Incidental Mutation 'R5394:Rnf123'
ID 426063
Institutional Source Beutler Lab
Gene Symbol Rnf123
Ensembl Gene ENSMUSG00000041528
Gene Name ring finger protein 123
Synonyms KPC1
MMRRC Submission 042966-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.171) question?
Stock # R5394 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 107928869-107957183 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 107947930 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 131 (Y131C)
Ref Sequence ENSEMBL: ENSMUSP00000136953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047746] [ENSMUST00000160249] [ENSMUST00000160649] [ENSMUST00000161828] [ENSMUST00000162355] [ENSMUST00000162516] [ENSMUST00000178267] [ENSMUST00000174504]
AlphaFold Q5XPI3
Predicted Effect probably damaging
Transcript: ENSMUST00000047746
AA Change: Y131C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528
AA Change: Y131C

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159136
Predicted Effect probably damaging
Transcript: ENSMUST00000160249
AA Change: Y131C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528
AA Change: Y131C

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160649
AA Change: Y131C

PolyPhen 2 Score 0.193 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528
AA Change: Y131C

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161673
Predicted Effect probably benign
Transcript: ENSMUST00000161828
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162152
Predicted Effect possibly damaging
Transcript: ENSMUST00000162355
AA Change: Y131C

PolyPhen 2 Score 0.628 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528
AA Change: Y131C

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162516
Predicted Effect probably damaging
Transcript: ENSMUST00000178267
AA Change: Y131C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528
AA Change: Y131C

