Mutagenetix > Incidental Mutation

Incidental Mutation 'R9432:Rnf123'

713032

Institutional Source

Beutler Lab

Gene Symbol

Rnf123

Ensembl Gene

ENSMUSG00000041528

Gene Name

ring finger protein 123

Synonyms

KPC1

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.212) question?

Stock #

R9432 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

108051534-108083346 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 108059809 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 849 (R849H)

Ref Sequence

ENSEMBL: ENSMUSP00000125745 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047746] [ENSMUST00000085060] [ENSMUST00000160249] [ENSMUST00000160649] [ENSMUST00000162355] [ENSMUST00000162753] [ENSMUST00000178267]

AlphaFold

Q5XPI3

Predicted Effect

probably damaging
Transcript: ENSMUST00000047746
AA Change: R849H

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528
AA Change: R849H

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1047	1067	N/A	INTRINSIC
low complexity region	1242	1251	N/A	INTRINSIC
RING	1260	1297	5.27e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000085060

SMART Domains

Protein: ENSMUSP00000082137
Gene: ENSMUSG00000032593

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
LRRNT	33	65	2.55e-2	SMART
LRR	65	83	6.97e1	SMART
LRR_TYP	84	107	1.56e-2	SMART
LRR	109	131	2.84e1	SMART
LRR	132	155	7.05e-1	SMART
LRR	156	176	3.98e1	SMART
LRR	182	206	5.56e0	SMART
Blast:LRRCT	219	274	8e-23	BLAST
IG	285	372	1.59e-6	SMART
transmembrane domain	383	405	N/A	INTRINSIC
low complexity region	407	422	N/A	INTRINSIC
low complexity region	492	504	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000159306

SMART Domains

Protein: ENSMUSP00000125695
Gene: ENSMUSG00000041528

Domain	Start	End	E-Value	Type
coiled coil region	172	192	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000160249
AA Change: R843H

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528
AA Change: R843H

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC
low complexity region	1236	1245	N/A	INTRINSIC
RING	1254	1291	5.27e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000160649
AA Change: R843H

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528
AA Change: R843H

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000162355
AA Change: R849H

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528
AA Change: R849H

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1047	1067	N/A	INTRINSIC
low complexity region	1242	1251	N/A	INTRINSIC
RING	1260	1297	5.27e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000162753

