Mutagenetix > Incidental Mutation

Incidental Mutation 'R4714:Rnf123'

397192

Institutional Source

Beutler Lab

Gene Symbol

Rnf123

Ensembl Gene

ENSMUSG00000041528

Gene Name

ring finger protein 123

Synonyms

KPC1

MMRRC Submission

041956-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.332) question?

Stock #

R4714 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

108051534-108083346 bp(-) (GRCm38)

Type of Mutation

splice site (6 bp from exon)

DNA Base Change (assembly)

A to G at 108052439 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000136953 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035214] [ENSMUST00000047746] [ENSMUST00000047746] [ENSMUST00000047746] [ENSMUST00000047746] [ENSMUST00000047947] [ENSMUST00000085060] [ENSMUST00000112295] [ENSMUST00000160249] [ENSMUST00000160249] [ENSMUST00000160249] [ENSMUST00000160249] [ENSMUST00000160649] [ENSMUST00000160649] [ENSMUST00000160649] [ENSMUST00000160649] [ENSMUST00000162355] [ENSMUST00000162355] [ENSMUST00000178267] [ENSMUST00000178267] [ENSMUST00000178267] [ENSMUST00000178267] [ENSMUST00000162753]

AlphaFold

Q5XPI3

Predicted Effect

probably benign
Transcript: ENSMUST00000035214

SMART Domains

Protein: ENSMUSP00000035214
Gene: ENSMUSG00000032594

Domain	Start	End	E-Value	Type
low complexity region	114	129	N/A	INTRINSIC
Pfam:IPK	207	426	2.2e-67	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000047746

SMART Domains

Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1047	1067	N/A	INTRINSIC
low complexity region	1242	1251	N/A	INTRINSIC
RING	1260	1297	5.27e-4	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000047746

SMART Domains

Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1047	1067	N/A	INTRINSIC
low complexity region	1242	1251	N/A	INTRINSIC
RING	1260	1297	5.27e-4	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000047746

SMART Domains

Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1047	1067	N/A	INTRINSIC
low complexity region	1242	1251	N/A	INTRINSIC
RING	1260	1297	5.27e-4	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000047746

SMART Domains

Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1047	1067	N/A	INTRINSIC
low complexity region	1242	1251	N/A	INTRINSIC
RING	1260	1297	5.27e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000047947

SMART Domains

Protein: ENSMUSP00000036898
Gene: ENSMUSG00000070284

Domain	Start	End	E-Value	Type
Pfam:NTP_transferase	2	234	8e-48	PFAM
Pfam:NTP_transf_3	3	202	6.6e-12	PFAM
Pfam:Hexapep	259	294	1.8e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000085060

SMART Domains

Protein: ENSMUSP00000082137
Gene: ENSMUSG00000032593

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
LRRNT	33	65	2.55e-2	SMART
LRR	65	83	6.97e1	SMART
LRR_TYP	84	107	1.56e-2	SMART
LRR	109	131	2.84e1	SMART
LRR	132	155	7.05e-1	SMART
LRR	156	176	3.98e1	SMART
LRR	182	206	5.56e0	SMART
Blast:LRRCT	219	274	8e-23	BLAST
IG	285	372	1.59e-6	SMART
transmembrane domain	383	405	N/A	INTRINSIC
low complexity region	407	422	N/A	INTRINSIC
low complexity region	492	504	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112295

SMART Domains

Protein: ENSMUSP00000107914
Gene: ENSMUSG00000070284

Domain	Start	End	E-Value	Type
Pfam:NTP_transferase	2	235	2.1e-51	PFAM
Pfam:NTP_transf_3	3	199	1.1e-11	PFAM
Pfam:Hexapep	259	294	9.4e-11	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137284

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145330

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150700

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159136

Predicted Effect

probably benign
Transcript: ENSMUST00000159306

SMART Domains

Protein: ENSMUSP00000125695
Gene: ENSMUSG00000041528

Domain	Start	End	E-Value	Type
coiled coil region	172	192	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000159306

SMART Domains

Protein: ENSMUSP00000125695
Gene: ENSMUSG00000041528

Domain	Start	End	E-Value	Type
coiled coil region	172	192	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159523

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159526

Predicted Effect

probably null
Transcript: ENSMUST00000160249

SMART Domains

Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC
low complexity region	1236	1245	N/A	INTRINSIC
RING	1254	1291	5.27e-4	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000160249

SMART Domains

Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC
low complexity region	1236	1245	N/A	INTRINSIC
RING	1254	1291	5.27e-4	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000160249

SMART Domains

Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC
low complexity region	1236	1245	N/A	INTRINSIC
RING	1254	1291	5.27e-4	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000160249

