Incidental Mutation 'R4714:Rnf123'
ID 397192
Institutional Source Beutler Lab
Gene Symbol Rnf123
Ensembl Gene ENSMUSG00000041528
Gene Name ring finger protein 123
Synonyms KPC1
MMRRC Submission 041956-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.171) question?
Stock # R4714 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 107928869-107957183 bp(-) (GRCm39)
Type of Mutation splice site (6 bp from exon)
DNA Base Change (assembly) A to G at 107929638 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035214] [ENSMUST00000047746] [ENSMUST00000047746] [ENSMUST00000047746] [ENSMUST00000047746] [ENSMUST00000047947] [ENSMUST00000085060] [ENSMUST00000112295] [ENSMUST00000160249] [ENSMUST00000160249] [ENSMUST00000160249] [ENSMUST00000160249] [ENSMUST00000160649] [ENSMUST00000160649] [ENSMUST00000160649] [ENSMUST00000160649] [ENSMUST00000162355] [ENSMUST00000162355] [ENSMUST00000162753] [ENSMUST00000178267] [ENSMUST00000178267] [ENSMUST00000178267] [ENSMUST00000178267]
AlphaFold Q5XPI3
Predicted Effect probably benign
Transcript: ENSMUST00000035214
SMART Domains Protein: ENSMUSP00000035214
Gene: ENSMUSG00000032594

DomainStartEndE-ValueType
low complexity region 114 129 N/A INTRINSIC
Pfam:IPK 207 426 2.2e-67 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000047746
SMART Domains Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000047746
SMART Domains Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000047746
SMART Domains Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000047746
SMART Domains Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000047947
SMART Domains Protein: ENSMUSP00000036898
Gene: ENSMUSG00000070284

DomainStartEndE-ValueType
Pfam:NTP_transferase 2 234 8e-48 PFAM
Pfam:NTP_transf_3 3 202 6.6e-12 PFAM
Pfam:Hexapep 259 294 1.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085060
SMART Domains Protein: ENSMUSP00000082137
Gene: ENSMUSG00000032593

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 33 65 2.55e-2 SMART
LRR 65 83 6.97e1 SMART
LRR_TYP 84 107 1.56e-2 SMART
LRR 109 131 2.84e1 SMART
LRR 132 155 7.05e-1 SMART
LRR 156 176 3.98e1 SMART
LRR 182 206 5.56e0 SMART
Blast:LRRCT 219 274 8e-23 BLAST
IG 285 372 1.59e-6 SMART
transmembrane domain 383 405 N/A INTRINSIC
low complexity region 407 422 N/A INTRINSIC
low complexity region 492 504 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112295
SMART Domains Protein: ENSMUSP00000107914
Gene: ENSMUSG00000070284

DomainStartEndE-ValueType
Pfam:NTP_transferase 2 235 2.1e-51 PFAM
Pfam:NTP_transf_3 3 199 1.1e-11 PFAM
Pfam:Hexapep 259 294 9.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137284
Predicted Effect probably benign
Transcript: ENSMUST00000159306
SMART Domains Protein: ENSMUSP00000125695
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
coiled coil region 172 192 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159306
SMART Domains Protein: ENSMUSP00000125695
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
coiled coil region 172 192 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000160249
SMART Domains Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000160249
SMART Domains Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000160249
SMART Domains Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000160249
SMART Domains Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000160649
SMART Domains Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000160649
SMART Domains Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000160649
SMART Domains Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000160649
SMART Domains Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000162355
SMART Domains Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000162355
