Mutagenetix > Incidental Mutation

Incidental Mutation 'R5442:Trio'

427241

Institutional Source

Beutler Lab

Gene Symbol

Trio

Ensembl Gene

ENSMUSG00000022263

Gene Name

triple functional domain (PTPRF interacting)

Synonyms

Solo, 6720464I07Rik

MMRRC Submission

043007-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5442 (G1)

Quality Score

151

Status

Not validated

Chromosome

Chromosomal Location

27730651-28025848 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 27856194 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 696 (D696G)

Ref Sequence

ENSEMBL: ENSMUSP00000087714 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090247] [ENSMUST00000227337]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000090247
AA Change: D696G

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000087714
Gene: ENSMUSG00000022263
AA Change: D696G

Domain	Start	End	E-Value	Type
low complexity region	2	40	N/A	INTRINSIC
SEC14	68	207	3.4e-26	SMART
SPEC	221	337	2.48e-9	SMART
SPEC	343	445	1.92e-15	SMART
SPEC	569	671	5.35e-14	SMART
SPEC	674	783	1.18e-6	SMART
SPEC	910	1011	2.6e-12	SMART
SPEC	1141	1243	7e-18	SMART
low complexity region	1249	1258	N/A	INTRINSIC
RhoGEF	1296	1466	2.79e-53	SMART
PH	1480	1593	1.53e-9	SMART
SH3	1659	1720	1.9e-8	SMART
low complexity region	1788	1802	N/A	INTRINSIC
low complexity region	1837	1863	N/A	INTRINSIC
low complexity region	1936	1954	N/A	INTRINSIC
RhoGEF	1973	2144	1.32e-63	SMART
PH	2158	2273	3.6e-6	SMART
low complexity region	2291	2341	N/A	INTRINSIC
low complexity region	2371	2390	N/A	INTRINSIC
low complexity region	2491	2503	N/A	INTRINSIC
SH3	2558	2619	1.04e0	SMART
low complexity region	2640	2660	N/A	INTRINSIC
IGc2	2701	2770	4e-12	SMART
S_TKc	2800	3054	4.84e-72	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226580

Predicted Effect

probably benign
Transcript: ENSMUST00000227337
AA Change: D637G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228765

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that functions as a GDP to GTP exchange factor. This protein promotes the reorganization of the actin cytoskeleton, thereby playing a role in cell migration and growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutant mice die during late embryonic development or shortly after birth. They exhibit abnormal skeletal myogenesis and display aberrant organization within the hippocampus and olfactory bulb. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	A	G	11: 120,018,768	M114T	probably benign	Het
Ablim3	A	T	18: 61,857,225		probably null	Het
Adcy10	A	G	1: 165,513,140	D238G	probably benign	Het
Astn2	G	T	4: 65,581,786	S955R	possibly damaging	Het
Casc3	A	G	11: 98,821,471	E112G	probably damaging	Het
Cetn4	C	T	3: 37,309,945	V39I	probably benign	Het
Commd4	A	G	9: 57,156,806	V37A	possibly damaging	Het
Dyrk2	T	C	10: 118,860,738	Q205R	possibly damaging	Het
Gal3st4	A	G	5: 138,265,780	V319A	possibly damaging	Het
Gm14085	A	G	2: 122,486,869	N36S	probably benign	Het
Inpp5d	G	A	1: 87,718,066	A1058T	probably benign	Het
Lpin3	A	G	2: 160,905,016	Y781C	probably damaging	Het
Lrat	C	T	3: 82,903,220	V165M	probably damaging	Het
Ltbr	G	A	6: 125,312,794	R146W	probably damaging	Het
Nlrp6	T	C	7: 140,922,190	S142P	probably benign	Het
Oas1a	T	C	5: 120,897,206	T349A	probably benign	Het
Olfr1033	T	C	2: 86,041,951	V212A	probably benign	Het
Olfr110	A	T	17: 37,499,439	I263F	probably damaging	Het
Olfr671	A	T	7: 104,975,228	F252L	possibly damaging	Het
Olfr898	T	A	9: 38,349,862	S260T	probably benign	Het
Pakap	C	A	4: 57,637,876	P18Q	probably null	Het
Pcdha2	T	C	18: 36,939,862	V182A	probably benign	Het
Phactr3	A	G	2: 178,142,461	D26G	probably benign	Het
Phrf1	G	A	7: 141,240,937	R159H	probably damaging	Het
R3hdm4	C	T	10: 79,912,458	E162K	possibly damaging	Het
Rab3ip	T	C	10: 116,918,848	T268A	probably benign	Het
Rapgef3	T	C	15: 97,758,861	D299G	probably damaging	Het
Rem1	A	G	2: 152,628,057		probably null	Het
Syne1	A	G	10: 5,343,473	M1286T	probably benign	Het
Thsd7a	T	C	6: 12,748,800	T52A	probably benign	Het
Tmem135	A	T	7: 89,144,664	F390Y	probably damaging	Het
Ttll11	T	C	2: 35,903,123	*191W	probably null	Het
Ubr4	A	G	4: 139,407,772	D805G	probably damaging	Het
Usp9y	A	G	Y: 1,336,467	I1469T	possibly damaging	Het
Vmn1r70	G	T	7: 10,633,950	A122S	possibly damaging	Het
Vmn2r78	G	T	7: 86,920,122	L74F	possibly damaging	Het
Wdfy3	T	C	5: 101,896,559	E1860G	probably benign	Het

