Incidental Mutation 'R9717:Rnf123'
ID 730544
Institutional Source Beutler Lab
Gene Symbol Rnf123
Ensembl Gene ENSMUSG00000041528
Gene Name ring finger protein 123
Synonyms KPC1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock # R9717 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 108051534-108083346 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 108077764 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 14 (S14G)
Ref Sequence ENSEMBL: ENSMUSP00000125745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035211] [ENSMUST00000047746] [ENSMUST00000159372] [ENSMUST00000160249] [ENSMUST00000160649] [ENSMUST00000161828] [ENSMUST00000162355] [ENSMUST00000162516] [ENSMUST00000162886] [ENSMUST00000174504] [ENSMUST00000178267]
AlphaFold Q5XPI3
Predicted Effect probably benign
Transcript: ENSMUST00000035211
SMART Domains Protein: ENSMUSP00000035211
Gene: ENSMUSG00000032591

DomainStartEndE-ValueType
PAN_AP 21 104 2.65e-9 SMART
KR 108 188 3.13e-39 SMART
KR 189 270 8.57e-46 SMART
KR 290 372 7.94e-41 SMART
KR 377 459 6.59e-47 SMART
Tryp_SPc 488 709 2.27e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000047746
AA Change: S14G

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528
AA Change: S14G

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159372
AA Change: S14G

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000160184
Predicted Effect probably benign
Transcript: ENSMUST00000160249
AA Change: S14G

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528
AA Change: S14G

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160649
AA Change: S14G

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528
AA Change: S14G

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161828
AA Change: S14G

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000162355
AA Change: S14G

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528
AA Change: S14G

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162516
AA Change: S14G

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000162886
SMART Domains Protein: ENSMUSP00000125175
Gene: ENSMUSG00000032591

DomainStartEndE-ValueType
PAN_AP 21 104 2.65e-9 SMART
KR 108 188 3.13e-39 SMART
KR 189 270 1.07e-46 SMART
KR 281 363 7.94e-41 SMART
KR 368 450 6.59e-47 SMART
Tryp_SPc 479 700 2.27e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174504
AA Change: S14G

