Mutagenetix > Incidental Mutation

Incidental Mutation 'R5394:Rnf123'

426063

Institutional Source

Beutler Lab

Gene Symbol

Rnf123

Ensembl Gene

ENSMUSG00000041528

Gene Name

ring finger protein 123

Synonyms

KPC1

MMRRC Submission

042966-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.180) question?

Stock #

R5394 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

108051534-108083346 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 108070731 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 131 (Y131C)

Ref Sequence

ENSEMBL: ENSMUSP00000136953 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047746] [ENSMUST00000160249] [ENSMUST00000160649] [ENSMUST00000161828] [ENSMUST00000162355] [ENSMUST00000162516] [ENSMUST00000174504] [ENSMUST00000178267]

AlphaFold

Q5XPI3

Predicted Effect

probably damaging
Transcript: ENSMUST00000047746
AA Change: Y131C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528
AA Change: Y131C

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1047	1067	N/A	INTRINSIC
low complexity region	1242	1251	N/A	INTRINSIC
RING	1260	1297	5.27e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159136

Predicted Effect

probably damaging
Transcript: ENSMUST00000160249
AA Change: Y131C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528
AA Change: Y131C

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC
low complexity region	1236	1245	N/A	INTRINSIC
RING	1254	1291	5.27e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000160649
AA Change: Y131C

PolyPhen 2 Score 0.193 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528
AA Change: Y131C

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161673

Predicted Effect

probably benign
Transcript: ENSMUST00000161828

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162152

Predicted Effect

possibly damaging
Transcript: ENSMUST00000162355
AA Change: Y131C

PolyPhen 2 Score 0.628 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528
AA Change: Y131C

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1047	1067	N/A	INTRINSIC
low complexity region	1242	1251	N/A	INTRINSIC
RING	1260	1297	5.27e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000162516

Predicted Effect

probably benign
Transcript: ENSMUST00000174504

Predicted Effect

probably damaging
Transcript: ENSMUST00000178267
AA Change: Y131C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528
AA Change: Y131C

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC
low complexity region	1236	1245	N/A	INTRINSIC
RING	1254	1291	5.27e-4	SMART