SMART Domains Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161673
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159526
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150700
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159136
Predicted Effect probably benign
Transcript: ENSMUST00000162753
Predicted Effect probably null
Transcript: ENSMUST00000178267
SMART Domains Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000178267
SMART Domains Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000178267
SMART Domains Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000178267
SMART Domains Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173683
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a C-terminal RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions, and an N-terminal SPRY domain. This protein displays E3 ubiquitin ligase activity toward the cyclin-dependent kinase inhibitor 1B which is also known as p27 or KIP1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,211,320 (GRCm39) E685* probably null Het
2700049A03Rik A T 12: 71,211,321 (GRCm39) E685V possibly damaging Het
4930486L24Rik A G 13: 60,992,132 (GRCm39) V298A probably damaging Het
Abca12 A G 1: 71,360,609 (GRCm39) V534A probably benign Het
Abcb4 A G 5: 8,980,906 (GRCm39) probably null Het
Adam30 A T 3: 98,070,170 (GRCm39) S668C probably damaging Het
Ap1g1 T A 8: 110,556,252 (GRCm39) V196D probably damaging Het
Atp11b G A 3: 35,888,543 (GRCm39) V738I probably benign Het
Cast C T 13: 74,946,834 (GRCm39) V27I probably damaging Het
Cfap54 A G 10: 92,651,780 (GRCm39) I3090T probably benign Het
Cgn C A 3: 94,686,748 (GRCm39) G185W probably damaging Het
Champ1 T C 8: 13,928,063 (GRCm39) Y74H probably damaging Het
Cpm T C 10: 117,511,890 (GRCm39) I278T probably damaging Het
Dcaf15 T C 8: 84,828,845 (GRCm39) T141A probably benign Het
Dcun1d1 C T 3: 35,949,819 (GRCm39) V244M probably damaging Het
Defb8 A G 8: 19,497,575 (GRCm39) L12P probably damaging Het
Dlg1 A T 16: 31,609,079 (GRCm39) I225F probably damaging Het
Dync2h1 G T 9: 7,118,932 (GRCm39) H2178N possibly damaging Het
Enam A G 5: 88,651,395 (GRCm39) E893G probably damaging Het
Flt4 T A 11: 49,518,034 (GRCm39) L358Q probably damaging Het
Frmpd1 A G 4: 45,284,785 (GRCm39) Q1202R probably benign Het
Ghr T A 15: 3,349,879 (GRCm39) D433V possibly damaging Het
Grm7 G A 6: 111,057,383 (GRCm39) D328N possibly damaging Het
Haus4 T C 14: 54,779,577 (GRCm39) D349G probably benign Het
Helz T C 11: 107,517,542 (GRCm39) probably null Het
Hif3a A G 7: 16,790,196 (GRCm39) L69P probably damaging Het
Ifit1 A G 19: 34,625,563 (GRCm39) E233G probably damaging Het
Kcnc2 T C 10: 112,291,733 (GRCm39) F307S possibly damaging Het
Lrp1b A T 2: 41,000,771 (GRCm39) V2151E possibly damaging Het
Lrp5 T C 19: 3,709,454 (GRCm39) N92S probably damaging Het
Metrnl C T 11: 121,606,839 (GRCm39) A216V probably damaging Het
Msh2 A G 17: 88,026,217 (GRCm39) T732A probably damaging Het
Necab2 T C 8: 120,194,334 (GRCm39) L270P probably damaging Het
Noc3l T C 19: 38,804,157 (GRCm39) K74E probably benign Het
Oas2 A T 5: 120,871,537 (GRCm39) L702Q probably damaging Het
Or1j1 A T 2: 36,703,047 (GRCm39) I19N probably benign Het
Or2n1d A C 17: 38,646,731 (GRCm39) I228L possibly damaging Het
Or4k1 A G 14: 50,377,436 (GRCm39) I220T possibly damaging Het
Or4k6 C A 14: 50,475,824 (GRCm39) V173L possibly damaging Het
Or6c216 A T 10: 129,678,814 (GRCm39) N32K probably damaging Het
Pax6 A G 2: 105,525,745 (GRCm39) H376R possibly damaging Het
Pnkd C T 1: 74,390,941 (GRCm39) R376C probably damaging Het
Pnpla8 T C 12: 44,342,696 (GRCm39) F484S probably damaging Het
Psme4 T A 11: 30,782,573 (GRCm39) H909Q probably benign Het
Rasip1 CGG CGGG 7: 45,281,820 (GRCm39) probably null Het
Rbm47 A T 5: 66,182,395 (GRCm39) Y413N probably damaging Het
