging	Het
Atg14	G	A	14: 47,568,199	R70C	probably damaging	Het
Cacna1c	T	G	6: 118,742,361	D215A	probably damaging	Het
Cadps	T	A	14: 12,822,345	N132Y	probably damaging	Het
Casp6	T	C	3: 129,910,555	F97L	possibly damaging	Het
Ckap2l	T	C	2: 129,285,370	N296S	possibly damaging	Het
Col6a4	T	C	9: 106,074,867	K611E	probably benign	Het
Copa	A	G	1: 172,113,108	H696R	probably damaging	Het
Cyp2a4	T	A	7: 26,312,204	N283K	probably benign	Het
Dcc	C	T	18: 71,378,738	V869I	probably benign	Het
Efemp1	G	T	11: 28,867,868	G116C	probably damaging	Het
F830045P16Rik	T	C	2: 129,460,553	E373G	probably benign	Het
Fbxo9	T	C	9: 78,086,279	T318A	probably benign	Het
Gipr	A	G	7: 19,157,544	W403R	probably damaging	Het
Gm10093	A	G	17: 78,492,758	S393G	probably benign	Het
Gm12794	T	A	4: 101,941,151	D106E	possibly damaging	Het
Gm4787	G	C	12: 81,377,830	T518S	probably benign	Het
Golgb1	G	A	16: 36,875,616		probably benign	Het
Herc3	T	C	6: 58,856,641	L171P	probably damaging	Het
Il5ra	A	G	6: 106,738,134	I221T	probably benign	Het
Itgb2	A	G	10: 77,564,667	I705V	probably damaging	Het
Map4k4	G	T	1: 39,962,217	V55F	probably damaging	Het
Mast1	A	G	8: 84,913,318		probably null	Het
Mitf	G	T	6: 97,994,430	G186V	probably benign	Het
Mtpn	C	T	6: 35,512,290	D100N	probably benign	Het
Nrcam	T	C	12: 44,544,784	F204L	probably damaging	Het
Olfr1	AGCGGTCGTAGGC	AGC	11: 73,395,654		probably null	Het
Olfr1111	T	C	2: 87,150,449	I71V	probably benign	Het
Olfr1510	A	G	14: 52,410,218	L218P	probably damaging	Het
Olfr248	A	G	1: 174,391,200	M44V	probably benign	Het
Olfr381	A	T	11: 73,486,389	V145E	probably damaging	Het
Olfr446	T	C	6: 42,927,437	S69P	probably benign	Het
Olfr503	A	T	7: 108,545,404	N291I	probably damaging	Het
Pclo	A	T	5: 14,676,249		probably benign	Het
Pik3ca	T	A	3: 32,450,053	Y631N	probably damaging	Het
Ptk2b	T	C	14: 66,172,517	D462G	probably benign	Het
Rnf19a	A	G	15: 36,247,778	S427P	probably damaging	Het
Scn3a	T	A	2: 65,469,034	Y1376F	possibly damaging	Het
Spem1	A	G	11: 69,820,927	Y304H	probably damaging	Het
Stk38l	C	A	6: 146,775,655	Y450*	probably null	Het
Stx19	A	G	16: 62,821,974	E51G	probably damaging	Het
Ttc41	C	G	10: 86,776,579	Q1239E	probably benign	Het
Tuba3a	C	T	6: 125,281,340	R229H	probably damaging	Het
Utp18	A	T	11: 93,876,089	V264D	probably damaging	Het
V1rd19	T	C	7: 24,003,289	V60A	probably damaging	Het
Virma	T	G	4: 11,494,819	V40G	probably damaging	Het
Vmn1r160	C	T	7: 22,871,290	Q23*	probably null	Het
Vmn2r13	T	C	5: 109,191,939	I57V	probably benign	Het
Vmn2r26	T	A	6: 124,061,873	F802L	probably damaging	Het
Vmn2r61	A	G	7: 42,260,222	D57G	probably benign	Het
Vps13c	A	G	9: 67,878,131	N260S	probably damaging	Het
Xirp1	C	A	9: 120,019,602	A72S	probably damaging	Het
Zfp212	T	C	6: 47,929,077	V190A	probably benign	Het
Zfp703	C	T	8: 26,979,205	P299L	probably damaging	Het