Meta Mutation Damage Score

0.1966

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

97% (96/99)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a C-terminal RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions, and an N-terminal SPRY domain. This protein displays E3 ubiquitin ligase activity toward the cyclin-dependent kinase inhibitor 1B which is also known as p27 or KIP1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310050C09Rik	T	C	3: 92,868,698	E226G	probably damaging	Het
4930503B20Rik	A	G	3: 146,650,608	F182L	probably damaging	Het
4930503B20Rik	T	C	3: 146,650,958	Y65C	probably damaging	Het
4930590J08Rik	A	G	6: 91,919,193	T341A	probably benign	Het
4932438A13Rik	G	T	3: 36,917,668	V517F	probably damaging	Het
Adamts13	G	A	2: 26,986,558	V495I	probably benign	Het
Alms1	C	A	6: 85,623,088	T2101K	probably benign	Het
Als2	T	C	1: 59,174,946	D1361G	probably benign	Het
Ankdd1a	A	T	9: 65,505,214	M275K	probably benign	Het
Arfip2	A	T	7: 105,636,976	Y161*	probably null	Het
Asap3	A	T	4: 136,241,259	E707D	probably benign	Het
Atm	C	T	9: 53,507,777		probably null	Het
Atp9b	A	T	18: 80,776,837	S577R	probably benign	Het
Camk1d	G	C	2: 5,303,366	D274E	probably benign	Het
Cebpz	C	T	17: 78,922,205	D907N	probably benign	Het
Cmtm1	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	8: 104,309,470		probably benign	Het
Cnst	T	A	1: 179,601,736		probably benign	Het
Cog2	G	T	8: 124,532,529	V196L	probably benign	Het
Col11a1	A	G	3: 114,194,184		probably null	Het
Cops6	T	A	5: 138,163,500		probably null	Het
Cspg4	A	G	9: 56,890,200	E1316G	probably damaging	Het
Cwc22	G	C	2: 77,929,339	D122E	possibly damaging	Het
Dapk2	G	A	9: 66,268,718	V300M	probably benign	Het
Dcp1b	C	A	6: 119,175,367	D25E	probably damaging	Het
Ddx10	A	T	9: 53,233,857	Y273*	probably null	Het
Dhx58	T	C	11: 100,698,208	E504G	probably benign	Het
Dync2h1	C	T	9: 7,120,899	W2129*	probably null	Het
Egr4	A	T	6: 85,512,460	L206Q	probably damaging	Het
Eif4g3	A	G	4: 138,103,398		probably null	Het
Fbxo46	A	G	7: 19,136,616	N387D	possibly damaging	Het
Fpr-rs3	T	G	17: 20,624,208	M224L	probably benign	Het
Gm14325	G	A	2: 177,832,984	H102Y	possibly damaging	Het
Gxylt2	A	G	6: 100,705,114	K91E	probably benign	Het
H2afy2	G	A	10: 61,751,687	T156M	possibly damaging	Het
Hecw1	A	T	13: 14,322,589	V278E	probably damaging	Het
Hydin	A	G	8: 110,539,842		probably null	Het
Iars	T	C	13: 49,722,165	L776P	probably damaging	Het
Kcnh2	T	A	5: 24,332,041	T182S	probably benign	Het
Lats2	T	G	14: 57,691,353	S1022R	probably benign	Het
Lef1	C	T	3: 131,194,659	P264S	probably damaging	Het
Lyrm1	A	C	7: 119,914,248	I79L	possibly damaging	Het
Man2b2	T	G	5: 36,814,518	Q618P	probably benign	Het
Mei1	T	C	15: 82,092,756	V180A	possibly damaging	Het
Mmp15	A	T	8: 95,366,404	N137I	probably damaging	Het
Mms22l	A	G	4: 24,517,115	D222G	possibly damaging	Het
Mut	T	A	17: 40,947,184	S414T	probably benign	Het
Myo18a	T	C	11: 77,853,350	M1846T	probably benign	Het
Neo1	A	T	9: 58,990,234	N146K	probably benign	Het
Nos3	A	G	5: 24,383,890	T1174A	probably benign	Het
Olfr1233	A	T	2: 89,339,462	I280N	probably damaging	Het
Olfr417	T	C	1: 174,369,270	Y118H	probably damaging	Het
Olfr566	A	T	7: 102,856,479	S268T	probably damaging	Het
Olfr960	A	T	9: 39,623,134	T4S	probably benign	Het
Pax8	A	T	2: 24,442,910		probably benign	Het
Pde5a	G	A	3: 122,818,009	C532Y	probably damaging	Het
Pigq	T	C	17: 25,931,472	D442G	possibly damaging	Het
Pik3c2g	T	C	6: 139,720,082	V43A	probably benign	Het
Pik3cb	T	C	9: 99,088,663	N325S	probably benign	Het
Pot1b	T	C	17: 55,700,063	K18R	probably benign	Het
Ppp1r42	A	T	1: 9,999,405	L144Q	probably damaging	Het
Prdm13	T	A	4: 21,679,455	Q345L	unknown	Het
Pyroxd2	T	A	19: 42,740,459	K167N	probably benign	Het
Rnf25	T	C	1: 74,595,252	D204G	probably damaging	Het
Rpf2	G	A	10: 40,233,185	T60I	possibly damaging	Het
Scaf11	T	C	15: 96,419,458	N742D	probably benign	Het
Shank1	G	A	7: 44,352,651	D1257N	possibly damaging	Het
Shc2	A	G	10: 79,630,099	V168A	probably damaging	Het
Slc16a4	G	A	3: 107,292,442	V2M	probably benign	Het
Slc24a3	T	C	2: 145,613,574	V461A	probably benign	Het
Slc45a2	C	T	15: 11,027,785	T480I	probably damaging	Het
Slc4a4	T	A	5: 89,197,764		probably null	Het
Snx30	T	A	4: 59,879,329	D189E	probably benign	Het
Sspo	A	G	6: 48,495,260	Q4653R	possibly damaging	Het
Tpte	G	T	8: 22,327,790	R264I	probably damaging	Het
Tsc22d4	T	A	5: 137,758,774		probably benign	Het
Ubn1	T	C	16: 5,074,369	L585P	possibly damaging	Het
Usp24	A	T	4: 106,408,013	D1781V	probably damaging	Het
Utp20	A	T	10: 88,772,915	Y1514*	probably null	Het
Vmn1r55	A	T	7: 5,146,996	Y143N	probably damaging	Het
Vmn2r65	A	G	7: 84,946,654	V274A	probably benign	Het
Wdr17	A	G	8: 54,639,489	S1087P	possibly damaging	Het
Wnt5b	C	A	6: 119,440,322	R156L	probably damaging	Het
Zan	T	C	5: 137,435,634	D2279G	unknown	Het
Zan	T	C	5: 137,464,074	T948A	unknown	Het
Zfp758	T	C	17: 22,372,068	S4P	probably damaging	Het
Zfp839	A	G	12: 110,855,586	E278G	probably benign	Het
Zfp994	T	A	17: 22,200,525	H481L	probably damaging	Het
Zswim9	G	A	7: 13,260,983	R416C	probably damaging	Het