Other mutations in Trio

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00480:Trio	APN	15	27,912,743 (GRCm38)	splice site	probably benign
IGL01011:Trio	APN	15	27,736,489 (GRCm38)	missense	probably damaging	0.96
IGL01090:Trio	APN	15	27,773,007 (GRCm38)	missense	probably damaging	1.00
IGL01145:Trio	APN	15	27,818,167 (GRCm38)	splice site	probably benign
IGL01147:Trio	APN	15	27,881,320 (GRCm38)	missense	probably damaging	1.00
IGL01161:Trio	APN	15	27,749,781 (GRCm38)	missense	probably damaging	1.00
IGL01324:Trio	APN	15	27,905,323 (GRCm38)	missense	probably benign	0.42
IGL01352:Trio	APN	15	27,901,229 (GRCm38)	missense	probably benign	0.01
IGL01366:Trio	APN	15	27,732,868 (GRCm38)	missense	possibly damaging	0.76
IGL01443:Trio	APN	15	27,838,775 (GRCm38)	splice site	probably benign
IGL01454:Trio	APN	15	27,832,985 (GRCm38)	missense	probably benign	0.32
IGL01695:Trio	APN	15	27,773,001 (GRCm38)	missense	probably damaging	1.00
IGL01765:Trio	APN	15	27,764,026 (GRCm38)	missense	possibly damaging	0.85
IGL01860:Trio	APN	15	27,846,810 (GRCm38)	missense	probably damaging	1.00
IGL01879:Trio	APN	15	27,741,033 (GRCm38)	missense	probably benign	0.12
IGL01991:Trio	APN	15	27,871,274 (GRCm38)	missense	possibly damaging	0.95
IGL02106:Trio	APN	15	27,744,158 (GRCm38)	missense	possibly damaging	0.85
IGL02209:Trio	APN	15	27,744,053 (GRCm38)	missense	probably damaging	1.00
IGL02232:Trio	APN	15	27,902,561 (GRCm38)	missense	probably benign	0.24
IGL02304:Trio	APN	15	27,735,436 (GRCm38)	missense	probably damaging	0.96
IGL02504:Trio	APN	15	27,847,390 (GRCm38)	nonsense	probably null
IGL02508:Trio	APN	15	27,818,104 (GRCm38)	missense	possibly damaging	0.65
IGL02541:Trio	APN	15	27,844,930 (GRCm38)	splice site	probably benign
IGL02617:Trio	APN	15	27,841,849 (GRCm38)	splice site	probably benign
IGL02675:Trio	APN	15	27,768,039 (GRCm38)	unclassified	probably benign
IGL02817:Trio	APN	15	27,902,881 (GRCm38)	missense	probably benign	0.01
IGL02993:Trio	APN	15	27,830,239 (GRCm38)	splice site	probably benign
IGL03007:Trio	APN	15	27,902,742 (GRCm38)	missense	probably damaging	0.99
IGL03135:Trio	APN	15	27,832,011 (GRCm38)	splice site	probably benign
IGL03225:Trio	APN	15	27,902,695 (GRCm38)	missense	probably benign	0.30
R0063:Trio	UTSW	15	27,881,437 (GRCm38)	splice site	probably benign
R0063:Trio	UTSW	15	27,881,437 (GRCm38)	splice site	probably benign
R0302:Trio	UTSW	15	27,902,517 (GRCm38)	missense	probably damaging	1.00
R0505:Trio	UTSW	15	27,767,907 (GRCm38)	missense	probably benign	0.00
R0506:Trio	UTSW	15	27,854,963 (GRCm38)	missense	probably benign	0.12
R0564:Trio	UTSW	15	27,805,822 (GRCm38)	missense	probably damaging	1.00
R0659:Trio	UTSW	15	27,831,399 (GRCm38)	missense	probably damaging	0.97
R0882:Trio	UTSW	15	27,732,894 (GRCm38)	missense	probably damaging	1.00