Other mutations in Atp1a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01396:Atp1a1	APN	3	101591453	missense	probably damaging	1.00
IGL01700:Atp1a1	APN	3	101594258	missense	possibly damaging	0.95
IGL01836:Atp1a1	APN	3	101591414	missense	probably damaging	1.00
IGL01863:Atp1a1	APN	3	101591889	nonsense	probably null
IGL02021:Atp1a1	APN	3	101594208	missense	probably benign	0.02
IGL02078:Atp1a1	APN	3	101591863	missense	probably damaging	1.00
IGL02873:Atp1a1	APN	3	101576578	missense	probably benign	0.16
IGL02934:Atp1a1	APN	3	101576992	nonsense	probably null
IGL03068:Atp1a1	APN	3	101583859	missense	probably benign	0.26
PIT4453001:Atp1a1	UTSW	3	101581179	missense	probably benign	0.01
R0009:Atp1a1	UTSW	3	101579835	missense	possibly damaging	0.67
R0506:Atp1a1	UTSW	3	101589812	missense	probably damaging	0.96
R0724:Atp1a1	UTSW	3	101592439	missense	possibly damaging	0.50
R0826:Atp1a1	UTSW	3	101584853	missense	probably damaging	0.99
R1457:Atp1a1	UTSW	3	101590466	missense	probably damaging	1.00
R1732:Atp1a1	UTSW	3	101584799	missense	probably damaging	1.00
R1843:Atp1a1	UTSW	3	101582017	missense	probably benign	0.43
R2172:Atp1a1	UTSW	3	101590548	missense	probably benign
R3770:Atp1a1	UTSW	3	101581194	missense	probably benign	0.17
R3905:Atp1a1	UTSW	3	101590612	missense	probably benign	0.00
R4602:Atp1a1	UTSW	3	101586943	missense	probably benign	0.00
R4611:Atp1a1	UTSW	3	101586943	missense	probably benign	0.00
R4715:Atp1a1	UTSW	3	101591806	missense	possibly damaging	0.90
R4777:Atp1a1	UTSW	3	101594996	critical splice donor site	probably null
R4795:Atp1a1	UTSW	3	101583775	missense	probably benign	0.15
R5030:Atp1a1	UTSW	3	101579817	missense	probably benign	0.22
R5066:Atp1a1	UTSW	3	101582104	missense	probably damaging	0.98
R5165:Atp1a1	UTSW	3	101581789	missense	probably benign	0.01
R5307:Atp1a1	UTSW	3	101589964	missense	probably damaging	1.00
R5379:Atp1a1	UTSW	3	101582095	missense	probably benign	0.01
R5495:Atp1a1	UTSW	3	101591425	missense	probably benign	0.01
R5946:Atp1a1	UTSW	3	101589774	missense	probably benign	0.12
R6125:Atp1a1	UTSW	3	101590707	missense	probably damaging	1.00
R6789:Atp1a1	UTSW	3	101586298	missense	possibly damaging	0.71
R7339:Atp1a1	UTSW	3	101589872	missense	probably benign	0.44
R7552:Atp1a1	UTSW	3	101582121	nonsense	probably null
R7825:Atp1a1	UTSW	3	101586169	missense	probably benign	0.00
R8098:Atp1a1	UTSW	3	101582049	missense	probably damaging	0.97
X0019:Atp1a1	UTSW	3	101594213	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- AAACTTCCTGGGCTTTCCTG -3'
(R):5'- CATATCTGCAAACGGCTGC -3'

Sequencing Primer
(F):5'- TTTCCTGGCAGCAGGGGAAG -3'
(R):5'- TGAACCAGGAGACCTCTCTTG -3'

Posted On

2016-07-22