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000178267
AA Change: S14G

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528
AA Change: S14G

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a C-terminal RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions, and an N-terminal SPRY domain. This protein displays E3 ubiquitin ligase activity toward the cyclin-dependent kinase inhibitor 1B which is also known as p27 or KIP1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T A 13: 81,520,781 N2552I probably damaging Het
Amph G T 13: 19,125,083 A444S probably benign Het
Ankrd52 A G 10: 128,380,588 N157S probably benign Het
Arhgap29 T C 3: 122,004,271 F537L probably benign Het
Asic1 A C 15: 99,692,776 T136P probably damaging Het
Atg2b T C 12: 105,639,302 Y1468C probably benign Het
Atm A G 9: 53,516,517 L431P probably damaging Het
Btaf1 A G 19: 36,945,246 T17A probably benign Het
Car10 A G 11: 93,304,541 N58S probably benign Het
Cd79b A T 11: 106,312,019 D252E probably damaging Het
Cdipt C T 7: 126,977,030 probably benign Het
Cebpe T C 14: 54,711,708 D84G probably damaging Het
Cenpj T C 14: 56,552,996 E532G probably benign Het
Cherp A G 8: 72,463,076 probably null Het
Chuk T C 19: 44,082,670 D532G possibly damaging Het
Clec1b C T 6: 129,397,640 T9I probably benign Het
Clspn G T 4: 126,564,963 A280S possibly damaging Het
Cts3 T G 13: 61,564,985 Y307S probably benign Het
Cyp2c39 T C 19: 39,568,049 M443T possibly damaging Het
Dhx57 C T 17: 80,275,018 R386H probably damaging Het
Dhx58 A T 11: 100,701,307 M305K probably benign Het
Dlgap3 T C 4: 127,235,494 L894P probably damaging Het
Dnah3 A T 7: 119,975,076 N2164K probably damaging Het
Dnajb14 A G 3: 137,902,283 N183S probably benign Het
Drd5 G T 5: 38,320,747 R361L probably damaging Het
Duoxa1 T C 2: 122,305,141 E159G probably damaging Het
Exoc1 T A 5: 76,563,232 S659R probably benign Het
Fam214b T C 4: 43,036,050 H227R probably damaging Het
Fbln7 T C 2: 128,877,394 I37T probably benign Het
Fcgrt T G 7: 45,095,429 E205A possibly damaging Het
Fcho2 A T 13: 98,763,694 S304T probably damaging Het
Gbp9 C A 5: 105,105,721 G43* probably null Het
Gm21671 T C 5: 25,949,831 E257G probably damaging Het
Gucy2d A G 7: 98,474,661 K151R probably benign Het
Heatr4 T A 12: 83,978,055 I331F probably damaging Het
Hmcn1 G A 1: 150,609,627 T4408I probably damaging Het
Hoxc9 C T 15: 102,982,119 T156M probably benign Het
Hrnr A T 3: 93,320,680 E35V probably damaging Het
Idua C T 5: 108,670,171 Q70* probably null Het
Klf5 A T 14: 99,301,753 I201F probably damaging Het
Lonrf1 T C 8: 36,234,010 K349E probably damaging Het
Lrp1b A T 2: 41,268,383 D1721E Het
Mdh1 T A 11: 21,571,870 probably benign Het
Mllt11 T C 3: 95,220,210 H83R probably benign Het
Mrgprb4 A C 7: 48,198,835 I115S possibly damaging Het
Mrpl38 A G 11: 116,132,470 F319S probably damaging Het
Naif1 A T 2: 32,454,895 M204L probably benign Het
Ncan T A 8: 70,101,978 D1063V probably damaging Het
Noto A T 6: 85,424,345 R119W possibly damaging Het
Olfr1220 G A 2: 89,097,229 L233F probably benign Het
Olfr147 A T 9: 38,403,545 I224F probably damaging Het
Olfr573-ps1 A T 7: 102,941,958 D206E probably damaging Het
Olfr816 T A 10: 129,912,179 Y33F probably damaging Het
Ovch2 A G 7: 107,794,377 W181R probably damaging Het
Palm G C 10: 79,819,283 G292R probably damaging Het
Pdgfrb T A 18: 61,072,715 L591* probably null Het
Pik3c2g T C 6: 139,896,184 S772P Het
Prx C A 7: 27,517,986 D776E probably benign Het
Ptpra A G 2: 130,542,446 E562G possibly damaging Het
Rbm4b A G 19: 4,757,331 Y25C probably damaging Het
Reln T C 5: 21,931,429 T2534A probably benign Het
Rock2 A G 12: 16,965,601 H833R probably benign Het
Rxfp3 A G 15: 11,037,025 V87A possibly damaging Het
S100b G A 10: 76,257,102 G23D probably damaging Het
Scn9a T A 2: 66,526,658 M1100L probably benign Het
Sept11 T A 5: 93,148,407 S55T possibly damaging Het
Sv2b T A 7: 75,119,928 Q622L probably benign Het
Taar7a T C 10: 23,992,901 D194G probably benign Het
Trappc3 T C 4: 126,275,221 I168T probably benign Het
Trim27 T C 13: 21,190,126 probably null Het
Wdr49 G A 3: 75,397,052 T109I probably benign Het
Wdr64 T C 1: 175,717,288 Y96H probably damaging Het
Zfp219 A T 14: 52,009,592 L26Q probably damaging Het
Zfp758 T A 17: 22,374,848 V105D possibly damaging Het
Zfp975 C G 7: 42,662,908 E94Q possibly damaging Het
Zfyve9 C T 4: 108,682,137 A289T probably benign Het
Zscan5b T C 7: 6,231,526 S184P possibly damaging Het
Other mutations in Rnf123
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Rnf123 APN 9 108067395 critical splice donor site probably null
IGL01358:Rnf123 APN 9 108069182 missense probably damaging 1.00
IGL01464:Rnf123 APN 9 108052302 missense probably damaging 1.00
IGL01637:Rnf123 APN 9 108058238 missense probably damaging 1.00
IGL01669:Rnf123 APN 9 108058356 missense probably damaging 0.98
IGL01905:Rnf123 APN 9 108071370 splice site probably benign
IGL02070:Rnf123 APN 9 108068302 nonsense probably null
IGL02072:Rnf123 APN 9 108068302 nonsense probably null