Predicted Effect

probably damaging
Transcript: ENSMUST00000178267
AA Change: R843H

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528
AA Change: R843H

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC
low complexity region	1236	1245	N/A	INTRINSIC
RING	1254	1291	5.27e-4	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a C-terminal RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions, and an N-terminal SPRY domain. This protein displays E3 ubiquitin ligase activity toward the cyclin-dependent kinase inhibitor 1B which is also known as p27 or KIP1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	T	C	5: 109,737,051	R314G	unknown	Het
Abca13	G	A	11: 9,294,559	V2141M	probably benign	Het
Abcc10	G	A	17: 46,323,784	A431V	possibly damaging	Het
Acod1	A	G	14: 103,054,978	R313G	probably damaging	Het
Adam3	G	T	8: 24,703,912	S361R	probably damaging	Het
Ahcyl2	C	T	6: 29,768,875	T113M	possibly damaging	Het
Ano8	C	A	8: 71,480,917	R577L	unknown	Het
Arhgef7	T	A	8: 11,819,646	S653R	probably damaging	Het
Atp10a	G	A	7: 58,819,670	V1090I	possibly damaging	Het
Birc6	A	G	17: 74,659,221	M4048V	probably benign	Het
C3	G	A	17: 57,223,950	P384S	probably damaging	Het
Camkk1	A	T	11: 73,037,931	E432V	probably damaging	Het
Celsr3	T	A	9: 108,848,833	V3087D	probably benign	Het
Ckap4	A	G	10: 84,527,679	S507P	probably damaging	Het
Coq6	G	A	12: 84,373,690	M471I	probably benign	Het
Csmd2	C	A	4: 128,277,211	H332Q		Het
Cxcr1	T	A	1: 74,192,072	N264Y	probably damaging	Het
Dchs2	C	A	3: 83,128,725	R260S	possibly damaging	Het
Elmod2	C	A	8: 83,331,132	A41S	possibly damaging	Het
Emilin2	G	A	17: 71,274,786	T315I	probably benign	Het
Eml1	A	G	12: 108,516,583	N487S	probably benign	Het
Epn1	G	T	7: 5,093,370	R221L	probably benign	Het
Faah	A	G	4: 116,017,575	V28A	probably benign	Het
Fbl	G	A	7: 28,177,264	R230H	probably benign	Het
Fsip2	C	T	2: 82,975,563	S742F	probably damaging	Het
Gm5460	A	G	14: 34,045,812	D184G	possibly damaging	Het
Gpatch2l	T	C	12: 86,260,634	V262A	probably damaging	Het
Grin2c	A	T	11: 115,251,226	L789*	probably null	Het
H1f0	C	T	15: 79,028,747	P9L	probably damaging	Het
Hectd4	A	G	5: 121,322,801	T948A	probably benign	Het
Herc2	G	A	7: 56,131,184	G1199D	probably damaging	Het
Hoxb7	G	T	11: 96,286,791	A22S	possibly damaging	Het
Ifih1	T	A	2: 62,609,274	I519F	probably damaging	Het
Ifit1bl1	T	A	19: 34,594,098	I320F	possibly damaging	Het
Iqgap2	T	C	13: 95,637,753	T1320A	probably benign	Het
Kat2a	A	G	11: 100,711,352	V192A	probably damaging	Het
Kat6b	A	C	14: 21,622,009	H329P	probably damaging	Het
Klhl29	A	G	12: 5,210,056	L54P	probably benign	Het
Kntc1	A	T	5: 123,787,049	I1142F	possibly damaging	Het
Lipo3	A	G	19: 33,556,464	Y323H	probably damaging	Het
Lmtk3	G	A	7: 45,792,570	V351I	probably damaging	Het
Lrrc8b	T	C	5: 105,486,022	S787P	probably benign	Het
Magi1	A	G	6: 93,683,077	I1179T	probably damaging	Het
Mapk11	T	C	15: 89,144,428	D269G	probably benign	Het
Mfsd13a	T	G	19: 46,366,429	I15R	probably benign	Het
Myo1h	G	A	5: 114,361,305	V143I	possibly damaging	Het
Naaladl1	T	C	19: 6,106,887	I187T	possibly damaging	Het
Nos1	G	A	5: 117,896,806	V416M	probably damaging	Het
Olfr1076	T	G	2: 86,508,570	I37S	probably benign	Het
Olfr294	G	A	7: 86,615,857	R263C	possibly damaging	Het
Olfr761	A	G	17: 37,952,668	S119P	probably damaging	Het
Pcdh15	A	G	10: 74,624,338	T1373A	probably damaging	Het
Pcdh18	T	G	3: 49,745,218	M932L	probably damaging	Het
Pcdhb15	T	A	18: 37,475,630	H638Q	probably benign	Het
Pcdhb19	A	G	18: 37,497,575	E141G	possibly damaging	Het
Pds5b	T	G	5: 150,769,791	L656R	probably damaging	Het
Plcl1	T	C	1: 55,406,428	L14P	probably benign	Het
Pzp	A	T	6: 128,522,165	I173N		Het
Sfrp5	T	C	19: 42,199,786	D198G	probably damaging	Het
Sftpb	G	C	6: 72,306,859	A147P	probably benign	Het
Shank1	G	A	7: 44,312,918	S71N	unknown	Het
Slc30a6	A	G	17: 74,412,704	T220A	possibly damaging	Het
Slc5a3	T	A	16: 92,077,727	V224D	probably benign	Het
Smad5	T	A	13: 56,727,604	Y202N	probably benign	Het
Smok2b	A	G	17: 13,234,994	I14V	probably damaging	Het
Tas2r108	T	A	6: 40,494,187	I199K	probably damaging	Het
Tcea2	A	G	2: 181,680,434	I10V	probably damaging	Het
Tfg	G	A	16: 56,704,505	R113*	probably null	Het
Tubb4a	A	T	17: 57,081,034	L331I	probably benign	Het
Ugt2b37	A	G	5: 87,254,187	V195A	probably damaging	Het
Umad1	A	G	6: 8,401,096	H55R	unknown	Het
Vmn1r176	A	T	7: 23,835,318	Y137N	probably damaging	Het
Vmn1r44	T	A	6: 89,893,491	M73K	possibly damaging	Het
Vmn2r112	A	G	17: 22,602,252	T69A		Het
Vmn2r59	A	T	7: 42,046,830	Y163N	probably damaging	Het
Vps13c	T	A	9: 67,922,855	D1514E	probably benign	Het
Vsir	A	G	10: 60,357,953	D65G	possibly damaging	Het
Ypel3	A	T	7: 126,780,090	M112L	probably benign	Het
Zfp26	T	A	9: 20,436,534	K911N	probably damaging	Het
Zfp362	C	T	4: 128,777,187	R346Q	probably damaging	Het
Zfp595	A	T	13: 67,317,343	Y288*	probably null	Het
Zfyve28	G	T	5: 34,243,289	Q22K	possibly damaging	Het
Zswim4	T	G	8: 84,236,910	D32A	probably damaging	Het