Ruvbl1 T A 6: 88,461,412 (GRCm39) M259K possibly damaging Het
Sohlh2 A G 3: 55,097,950 (GRCm39) H134R probably benign Het
Sorbs2 A G 8: 46,248,330 (GRCm39) D447G possibly damaging Het
Tank C T 2: 61,480,573 (GRCm39) P370S probably benign Het
Tenm4 A G 7: 96,544,131 (GRCm39) E2049G probably damaging Het
Tnik A G 3: 28,648,226 (GRCm39) H426R possibly damaging Het
Trpm6 C A 19: 18,831,564 (GRCm39) S1476R possibly damaging Het
Trpm7 G A 2: 126,682,703 (GRCm39) Q389* probably null Het
Ttc28 G A 5: 111,433,095 (GRCm39) R2043Q possibly damaging Het
Tymp A G 15: 89,260,510 (GRCm39) S103P probably damaging Het
Usp40 C T 1: 87,894,901 (GRCm39) probably null Het
Vmn1r202 T A 13: 22,685,977 (GRCm39) N147Y probably damaging Het
Vmn2r89 T C 14: 51,689,688 (GRCm39) S64P probably damaging Het
Vps13a A T 19: 16,727,220 (GRCm39) D229E probably benign Het
Vps52 A G 17: 34,180,153 (GRCm39) I354V probably benign Het
Zbtb8os T C 4: 129,235,557 (GRCm39) F90L probably damaging Het
Zfp36l1 T C 12: 80,157,270 (GRCm39) D37G possibly damaging Het
Zfp467 A G 6: 48,404,751 (GRCm39) S109P unknown Het
Zzef1 T A 11: 72,728,038 (GRCm39) C535S probably damaging Het
Other mutations in Rnf123
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Rnf123 APN 9 107,944,594 (GRCm39) critical splice donor site probably null
IGL01358:Rnf123 APN 9 107,946,381 (GRCm39) missense probably damaging 1.00
IGL01464:Rnf123 APN 9 107,929,501 (GRCm39) missense probably damaging 1.00
IGL01637:Rnf123 APN 9 107,935,437 (GRCm39) missense probably damaging 1.00
IGL01669:Rnf123 APN 9 107,935,555 (GRCm39) missense probably damaging 0.98
IGL01905:Rnf123 APN 9 107,948,569 (GRCm39) splice site probably benign
IGL02070:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02072:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02073:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02074:Rnf123 APN 9 107,944,088 (GRCm39) missense probably damaging 1.00
IGL02079:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02080:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02231:Rnf123 APN 9 107,943,598 (GRCm39) missense probably benign 0.17
IGL02281:Rnf123 APN 9 107,948,651 (GRCm39) missense probably benign 0.01
IGL02336:Rnf123 APN 9 107,939,041 (GRCm39) missense probably damaging 1.00
IGL02543:Rnf123 APN 9 107,943,547 (GRCm39) missense probably damaging 1.00
IGL02565:Rnf123 APN 9 107,929,411 (GRCm39) critical splice donor site probably null
IGL02571:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02572:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02574:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02586:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02589:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02600:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02601:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02602:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02603:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02609:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02628:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02629:Rnf123 APN 9 107,947,988 (GRCm39) splice site probably benign
IGL02629:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02630:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02631:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02632:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02650:Rnf123 APN 9 107,946,947 (GRCm39) missense probably benign 0.29
IGL02690:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02691:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02692:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02693:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02713:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02736:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02929:Rnf123 APN 9 107,946,275 (GRCm39) missense probably benign