R0939:Trio	UTSW	15	27,741,250 (GRCm38)	critical splice donor site	probably null
R1018:Trio	UTSW	15	27,871,171 (GRCm38)	missense	probably damaging	1.00
R1439:Trio	UTSW	15	27,897,914 (GRCm38)	missense	probably damaging	1.00
R1456:Trio	UTSW	15	27,753,804 (GRCm38)	splice site	probably benign
R1488:Trio	UTSW	15	27,740,967 (GRCm38)	missense	probably damaging	1.00
R1522:Trio	UTSW	15	27,732,640 (GRCm38)	missense	probably benign	0.28
R1531:Trio	UTSW	15	27,832,985 (GRCm38)	missense	probably benign	0.32
R1640:Trio	UTSW	15	27,833,044 (GRCm38)	missense	probably damaging	1.00
R1646:Trio	UTSW	15	27,758,347 (GRCm38)	missense	possibly damaging	0.91
R1682:Trio	UTSW	15	27,744,146 (GRCm38)	splice site	probably null
R1780:Trio	UTSW	15	27,744,038 (GRCm38)	missense	possibly damaging	0.93
R1791:Trio	UTSW	15	27,841,756 (GRCm38)	missense	probably damaging	1.00
R1803:Trio	UTSW	15	27,748,340 (GRCm38)	missense	probably benign
R1817:Trio	UTSW	15	27,742,495 (GRCm38)	nonsense	probably null
R1853:Trio	UTSW	15	27,756,536 (GRCm38)	missense	probably damaging	1.00
R1898:Trio	UTSW	15	27,742,380 (GRCm38)	missense	possibly damaging	0.52
R1937:Trio	UTSW	15	27,833,056 (GRCm38)	missense	probably damaging	1.00
R1938:Trio	UTSW	15	27,732,891 (GRCm38)	missense	probably damaging	0.98
R2025:Trio	UTSW	15	27,773,927 (GRCm38)	missense	probably damaging	1.00
R2025:Trio	UTSW	15	27,744,137 (GRCm38)	missense	probably damaging	0.99
R2050:Trio	UTSW	15	27,851,945 (GRCm38)	missense	possibly damaging	0.85
R2186:Trio	UTSW	15	27,823,975 (GRCm38)	splice site	probably null
R2913:Trio	UTSW	15	27,854,912 (GRCm38)	missense	probably damaging	1.00
R3151:Trio	UTSW	15	27,805,776 (GRCm38)	missense	probably damaging	1.00
R3771:Trio	UTSW	15	27,748,091 (GRCm38)	missense	probably damaging	0.98
R3773:Trio	UTSW	15	27,748,091 (GRCm38)	missense	probably damaging	0.98
R3826:Trio	UTSW	15	27,833,070 (GRCm38)	missense	probably damaging	1.00
R4015:Trio	UTSW	15	27,744,101 (GRCm38)	missense	possibly damaging	0.71
R4359:Trio	UTSW	15	27,749,797 (GRCm38)	nonsense	probably null
R4370:Trio	UTSW	15	27,748,337 (GRCm38)	nonsense	probably null
R4547:Trio	UTSW	15	27,818,982 (GRCm38)	missense	possibly damaging	0.89
R4573:Trio	UTSW	15	27,772,998 (GRCm38)	small deletion	probably benign
R4620:Trio	UTSW	15	27,871,171 (GRCm38)	missense	probably damaging	1.00
R4735:Trio	UTSW	15	27,752,789 (GRCm38)	splice site	probably null
R4764:Trio	UTSW	15	27,732,538 (GRCm38)	nonsense	probably null
R4775:Trio	UTSW	15	27,881,342 (GRCm38)	nonsense	probably null
R4942:Trio	UTSW	15	27,752,725 (GRCm38)	missense	probably benign	0.21
R5004:Trio	UTSW	15	27,755,178 (GRCm38)	missense	probably damaging	1.00
R5149:Trio	UTSW	15	27,754,029 (GRCm38)	missense	possibly damaging	0.74