Other mutations in Rnf123

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00950:Rnf123	APN	9	108067395	critical splice donor site	probably null
IGL01358:Rnf123	APN	9	108069182	missense	probably damaging	1.00
IGL01464:Rnf123	APN	9	108052302	missense	probably damaging	1.00
IGL01637:Rnf123	APN	9	108058238	missense	probably damaging	1.00
IGL01669:Rnf123	APN	9	108058356	missense	probably damaging	0.98
IGL01905:Rnf123	APN	9	108071370	splice site	probably benign
IGL02070:Rnf123	APN	9	108068302	nonsense	probably null
IGL02072:Rnf123	APN	9	108068302	nonsense	probably null
IGL02073:Rnf123	APN	9	108068302	nonsense	probably null
IGL02074:Rnf123	APN	9	108066889	missense	probably damaging	1.00
IGL02079:Rnf123	APN	9	108068302	nonsense	probably null
IGL02080:Rnf123	APN	9	108068302	nonsense	probably null
IGL02231:Rnf123	APN	9	108066399	missense	probably benign	0.17
IGL02281:Rnf123	APN	9	108071452	missense	probably benign	0.01
IGL02336:Rnf123	APN	9	108061842	missense	probably damaging	1.00
IGL02543:Rnf123	APN	9	108066348	missense	probably damaging	1.00
IGL02565:Rnf123	APN	9	108052212	critical splice donor site	probably null
IGL02571:Rnf123	APN	9	108068302	nonsense	probably null
IGL02572:Rnf123	APN	9	108068302	nonsense	probably null
IGL02574:Rnf123	APN	9	108068302	nonsense	probably null
IGL02586:Rnf123	APN	9	108068302	nonsense	probably null
IGL02589:Rnf123	APN	9	108068302	nonsense	probably null
IGL02600:Rnf123	APN	9	108068302	nonsense	probably null
IGL02601:Rnf123	APN	9	108068302	nonsense	probably null
IGL02602:Rnf123	APN	9	108068302	nonsense	probably null
IGL02603:Rnf123	APN	9	108068302	nonsense	probably null
IGL02609:Rnf123	APN	9	108068302	nonsense	probably null
IGL02628:Rnf123	APN	9	108068302	nonsense	probably null
IGL02629:Rnf123	APN	9	108068302	nonsense	probably null
IGL02629:Rnf123	APN	9	108070789	splice site	probably benign
IGL02630:Rnf123	APN	9	108068302	nonsense	probably null
IGL02631:Rnf123	APN	9	108068302	nonsense	probably null
IGL02632:Rnf123	APN	9	108068302	nonsense	probably null
IGL02650:Rnf123	APN	9	108069748	missense	probably benign	0.29
IGL02690:Rnf123	APN	9	108068302	nonsense	probably null
IGL02691:Rnf123	APN	9	108068302	nonsense	probably null
IGL02692:Rnf123	APN	9	108068302	nonsense	probably null
IGL02693:Rnf123	APN	9	108068302	nonsense	probably null
IGL02713:Rnf123	APN	9	108068302	nonsense	probably null
IGL02736:Rnf123	APN	9	108068302	nonsense	probably null
IGL02929:Rnf123	APN	9	108069076	missense	probably benign
R1175:Rnf123	UTSW	9	108077373	missense	probably benign
R1465:Rnf123	UTSW	9	108071466	splice site	probably benign
R1502:Rnf123	UTSW	9	108068510	splice site	probably null
R1682:Rnf123	UTSW	9	108077398	missense	probably benign	0.16
R1817:Rnf123	UTSW	9	108062926	missense	probably benign	0.41
R1855:Rnf123	UTSW	9	108061791	missense	probably damaging	1.00