SMART Domains

Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC
low complexity region	1236	1245	N/A	INTRINSIC
RING	1254	1291	5.27e-4	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000160649

SMART Domains

Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000160649

SMART Domains

Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000160649

SMART Domains

Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000160649

SMART Domains

Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000162355

SMART Domains

Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1047	1067	N/A	INTRINSIC
low complexity region	1242	1251	N/A	INTRINSIC
RING	1260	1297	5.27e-4	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000162355

SMART Domains

Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1047	1067	N/A	INTRINSIC
low complexity region	1242	1251	N/A	INTRINSIC
RING	1260	1297	5.27e-4	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000178267

SMART Domains

Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC
low complexity region	1236	1245	N/A	INTRINSIC
RING	1254	1291	5.27e-4	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000178267

SMART Domains

Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC
low complexity region	1236	1245	N/A	INTRINSIC
RING	1254	1291	5.27e-4	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000178267

SMART Domains

Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC
low complexity region	1236	1245	N/A	INTRINSIC
RING	1254	1291	5.27e-4	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000178267

SMART Domains

Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC
low complexity region	1236	1245	N/A	INTRINSIC
RING	1254	1291	5.27e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161673

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173683

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162123

Predicted Effect

probably benign
Transcript: ENSMUST00000162753

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a C-terminal RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions, and an N-terminal SPRY domain. This protein displays E3 ubiquitin ligase activity toward the cyclin-dependent kinase inhibitor 1B which is also known as p27 or KIP1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
4930486L24Rik	A	G	13: 60,844,318	V298A	probably damaging	Het
Abca12	A	G	1: 71,321,450	V534A	probably benign	Het
Abcb4	A	G	5: 8,930,906		probably null	Het
Adam30	A	T	3: 98,162,854	S668C	probably damaging	Het
Ap1g1	T	A	8: 109,829,620	V196D	probably damaging	Het
Atp11b	G	A	3: 35,834,394	V738I	probably benign	Het
Cast	C	T	13: 74,798,715	V27I	probably damaging	Het
Cfap54	A	G	10: 92,815,918	I3090T	probably benign	Het
Cgn	C	A	3: 94,779,438	G185W	probably damaging	Het
Champ1	T	C	8: 13,878,063	Y74H	probably damaging	Het
Cpm	T	C	10: 117,675,985	I278T	probably damaging	Het
Dcaf15	T	C	8: 84,102,216	T141A	probably benign	Het
Dcun1d1	C	T	3: 35,895,670	V244M	probably damaging	Het
Defb8	A	G	8: 19,447,559	L12P	probably damaging	Het
Dlg1	A	T	16: 31,790,261	I225F	probably damaging	Het
Dync2h1	G	T	9: 7,118,932	H2178N	possibly damaging	Het
Enam	A	G	5: 88,503,536	E893G	probably damaging	Het
Flt4	T	A	11: 49,627,207	L358Q	probably damaging	Het
Frmpd1	A	G	4: 45,284,785	Q1202R	probably benign	Het
Ghr	T	A	15: 3,320,397	D433V	possibly damaging	Het
Grm7	G	A	6: 111,080,422	D328N	possibly damaging	Het
Haus4	T	C	14: 54,542,120	D349G	probably benign	Het
Helz	T	C	11: 107,626,716		probably null	Het
Hif3a	A	G	7: 17,056,271	L69P	probably damaging	Het
Ifit1	A	G	19: 34,648,163	E233G	probably damaging	Het
Kcnc2	T	C	10: 112,455,828	F307S	possibly damaging	Het
Lrp1b	A	T	2: 41,110,759	V2151E	possibly damaging	Het
Lrp5	T	C	19: 3,659,454	N92S	probably damaging	Het
Metrnl	C	T	11: 121,716,013	A216V	probably damaging	Het
Msh2	A	G	17: 87,718,789	T732A	probably damaging	Het
Necab2	T	C	8: 119,467,595	L270P	probably damaging	Het
Noc3l	T	C	19: 38,815,713	K74E	probably benign	Het
Oas2	A	T	5: 120,733,472	L702Q	probably damaging	Het
Olfr136	A	C	17: 38,335,840	I228L	possibly damaging	Het
Olfr3	A	T	2: 36,813,035	I19N	probably benign	Het
Olfr728	A	G	14: 50,139,979	I220T	possibly damaging	Het
Olfr731	C	A	14: 50,238,367	V173L	possibly damaging	Het
Olfr812	A	T	10: 129,842,945	N32K	probably damaging	Het
Pax6	A	G	2: 105,695,400	H376R	possibly damaging	Het
Pnkd	C	T	1: 74,351,782	R376C	probably damaging	Het
Pnpla8	T	C	12: 44,295,913	F484S	probably damaging	Het
Psme4	T	A	11: 30,832,573	H909Q	probably benign	Het
Rasip1	CGG	CGGG	7: 45,632,396		probably null	Het
Rbm47	A	T	5: 66,025,052	Y413N	probably damaging	Het
Ruvbl1	T	A	6: 88,484,430	M259K	possibly damaging	Het
Sohlh2	A	G	3: 55,190,529	H134R	probably benign	Het
Sorbs2	A	G	8: 45,795,293	D447G	possibly damaging	Het
Tank	C	T	2: 61,650,229	P370S	probably benign	Het
Tenm4	A	G	7: 96,894,924	E2049G	probably damaging	Het
Tnik	A	G	3: 28,594,077	H426R	possibly damaging	Het
Trpm6	C	A	19: 18,854,200	S1476R	possibly damaging	Het
Trpm7	G	A	2: 126,840,783	Q389*	probably null	Het
Ttc28	G	A	5: 111,285,229	R2043Q	possibly damaging	Het
Tymp	A	G	15: 89,376,307	S103P	probably damaging	Het
Usp40	C	T	1: 87,967,179		probably null	Het
Vmn1r202	T	A	13: 22,501,807	N147Y	probably damaging	Het
Vmn2r89	T	C	14: 51,452,231	S64P	probably damaging	Het
Vps13a	A	T	19: 16,749,856	D229E	probably benign	Het
Vps52	A	G	17: 33,961,179	I354V	probably benign	Het
Zbtb8os	T	C	4: 129,341,764	F90L	probably damaging	Het
Zfp36l1	T	C	12: 80,110,496	D37G	possibly damaging	Het
Zfp467	A	G	6: 48,427,817	S109P	unknown	Het
Zzef1	T	A	11: 72,837,212	C535S	probably damaging	Het