Other mutations in Rnf123

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00950:Rnf123	APN	9	108067395	critical splice donor site	probably null
IGL01358:Rnf123	APN	9	108069182	missense	probably damaging	1.00
IGL01464:Rnf123	APN	9	108052302	missense	probably damaging	1.00
IGL01637:Rnf123	APN	9	108058238	missense	probably damaging	1.00
IGL01669:Rnf123	APN	9	108058356	missense	probably damaging	0.98
IGL01905:Rnf123	APN	9	108071370	splice site	probably benign
IGL02070:Rnf123	APN	9	108068302	nonsense	probably null
IGL02072:Rnf123	APN	9	108068302	nonsense	probably null
IGL02073:Rnf123	APN	9	108068302	nonsense	probably null
IGL02074:Rnf123	APN	9	108066889	missense	probably damaging	1.00
IGL02079:Rnf123	APN	9	108068302	nonsense	probably null
IGL02080:Rnf123	APN	9	108068302	nonsense	probably null
IGL02231:Rnf123	APN	9	108066399	missense	probably benign	0.17
IGL02281:Rnf123	APN	9	108071452	missense	probably benign	0.01
IGL02336:Rnf123	APN	9	108061842	missense	probably damaging	1.00
IGL02543:Rnf123	APN	9	108066348	missense	probably damaging	1.00
IGL02565:Rnf123	APN	9	108052212	critical splice donor site	probably null
IGL02571:Rnf123	APN	9	108068302	nonsense	probably null
IGL02572:Rnf123	APN	9	108068302	nonsense	probably null
IGL02574:Rnf123	APN	9	108068302	nonsense	probably null
IGL02586:Rnf123	APN	9	108068302	nonsense	probably null
IGL02589:Rnf123	APN	9	108068302	nonsense	probably null
IGL02600:Rnf123	APN	9	108068302	nonsense	probably null
IGL02601:Rnf123	APN	9	108068302	nonsense	probably null
IGL02602:Rnf123	APN	9	108068302	nonsense	probably null
IGL02603:Rnf123	APN	9	108068302	nonsense	probably null
IGL02609:Rnf123	APN	9	108068302	nonsense	probably null
IGL02628:Rnf123	APN	9	108068302	nonsense	probably null
IGL02629:Rnf123	APN	9	108068302	nonsense	probably null
IGL02629:Rnf123	APN	9	108070789	splice site	probably benign
IGL02630:Rnf123	APN	9	108068302	nonsense	probably null
IGL02631:Rnf123	APN	9	108068302	nonsense	probably null
IGL02632:Rnf123	APN	9	108068302	nonsense	probably null
IGL02650:Rnf123	APN	9	108069748	missense	probably benign	0.29
IGL02690:Rnf123	APN	9	108068302	nonsense	probably null
IGL02691:Rnf123	APN	9	108068302	nonsense	probably null
IGL02692:Rnf123	APN	9	108068302	nonsense	probably null
IGL02693:Rnf123	APN	9	108068302	nonsense	probably null
IGL02713:Rnf123	APN	9	108068302	nonsense	probably null
IGL02736:Rnf123	APN	9	108068302	nonsense	probably null
IGL02929:Rnf123	APN	9	108069076	missense	probably benign
R1175:Rnf123	UTSW	9	108077373	missense	probably benign
R1465:Rnf123	UTSW	9	108071466	splice site	probably benign
R1502:Rnf123	UTSW	9	108068510	splice site	probably null
R1682:Rnf123	UTSW	9	108077398	missense	probably benign	0.16
R1817:Rnf123	UTSW	9	108062926	missense	probably benign	0.41
R1855:Rnf123	UTSW	9	108061791	missense	probably damaging	1.00