R1175:Rnf123 UTSW 9 107,954,572 (GRCm39) missense probably benign
R1465:Rnf123 UTSW 9 107,948,665 (GRCm39) splice site probably benign
R1502:Rnf123 UTSW 9 107,945,709 (GRCm39) splice site probably null
R1682:Rnf123 UTSW 9 107,954,597 (GRCm39) missense probably benign 0.16
R1817:Rnf123 UTSW 9 107,940,125 (GRCm39) missense probably benign 0.41
R1855:Rnf123 UTSW 9 107,938,990 (GRCm39) missense probably damaging 1.00
R2394:Rnf123 UTSW 9 107,940,735 (GRCm39) missense probably benign 0.00
R2483:Rnf123 UTSW 9 107,940,720 (GRCm39) missense probably benign 0.16
R3896:Rnf123 UTSW 9 107,946,302 (GRCm39) splice site probably benign
R3940:Rnf123 UTSW 9 107,941,234 (GRCm39) splice site probably benign
R4206:Rnf123 UTSW 9 107,941,162 (GRCm39) missense probably benign 0.01
R4641:Rnf123 UTSW 9 107,935,786 (GRCm39) missense probably damaging 1.00
R4767:Rnf123 UTSW 9 107,929,288 (GRCm39) missense probably damaging 1.00
R4849:Rnf123 UTSW 9 107,933,290 (GRCm39) missense probably damaging 1.00
R4899:Rnf123 UTSW 9 107,940,879 (GRCm39) missense probably damaging 1.00
R5274:Rnf123 UTSW 9 107,941,202 (GRCm39) frame shift probably null
R5275:Rnf123 UTSW 9 107,941,202 (GRCm39) frame shift probably null
R5276:Rnf123 UTSW 9 107,941,202 (GRCm39) frame shift probably null
R5294:Rnf123 UTSW 9 107,941,202 (GRCm39) frame shift probably null
R5295:Rnf123 UTSW 9 107,941,202 (GRCm39) frame shift probably null
R5394:Rnf123 UTSW 9 107,947,930 (GRCm39) missense probably damaging 1.00
R5717:Rnf123 UTSW 9 107,944,623 (GRCm39) missense probably damaging 1.00
R6186:Rnf123 UTSW 9 107,947,157 (GRCm39) missense possibly damaging 0.55
R6449:Rnf123 UTSW 9 107,933,252 (GRCm39) missense probably benign 0.17
R6502:Rnf123 UTSW 9 107,945,531 (GRCm39) missense possibly damaging 0.46
R6944:Rnf123 UTSW 9 107,940,822 (GRCm39) missense probably benign 0.02
R7003:Rnf123 UTSW 9 107,940,882 (GRCm39) critical splice acceptor site probably null
R7088:Rnf123 UTSW 9 107,935,735 (GRCm39) missense probably null 1.00
R7092:Rnf123 UTSW 9 107,945,799 (GRCm39) missense probably benign 0.07
R7100:Rnf123 UTSW 9 107,933,838 (GRCm39) missense probably damaging 1.00
R7257:Rnf123 UTSW 9 107,946,228 (GRCm39) missense probably damaging 1.00
R7453:Rnf123 UTSW 9 107,947,607 (GRCm39) splice site probably null
R7468:Rnf123 UTSW 9 107,946,208 (GRCm39) missense probably benign 0.00
R7517:Rnf123 UTSW 9 107,947,473 (GRCm39) nonsense probably null
R7577:Rnf123 UTSW 9 107,947,818 (GRCm39) missense probably damaging 1.00
R8296:Rnf123 UTSW 9 107,940,089 (GRCm39) missense probably damaging 1.00
R8322:Rnf123 UTSW 9 107,945,706 (GRCm39) missense probably benign 0.26
R8754:Rnf123 UTSW 9 107,948,363 (GRCm39) missense probably damaging 1.00
R8783:Rnf123 UTSW 9 107,946,272 (GRCm39) missense probably benign
R9052:Rnf123 UTSW 9 107,936,930 (GRCm39) missense probably damaging 1.00
R9156:Rnf123 UTSW 9 107,940,227 (GRCm39) splice site probably benign
R9170:Rnf123 UTSW 9 107,948,375 (GRCm39) missense probably damaging 1.00
R9332:Rnf123 UTSW 9 107,944,704 (GRCm39) missense probably benign 0.00
R9385:Rnf123 UTSW 9 107,929,467 (GRCm39) missense probably benign 0.02
R9394:Rnf123 UTSW 9 107,942,905 (GRCm39) missense probably damaging 1.00
R9432:Rnf123 UTSW 9 107,937,008 (GRCm39) missense probably damaging 0.96
R9717:Rnf123 UTSW 9 107,954,963 (GRCm39) missense probably benign 0.43
Z1176:Rnf123 UTSW 9 107,940,180 (GRCm39) missense probably damaging 1.00
Z1176:Rnf123 UTSW 9 107,935,594 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGCCAGCATCTGTTCCAC -3'
(R):5'- CCCACGTGGAGAAAATGTTCAC -3'

Sequencing Primer
(F):5'- AGCATCTGTTCCACCTGGG -3'
(R):5'- TGGAGAAAATGTTCACACAGGCTC -3'
Posted On 2016-06-28