Other mutations in Rnf123

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00950:Rnf123	APN	9	108067395	critical splice donor site	probably null
IGL01358:Rnf123	APN	9	108069182	missense	probably damaging	1.00
IGL01464:Rnf123	APN	9	108052302	missense	probably damaging	1.00
IGL01637:Rnf123	APN	9	108058238	missense	probably damaging	1.00
IGL01669:Rnf123	APN	9	108058356	missense	probably damaging	0.98
IGL01905:Rnf123	APN	9	108071370	splice site	probably benign
IGL02070:Rnf123	APN	9	108068302	nonsense	probably null
IGL02072:Rnf123	APN	9	108068302	nonsense	probably null
IGL02073:Rnf123	APN	9	108068302	nonsense	probably null
IGL02074:Rnf123	APN	9	108066889	missense	probably damaging	1.00
IGL02079:Rnf123	APN	9	108068302	nonsense	probably null
IGL02080:Rnf123	APN	9	108068302	nonsense	probably null
IGL02231:Rnf123	APN	9	108066399	missense	probably benign	0.17
IGL02281:Rnf123	APN	9	108071452	missense	probably benign	0.01
IGL02336:Rnf123	APN	9	108061842	missense	probably damaging	1.00
IGL02543:Rnf123	APN	9	108066348	missense	probably damaging	1.00
IGL02565:Rnf123	APN	9	108052212	critical splice donor site	probably null
IGL02571:Rnf123	APN	9	108068302	nonsense	probably null
IGL02572:Rnf123	APN	9	108068302	nonsense	probably null
IGL02574:Rnf123	APN	9	108068302	nonsense	probably null
IGL02586:Rnf123	APN	9	108068302	nonsense	probably null
IGL02589:Rnf123	APN	9	108068302	nonsense	probably null
IGL02600:Rnf123	APN	9	108068302	nonsense	probably null
IGL02601:Rnf123	APN	9	108068302	nonsense	probably null
IGL02602:Rnf123	APN	9	108068302	nonsense	probably null
IGL02603:Rnf123	APN	9	108068302	nonsense	probably null
IGL02609:Rnf123	APN	9	108068302	nonsense	probably null
IGL02628:Rnf123	APN	9	108068302	nonsense	probably null
IGL02629:Rnf123	APN	9	108068302	nonsense	probably null
IGL02629:Rnf123	APN	9	108070789	splice site	probably benign
IGL02630:Rnf123	APN	9	108068302	nonsense	probably null
IGL02631:Rnf123	APN	9	108068302	nonsense	probably null
IGL02632:Rnf123	APN	9	108068302	nonsense	probably null
IGL02650:Rnf123	APN	9	108069748	missense	probably benign	0.29
IGL02690:Rnf123	APN	9	108068302	nonsense	probably null
IGL02691:Rnf123	APN	9	108068302	nonsense	probably null
IGL02692:Rnf123	APN	9	108068302	nonsense	probably null
IGL02693:Rnf123	APN	9	108068302	nonsense	probably null
IGL02713:Rnf123	APN	9	108068302	nonsense	probably null
IGL02736:Rnf123	APN	9	108068302	nonsense	probably null
IGL02929:Rnf123	APN	9	108069076	missense	probably benign
R1175:Rnf123	UTSW	9	108077373	missense	probably benign
R1465:Rnf123	UTSW	9	108071466	splice site	probably benign
R1502:Rnf123	UTSW	9	108068510	splice site	probably null
R1682:Rnf123	UTSW	9	108077398	missense	probably benign	0.16
R1817:Rnf123	UTSW	9	108062926	missense	probably benign	0.41
R1855:Rnf123	UTSW	9	108061791	missense	probably damaging	1.00