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174504
Meta Mutation Damage Score 0.1966 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 97% (96/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a C-terminal RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions, and an N-terminal SPRY domain. This protein displays E3 ubiquitin ligase activity toward the cyclin-dependent kinase inhibitor 1B which is also known as p27 or KIP1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik A G 3: 146,356,363 (GRCm39) F182L probably damaging Het
4930503B20Rik T C 3: 146,356,713 (GRCm39) Y65C probably damaging Het
4930590J08Rik A G 6: 91,896,174 (GRCm39) T341A probably benign Het
Adamts13 G A 2: 26,876,570 (GRCm39) V495I probably benign Het
Alms1 C A 6: 85,600,070 (GRCm39) T2101K probably benign Het
Als2 T C 1: 59,214,105 (GRCm39) D1361G probably benign Het
Ankdd1a A T 9: 65,412,496 (GRCm39) M275K probably benign Het
Arfip2 A T 7: 105,286,183 (GRCm39) Y161* probably null Het
Asap3 A T 4: 135,968,570 (GRCm39) E707D probably benign Het
Atm C T 9: 53,419,077 (GRCm39) probably null Het
Atp9b A T 18: 80,820,052 (GRCm39) S577R probably benign Het
Bltp1 G T 3: 36,971,817 (GRCm39) V517F probably damaging Het
Camk1d G C 2: 5,308,177 (GRCm39) D274E probably benign Het
Cebpz C T 17: 79,229,634 (GRCm39) D907N probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 105,036,102 (GRCm39) probably benign Het
Cnst T A 1: 179,429,301 (GRCm39) probably benign Het
Cog2 G T 8: 125,259,268 (GRCm39) V196L probably benign Het
Col11a1 A G 3: 113,987,833 (GRCm39) probably null Het
Cops6 T A 5: 138,161,762 (GRCm39) probably null Het
Cspg4 A G 9: 56,797,484 (GRCm39) E1316G probably damaging Het
Cwc22 G C 2: 77,759,683 (GRCm39) D122E possibly damaging Het
Dapk2 G A 9: 66,176,000 (GRCm39) V300M probably benign Het
Dcp1b C A 6: 119,152,328 (GRCm39) D25E probably damaging Het
Ddx10 A T 9: 53,145,157 (GRCm39) Y273* probably null Het
Dhx58 T C 11: 100,589,034 (GRCm39) E504G probably benign Het
Dync2h1 C T 9: 7,120,899 (GRCm39) W2129* probably null Het
Egr4 A T 6: 85,489,442 (GRCm39) L206Q probably damaging Het
Eif4g3 A G 4: 137,830,709 (GRCm39) probably null Het
Fbxo46 A G 7: 18,870,541 (GRCm39) N387D possibly damaging Het
Fpr-rs3 T G 17: 20,844,470 (GRCm39) M224L probably benign Het
Gm14325 G A 2: 177,474,777 (GRCm39) H102Y possibly damaging Het
Gxylt2 A G 6: 100,682,075 (GRCm39) K91E probably benign Het
Hecw1 A T 13: 14,497,174 (GRCm39) V278E probably damaging Het
Hydin A G 8: 111,266,474 (GRCm39) probably null Het
Iars1 T C 13: 49,875,641 (GRCm39) L776P probably damaging Het
Kcnh2 T A 5: 24,537,039 (GRCm39) T182S probably benign Het
Kplce T C 3: 92,776,005 (GRCm39) E226G probably damaging Het
Lats2 T G 14: 57,928,810 (GRCm39) S1022R probably benign Het
Lef1 C T 3: 130,988,308 (GRCm39) P264S probably damaging Het
Lyrm1 A C 7: 119,513,471 (GRCm39) I79L possibly damaging Het
Macroh2a2 G A 10: 61,587,466 (GRCm39) T156M possibly damaging Het
Man2b2 T G 5: 36,971,862 (GRCm39) Q618P probably benign Het
Mei1 T C 15: 81,976,957 (GRCm39) V180A possibly damaging Het
Mmp15 A T 8: 96,093,032 (GRCm39) N137I probably damaging Het
Mms22l A G 4: 24,517,115 (GRCm39) D222G possibly damaging Het
Mmut T A 17: 41,258,075 (GRCm39) S414T probably benign Het
Myo18a T C 11: 77,744,176 (GRCm39) M1846T probably benign Het
Neo1 A T 9: 58,897,517 (GRCm39) N146K probably benign Het
Nos3 A G 5: 24,588,888 (GRCm39) T1174A probably benign Het
Or10d4b A T 9: 39,534,430 (GRCm39) T4S probably benign Het
Or10x1 T C 1: 174,196,836 (GRCm39) Y118H probably damaging Het
Or4c125 A T 2: 89,169,806 (GRCm39) I280N probably damaging Het
Or51f1 A T 7: 102,505,686 (GRCm39) S268T probably damaging Het
Pax8 A T 2: 24,332,922 (GRCm39) probably benign Het
Pde5a G A 3: 122,611,658 (GRCm39) C532Y probably damaging Het
Pigq T C 17: 26,150,446 (GRCm39) D442G possibly damaging Het
Pik3c2g T C 6: 139,665,808 (GRCm39) V43A probably benign Het
Pik3cb T C 9: 98,970,716 (GRCm39) N325S probably benign Het
Pot1b T C 17: 56,007,063 (GRCm39) K18R probably benign Het