R2394:Rnf123	UTSW	9	108063536	missense	probably benign	0.00
R2483:Rnf123	UTSW	9	108063521	missense	probably benign	0.16
R3896:Rnf123	UTSW	9	108069103	splice site	probably benign
R3940:Rnf123	UTSW	9	108064035	splice site	probably benign
R4206:Rnf123	UTSW	9	108063963	missense	probably benign	0.01
R4641:Rnf123	UTSW	9	108058587	missense	probably damaging	1.00
R4714:Rnf123	UTSW	9	108052439	splice site	probably null
R4767:Rnf123	UTSW	9	108052089	missense	probably damaging	1.00
R4849:Rnf123	UTSW	9	108056091	missense	probably damaging	1.00
R4899:Rnf123	UTSW	9	108063680	missense	probably damaging	1.00
R5274:Rnf123	UTSW	9	108064003	frame shift	probably null
R5275:Rnf123	UTSW	9	108064003	frame shift	probably null
R5276:Rnf123	UTSW	9	108064003	frame shift	probably null
R5294:Rnf123	UTSW	9	108064003	frame shift	probably null
R5295:Rnf123	UTSW	9	108064003	frame shift	probably null
R5717:Rnf123	UTSW	9	108067424	missense	probably damaging	1.00
R6186:Rnf123	UTSW	9	108069958	missense	possibly damaging	0.55
R6449:Rnf123	UTSW	9	108056053	missense	probably benign	0.17
R6502:Rnf123	UTSW	9	108068332	missense	possibly damaging	0.46
R6944:Rnf123	UTSW	9	108063623	missense	probably benign	0.02
R7003:Rnf123	UTSW	9	108063683	critical splice acceptor site	probably null
R7088:Rnf123	UTSW	9	108058536	missense	probably null	1.00
R7092:Rnf123	UTSW	9	108068600	missense	probably benign	0.07
R7100:Rnf123	UTSW	9	108056639	missense	probably damaging	1.00
R7257:Rnf123	UTSW	9	108069029	missense	probably damaging	1.00
R7453:Rnf123	UTSW	9	108070408	splice site	probably null
R7468:Rnf123	UTSW	9	108069009	missense	probably benign	0.00
R7517:Rnf123	UTSW	9	108070274	nonsense	probably null
R7577:Rnf123	UTSW	9	108070619	missense	probably damaging	1.00
R8296:Rnf123	UTSW	9	108062890	missense	probably damaging	1.00
R8322:Rnf123	UTSW	9	108068507	missense	probably benign	0.26
R8754:Rnf123	UTSW	9	108071164	missense	probably damaging	1.00
R8783:Rnf123	UTSW	9	108069073	missense	probably benign
R9052:Rnf123	UTSW	9	108059731	missense	probably damaging	1.00
R9156:Rnf123	UTSW	9	108063028	splice site	probably benign
R9170:Rnf123	UTSW	9	108071176	missense	probably damaging	1.00
R9332:Rnf123	UTSW	9	108067505	missense	probably benign	0.00
R9385:Rnf123	UTSW	9	108052268	missense	probably benign	0.02
R9394:Rnf123	UTSW	9	108065706	missense	probably damaging	1.00
R9432:Rnf123	UTSW	9	108059809	missense	probably damaging	0.96
R9717:Rnf123	UTSW	9	108077764	missense	probably benign	0.43
Z1176:Rnf123	UTSW	9	108058395	missense	probably damaging	1.00
Z1176:Rnf123	UTSW	9	108062981	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCTGATTAAAGCGGCAGTTG -3'
(R):5'- ATCATGTCTGTCCCAGAAGCTC -3'

Sequencing Primer
(F):5'- ATTAAAGCGGCAGTTGATGGTGC -3'
(R):5'- CAGAAGCTCTGGACATGGATAC -3'

Posted On

2016-08-04