R2394:Rnf123	UTSW	9	108063536	missense	probably benign	0.00
R2483:Rnf123	UTSW	9	108063521	missense	probably benign	0.16
R3896:Rnf123	UTSW	9	108069103	splice site	probably benign
R3940:Rnf123	UTSW	9	108064035	splice site	probably benign
R4206:Rnf123	UTSW	9	108063963	missense	probably benign	0.01
R4641:Rnf123	UTSW	9	108058587	missense	probably damaging	1.00
R4714:Rnf123	UTSW	9	108052439	splice site	probably null
R4767:Rnf123	UTSW	9	108052089	missense	probably damaging	1.00
R4849:Rnf123	UTSW	9	108056091	missense	probably damaging	1.00
R4899:Rnf123	UTSW	9	108063680	missense	probably damaging	1.00
R5274:Rnf123	UTSW	9	108064003	frame shift	probably null
R5275:Rnf123	UTSW	9	108064003	frame shift	probably null
R5276:Rnf123	UTSW	9	108064003	frame shift	probably null
R5294:Rnf123	UTSW	9	108064003	frame shift	probably null
R5295:Rnf123	UTSW	9	108064003	frame shift	probably null
R5394:Rnf123	UTSW	9	108070731	missense	probably damaging	1.00
R5717:Rnf123	UTSW	9	108067424	missense	probably damaging	1.00
R6186:Rnf123	UTSW	9	108069958	missense	possibly damaging	0.55
R6449:Rnf123	UTSW	9	108056053	missense	probably benign	0.17
R6502:Rnf123	UTSW	9	108068332	missense	possibly damaging	0.46
R6944:Rnf123	UTSW	9	108063623	missense	probably benign	0.02
R7003:Rnf123	UTSW	9	108063683	critical splice acceptor site	probably null
R7088:Rnf123	UTSW	9	108058536	missense	probably null	1.00
R7092:Rnf123	UTSW	9	108068600	missense	probably benign	0.07
R7100:Rnf123	UTSW	9	108056639	missense	probably damaging	1.00
R7257:Rnf123	UTSW	9	108069029	missense	probably damaging	1.00
R7453:Rnf123	UTSW	9	108070408	splice site	probably null
R7468:Rnf123	UTSW	9	108069009	missense	probably benign	0.00
R7517:Rnf123	UTSW	9	108070274	nonsense	probably null
R7577:Rnf123	UTSW	9	108070619	missense	probably damaging	1.00
R8296:Rnf123	UTSW	9	108062890	missense	probably damaging	1.00
R8322:Rnf123	UTSW	9	108068507	missense	probably benign	0.26
R8754:Rnf123	UTSW	9	108071164	missense	probably damaging	1.00
R8783:Rnf123	UTSW	9	108069073	missense	probably benign
R9052:Rnf123	UTSW	9	108059731	missense	probably damaging	1.00
R9156:Rnf123	UTSW	9	108063028	splice site	probably benign
R9170:Rnf123	UTSW	9	108071176	missense	probably damaging	1.00
R9332:Rnf123	UTSW	9	108067505	missense	probably benign	0.00
R9385:Rnf123	UTSW	9	108052268	missense	probably benign	0.02
R9394:Rnf123	UTSW	9	108065706	missense	probably damaging	1.00
R9717:Rnf123	UTSW	9	108077764	missense	probably benign	0.43
Z1176:Rnf123	UTSW	9	108058395	missense	probably damaging	1.00
Z1176:Rnf123	UTSW	9	108062981	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGATCGTGAATGGCCCCATC -3'
(R):5'- ACCTTTCGTAATGGGTTCTCG -3'

Sequencing Primer
(F):5'- TGAATGGCCCCATCACCTG -3'
(R):5'- GGGTTCTTGCCTGCCAAAAAC -3'

Posted On

2022-05-16