Ppp1r42 A T 1: 10,069,630 (GRCm39) L144Q probably damaging Het
Prdm13 T A 4: 21,679,455 (GRCm39) Q345L unknown Het
Pyroxd2 T A 19: 42,728,898 (GRCm39) K167N probably benign Het
Rnf25 T C 1: 74,634,411 (GRCm39) D204G probably damaging Het
Rpf2 G A 10: 40,109,181 (GRCm39) T60I possibly damaging Het
Scaf11 T C 15: 96,317,339 (GRCm39) N742D probably benign Het
Shank1 G A 7: 44,002,075 (GRCm39) D1257N possibly damaging Het
Shc2 A G 10: 79,465,933 (GRCm39) V168A probably damaging Het
Slc16a4 G A 3: 107,199,758 (GRCm39) V2M probably benign Het
Slc24a3 T C 2: 145,455,494 (GRCm39) V461A probably benign Het
Slc45a2 C T 15: 11,027,871 (GRCm39) T480I probably damaging Het
Slc4a4 T A 5: 89,345,623 (GRCm39) probably null Het
Snx30 T A 4: 59,879,329 (GRCm39) D189E probably benign Het
Sspo A G 6: 48,472,194 (GRCm39) Q4653R possibly damaging Het
Tpte G T 8: 22,817,806 (GRCm39) R264I probably damaging Het
Tsc22d4 T A 5: 137,757,036 (GRCm39) probably benign Het
Ubn1 T C 16: 4,892,233 (GRCm39) L585P possibly damaging Het
Usp24 A T 4: 106,265,210 (GRCm39) D1781V probably damaging Het
Utp20 A T 10: 88,608,777 (GRCm39) Y1514* probably null Het
Vmn1r55 A T 7: 5,149,995 (GRCm39) Y143N probably damaging Het
Vmn2r65 A G 7: 84,595,862 (GRCm39) V274A probably benign Het
Wdr17 A G 8: 55,092,524 (GRCm39) S1087P possibly damaging Het
Wnt5b C A 6: 119,417,283 (GRCm39) R156L probably damaging Het
Zan T C 5: 137,433,896 (GRCm39) D2279G unknown Het
Zan T C 5: 137,462,336 (GRCm39) T948A unknown Het
Zfp758 T C 17: 22,591,049 (GRCm39) S4P probably damaging Het
Zfp839 A G 12: 110,822,020 (GRCm39) E278G probably benign Het
Zfp994 T A 17: 22,419,506 (GRCm39) H481L probably damaging Het
Zswim9 G A 7: 12,994,909 (GRCm39) R416C probably damaging Het
Other mutations in Rnf123
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Rnf123 APN 9 107,944,594 (GRCm39) critical splice donor site probably null
IGL01358:Rnf123 APN 9 107,946,381 (GRCm39) missense probably damaging 1.00
IGL01464:Rnf123 APN 9 107,929,501 (GRCm39) missense probably damaging 1.00
IGL01637:Rnf123 APN 9 107,935,437 (GRCm39) missense probably damaging 1.00
IGL01669:Rnf123 APN 9 107,935,555 (GRCm39) missense probably damaging 0.98
IGL01905:Rnf123 APN 9 107,948,569 (GRCm39) splice site probably benign
IGL02070:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02072:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02073:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02074:Rnf123 APN 9 107,944,088 (GRCm39) missense probably damaging 1.00
IGL02079:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02080:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02231:Rnf123 APN 9 107,943,598 (GRCm39) missense probably benign 0.17
IGL02281:Rnf123 APN 9 107,948,651 (GRCm39) missense probably benign 0.01
IGL02336:Rnf123 APN 9 107,939,041 (GRCm39) missense probably damaging 1.00
IGL02543:Rnf123 APN 9 107,943,547 (GRCm39) missense probably damaging 1.00
IGL02565:Rnf123 APN 9 107,929,411 (GRCm39) critical splice donor site probably null
IGL02571:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02572:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02574:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02586:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02589:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02600:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02601:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02602:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02603:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02609:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02628:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02629:Rnf123 APN 9 107,947,988 (GRCm39) splice site probably benign
IGL02629:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02630:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02631:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02632:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02650:Rnf123 APN 9 107,946,947 (GRCm39) missense probably benign 0.29