R2394:Rnf123	UTSW	9	108063536	missense	probably benign	0.00
R2483:Rnf123	UTSW	9	108063521	missense	probably benign	0.16
R3896:Rnf123	UTSW	9	108069103	splice site	probably benign
R3940:Rnf123	UTSW	9	108064035	splice site	probably benign
R4206:Rnf123	UTSW	9	108063963	missense	probably benign	0.01
R4641:Rnf123	UTSW	9	108058587	missense	probably damaging	1.00
R4767:Rnf123	UTSW	9	108052089	missense	probably damaging	1.00
R4849:Rnf123	UTSW	9	108056091	missense	probably damaging	1.00
R4899:Rnf123	UTSW	9	108063680	missense	probably damaging	1.00
R5274:Rnf123	UTSW	9	108064003	frame shift	probably null
R5275:Rnf123	UTSW	9	108064003	frame shift	probably null
R5276:Rnf123	UTSW	9	108064003	frame shift	probably null
R5294:Rnf123	UTSW	9	108064003	frame shift	probably null
R5295:Rnf123	UTSW	9	108064003	frame shift	probably null
R5394:Rnf123	UTSW	9	108070731	missense	probably damaging	1.00
R5717:Rnf123	UTSW	9	108067424	missense	probably damaging	1.00
R6186:Rnf123	UTSW	9	108069958	missense	possibly damaging	0.55
R6449:Rnf123	UTSW	9	108056053	missense	probably benign	0.17
R6502:Rnf123	UTSW	9	108068332	missense	possibly damaging	0.46
R6944:Rnf123	UTSW	9	108063623	missense	probably benign	0.02
R7003:Rnf123	UTSW	9	108063683	critical splice acceptor site	probably null
R7088:Rnf123	UTSW	9	108058536	missense	probably null	1.00
R7092:Rnf123	UTSW	9	108068600	missense	probably benign	0.07
R7100:Rnf123	UTSW	9	108056639	missense	probably damaging	1.00
R7257:Rnf123	UTSW	9	108069029	missense	probably damaging	1.00
R7453:Rnf123	UTSW	9	108070408	splice site	probably null
R7468:Rnf123	UTSW	9	108069009	missense	probably benign	0.00
R7517:Rnf123	UTSW	9	108070274	nonsense	probably null
R7577:Rnf123	UTSW	9	108070619	missense	probably damaging	1.00
R8296:Rnf123	UTSW	9	108062890	missense	probably damaging	1.00
R8322:Rnf123	UTSW	9	108068507	missense	probably benign	0.26
R8754:Rnf123	UTSW	9	108071164	missense	probably damaging	1.00
R8783:Rnf123	UTSW	9	108069073	missense	probably benign
R9052:Rnf123	UTSW	9	108059731	missense	probably damaging	1.00
R9156:Rnf123	UTSW	9	108063028	splice site	probably benign
R9170:Rnf123	UTSW	9	108071176	missense	probably damaging	1.00
R9332:Rnf123	UTSW	9	108067505	missense	probably benign	0.00
R9385:Rnf123	UTSW	9	108052268	missense	probably benign	0.02
R9394:Rnf123	UTSW	9	108065706	missense	probably damaging	1.00
R9432:Rnf123	UTSW	9	108059809	missense	probably damaging	0.96
R9717:Rnf123	UTSW	9	108077764	missense	probably benign	0.43
Z1176:Rnf123	UTSW	9	108058395	missense	probably damaging	1.00
Z1176:Rnf123	UTSW	9	108062981	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAGCCAGCATCTGTTCCAC -3'
(R):5'- CCCACGTGGAGAAAATGTTCAC -3'

Sequencing Primer
(F):5'- AGCATCTGTTCCACCTGGG -3'
(R):5'- TGGAGAAAATGTTCACACAGGCTC -3'

Posted On

2016-06-28