IGL02073:Rnf123 APN 9 108068302 nonsense probably null
IGL02074:Rnf123 APN 9 108066889 missense probably damaging 1.00
IGL02079:Rnf123 APN 9 108068302 nonsense probably null
IGL02080:Rnf123 APN 9 108068302 nonsense probably null
IGL02231:Rnf123 APN 9 108066399 missense probably benign 0.17
IGL02281:Rnf123 APN 9 108071452 missense probably benign 0.01
IGL02336:Rnf123 APN 9 108061842 missense probably damaging 1.00
IGL02543:Rnf123 APN 9 108066348 missense probably damaging 1.00
IGL02565:Rnf123 APN 9 108052212 critical splice donor site probably null
IGL02571:Rnf123 APN 9 108068302 nonsense probably null
IGL02572:Rnf123 APN 9 108068302 nonsense probably null
IGL02574:Rnf123 APN 9 108068302 nonsense probably null
IGL02586:Rnf123 APN 9 108068302 nonsense probably null
IGL02589:Rnf123 APN 9 108068302 nonsense probably null
IGL02600:Rnf123 APN 9 108068302 nonsense probably null
IGL02601:Rnf123 APN 9 108068302 nonsense probably null
IGL02602:Rnf123 APN 9 108068302 nonsense probably null
IGL02603:Rnf123 APN 9 108068302 nonsense probably null
IGL02609:Rnf123 APN 9 108068302 nonsense probably null
IGL02628:Rnf123 APN 9 108068302 nonsense probably null
IGL02629:Rnf123 APN 9 108068302 nonsense probably null
IGL02629:Rnf123 APN 9 108070789 splice site probably benign
IGL02630:Rnf123 APN 9 108068302 nonsense probably null
IGL02631:Rnf123 APN 9 108068302 nonsense probably null
IGL02632:Rnf123 APN 9 108068302 nonsense probably null
IGL02650:Rnf123 APN 9 108069748 missense probably benign 0.29
IGL02690:Rnf123 APN 9 108068302 nonsense probably null
IGL02691:Rnf123 APN 9 108068302 nonsense probably null
IGL02692:Rnf123 APN 9 108068302 nonsense probably null
IGL02693:Rnf123 APN 9 108068302 nonsense probably null
IGL02713:Rnf123 APN 9 108068302 nonsense probably null
IGL02736:Rnf123 APN 9 108068302 nonsense probably null
IGL02929:Rnf123 APN 9 108069076 missense probably benign
R1175:Rnf123 UTSW 9 108077373 missense probably benign
R1465:Rnf123 UTSW 9 108071466 splice site probably benign
R1502:Rnf123 UTSW 9 108068510 splice site probably null
R1682:Rnf123 UTSW 9 108077398 missense probably benign 0.16
R1817:Rnf123 UTSW 9 108062926 missense probably benign 0.41
R1855:Rnf123 UTSW 9 108061791 missense probably damaging 1.00
R2394:Rnf123 UTSW 9 108063536 missense probably benign 0.00
R2483:Rnf123 UTSW 9 108063521 missense probably benign 0.16
R3896:Rnf123 UTSW 9 108069103 splice site probably benign
R3940:Rnf123 UTSW 9 108064035 splice site probably benign
R4206:Rnf123 UTSW 9 108063963 missense probably benign 0.01
R4641:Rnf123 UTSW 9 108058587 missense probably damaging 1.00
R4714:Rnf123 UTSW 9 108052439 splice site probably null
R4767:Rnf123 UTSW 9 108052089 missense probably damaging 1.00
R4849:Rnf123 UTSW 9 108056091 missense probably damaging 1.00
R4899:Rnf123 UTSW 9 108063680 missense probably damaging 1.00
R5274:Rnf123 UTSW 9 108064003 frame shift probably null
R5275:Rnf123 UTSW 9 108064003 frame shift probably null
R5276:Rnf123 UTSW 9 108064003 frame shift probably null
R5294:Rnf123 UTSW 9 108064003 frame shift probably null
R5295:Rnf123 UTSW 9 108064003 frame shift probably null
R5394:Rnf123 UTSW 9 108070731 missense probably damaging 1.00
R5717:Rnf123 UTSW 9 108067424 missense probably damaging 1.00
R6186:Rnf123 UTSW 9 108069958 missense possibly damaging 0.55
R6449:Rnf123 UTSW 9 108056053 missense probably benign 0.17
R6502:Rnf123 UTSW 9 108068332 missense possibly damaging 0.46
R6944:Rnf123 UTSW 9 108063623 missense probably benign 0.02
R7003:Rnf123 UTSW 9 108063683 critical splice acceptor site probably null
R7088:Rnf123 UTSW 9 108058536 missense probably null 1.00
R7092:Rnf123 UTSW 9 108068600 missense probably benign 0.07
R7100:Rnf123 UTSW 9 108056639 missense probably damaging 1.00
R7257:Rnf123 UTSW 9 108069029 missense probably damaging 1.00
R7453:Rnf123 UTSW 9 108070408 splice site probably null
R7468:Rnf123 UTSW 9 108069009 missense probably benign 0.00
R7517:Rnf123 UTSW 9 108070274 nonsense probably null
R7577:Rnf123 UTSW 9 108070619 missense probably damaging 1.00
R8296:Rnf123 UTSW 9 108062890 missense probably damaging 1.00
R8322:Rnf123 UTSW 9 108068507 missense probably benign 0.26
R8754:Rnf123 UTSW 9 108071164 missense probably damaging 1.00
R8783:Rnf123 UTSW 9 108069073 missense probably benign
R9052:Rnf123 UTSW 9 108059731 missense probably damaging 1.00
R9156:Rnf123 UTSW 9 108063028 splice site probably benign
R9170:Rnf123 UTSW 9 108071176 missense probably damaging 1.00
R9332:Rnf123 UTSW 9 108067505 missense probably benign 0.00
R9385:Rnf123 UTSW 9 108052268 missense probably benign 0.02
R9394:Rnf123 UTSW 9 108065706 missense probably damaging 1.00
R9432:Rnf123 UTSW 9 108059809 missense probably damaging 0.96
Z1176:Rnf123 UTSW 9 108058395 missense probably damaging 1.00
Z1176:Rnf123 UTSW 9 108062981 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACACTGAGCGCACTTTTC -3'
(R):5'- ATATGCATGGTTCAGTCTTACCTG -3'

Sequencing Primer
(F):5'- GTGTCAGCAAAGAACTGGTCCC -3'
(R):5'- GGTTCAGTCTTACCTGCTCCCAAG -3'
Posted On 2022-10-06