IGL02690:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02691:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02692:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02693:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02713:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02736:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02929:Rnf123 APN 9 107,946,275 (GRCm39) missense probably benign
R1175:Rnf123 UTSW 9 107,954,572 (GRCm39) missense probably benign
R1465:Rnf123 UTSW 9 107,948,665 (GRCm39) splice site probably benign
R1502:Rnf123 UTSW 9 107,945,709 (GRCm39) splice site probably null
R1682:Rnf123 UTSW 9 107,954,597 (GRCm39) missense probably benign 0.16
R1817:Rnf123 UTSW 9 107,940,125 (GRCm39) missense probably benign 0.41
R1855:Rnf123 UTSW 9 107,938,990 (GRCm39) missense probably damaging 1.00
R2394:Rnf123 UTSW 9 107,940,735 (GRCm39) missense probably benign 0.00
R2483:Rnf123 UTSW 9 107,940,720 (GRCm39) missense probably benign 0.16
R3896:Rnf123 UTSW 9 107,946,302 (GRCm39) splice site probably benign
R3940:Rnf123 UTSW 9 107,941,234 (GRCm39) splice site probably benign
R4206:Rnf123 UTSW 9 107,941,162 (GRCm39) missense probably benign 0.01
R4641:Rnf123 UTSW 9 107,935,786 (GRCm39) missense probably damaging 1.00
R4714:Rnf123 UTSW 9 107,929,638 (GRCm39) splice site probably null
R4767:Rnf123 UTSW 9 107,929,288 (GRCm39) missense probably damaging 1.00
R4849:Rnf123 UTSW 9 107,933,290 (GRCm39) missense probably damaging 1.00
R4899:Rnf123 UTSW 9 107,940,879 (GRCm39) missense probably damaging 1.00
R5274:Rnf123 UTSW 9 107,941,202 (GRCm39) frame shift probably null
R5275:Rnf123 UTSW 9 107,941,202 (GRCm39) frame shift probably null
R5276:Rnf123 UTSW 9 107,941,202 (GRCm39) frame shift probably null
R5294:Rnf123 UTSW 9 107,941,202 (GRCm39) frame shift probably null
R5295:Rnf123 UTSW 9 107,941,202 (GRCm39) frame shift probably null
R5717:Rnf123 UTSW 9 107,944,623 (GRCm39) missense probably damaging 1.00
R6186:Rnf123 UTSW 9 107,947,157 (GRCm39) missense possibly damaging 0.55
R6449:Rnf123 UTSW 9 107,933,252 (GRCm39) missense probably benign 0.17
R6502:Rnf123 UTSW 9 107,945,531 (GRCm39) missense possibly damaging 0.46
R6944:Rnf123 UTSW 9 107,940,822 (GRCm39) missense probably benign 0.02
R7003:Rnf123 UTSW 9 107,940,882 (GRCm39) critical splice acceptor site probably null
R7088:Rnf123 UTSW 9 107,935,735 (GRCm39) missense probably null 1.00
R7092:Rnf123 UTSW 9 107,945,799 (GRCm39) missense probably benign 0.07
R7100:Rnf123 UTSW 9 107,933,838 (GRCm39) missense probably damaging 1.00
R7257:Rnf123 UTSW 9 107,946,228 (GRCm39) missense probably damaging 1.00
R7453:Rnf123 UTSW 9 107,947,607 (GRCm39) splice site probably null
R7468:Rnf123 UTSW 9 107,946,208 (GRCm39) missense probably benign 0.00
R7517:Rnf123 UTSW 9 107,947,473 (GRCm39) nonsense probably null
R7577:Rnf123 UTSW 9 107,947,818 (GRCm39) missense probably damaging 1.00
R8296:Rnf123 UTSW 9 107,940,089 (GRCm39) missense probably damaging 1.00
R8322:Rnf123 UTSW 9 107,945,706 (GRCm39) missense probably benign 0.26
R8754:Rnf123 UTSW 9 107,948,363 (GRCm39) missense probably damaging 1.00
R8783:Rnf123 UTSW 9 107,946,272 (GRCm39) missense probably benign
R9052:Rnf123 UTSW 9 107,936,930 (GRCm39) missense probably damaging 1.00
R9156:Rnf123 UTSW 9 107,940,227 (GRCm39) splice site probably benign
R9170:Rnf123 UTSW 9 107,948,375 (GRCm39) missense probably damaging 1.00
R9332:Rnf123 UTSW 9 107,944,704 (GRCm39) missense probably benign 0.00
R9385:Rnf123 UTSW 9 107,929,467 (GRCm39) missense probably benign 0.02
R9394:Rnf123 UTSW 9 107,942,905 (GRCm39) missense probably damaging 1.00
R9432:Rnf123 UTSW 9 107,937,008 (GRCm39) missense probably damaging 0.96
R9717:Rnf123 UTSW 9 107,954,963 (GRCm39) missense probably benign 0.43
Z1176:Rnf123 UTSW 9 107,940,180 (GRCm39) missense probably damaging 1.00
Z1176:Rnf123 UTSW 9 107,935,594 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGATTAAAGCGGCAGTTG -3'
(R):5'- ATCATGTCTGTCCCAGAAGCTC -3'

Sequencing Primer
(F):5'- ATTAAAGCGGCAGTTGATGGTGC -3'
(R):5'- CAGAAGCTCTGGACATGGATAC -3'
Posted On 2016-08-04