R5183:Trio	UTSW	15	27,902,600 (GRCm38)	missense	probably benign	0.00
R5186:Trio	UTSW	15	27,897,991 (GRCm38)	missense	probably damaging	0.97
R5268:Trio	UTSW	15	27,748,286 (GRCm38)	missense	probably benign	0.02
R5344:Trio	UTSW	15	27,735,532 (GRCm38)	missense	probably benign	0.12
R5407:Trio	UTSW	15	27,844,806 (GRCm38)	splice site	probably null
R5617:Trio	UTSW	15	27,902,748 (GRCm38)	missense	probably benign
R5778:Trio	UTSW	15	27,856,164 (GRCm38)	missense	probably benign	0.33
R5986:Trio	UTSW	15	27,851,933 (GRCm38)	missense	possibly damaging	0.88
R5990:Trio	UTSW	15	27,891,459 (GRCm38)	missense	probably benign	0.10
R6011:Trio	UTSW	15	27,735,545 (GRCm38)	missense	probably damaging	0.98
R6063:Trio	UTSW	15	27,891,379 (GRCm38)	missense	possibly damaging	0.94
R6166:Trio	UTSW	15	27,818,071 (GRCm38)	missense	probably damaging	0.96
R6187:Trio	UTSW	15	27,743,952 (GRCm38)	critical splice donor site	probably null
R6387:Trio	UTSW	15	27,752,739 (GRCm38)	missense	probably damaging	1.00
R6402:Trio	UTSW	15	27,902,911 (GRCm38)	missense	probably benign	0.02
R6478:Trio	UTSW	15	27,856,107 (GRCm38)	missense	probably benign	0.01
R6528:Trio	UTSW	15	27,805,870 (GRCm38)	missense	probably damaging	1.00
R6662:Trio	UTSW	15	27,854,996 (GRCm38)	missense	probably benign	0.00
R6825:Trio	UTSW	15	27,889,308 (GRCm38)	missense	probably damaging	0.98
R6890:Trio	UTSW	15	27,919,288 (GRCm38)	unclassified	probably benign
R6945:Trio	UTSW	15	27,824,090 (GRCm38)	missense	probably damaging	1.00
R7027:Trio	UTSW	15	27,805,654 (GRCm38)	missense	possibly damaging	0.86
R7046:Trio	UTSW	15	27,832,051 (GRCm38)	missense	probably damaging	1.00
R7049:Trio	UTSW	15	27,749,799 (GRCm38)	missense	possibly damaging	0.66
R7075:Trio	UTSW	15	27,898,000 (GRCm38)	missense	unknown
R7094:Trio	UTSW	15	27,891,448 (GRCm38)	missense	unknown
R7123:Trio	UTSW	15	27,742,313 (GRCm38)	critical splice donor site	probably benign
R7130:Trio	UTSW	15	27,742,313 (GRCm38)	critical splice donor site	probably benign
R7214:Trio	UTSW	15	27,871,187 (GRCm38)	missense	probably damaging	0.97
R7292:Trio	UTSW	15	27,828,351 (GRCm38)	missense	possibly damaging	0.63
R7293:Trio	UTSW	15	27,871,289 (GRCm38)	missense	possibly damaging	0.66
R7352:Trio	UTSW	15	27,732,876 (GRCm38)	missense	probably damaging	0.96
R7426:Trio	UTSW	15	27,856,107 (GRCm38)	missense	probably benign	0.01
R7451:Trio	UTSW	15	27,747,913 (GRCm38)	missense	probably benign	0.07
R7558:Trio	UTSW	15	27,831,394 (GRCm38)	missense	possibly damaging	0.90
R7578:Trio	UTSW	15	27,854,939 (GRCm38)	missense	possibly damaging	0.94
R7596:Trio	UTSW	15	27,749,826 (GRCm38)	missense	probably damaging	0.99
R7604:Trio	UTSW	15	27,736,445 (GRCm38)	critical splice donor site	probably null
R7609:Trio	UTSW	15	27,912,642 (GRCm38)	missense	unknown
R7767:Trio	UTSW	15	27,889,418 (GRCm38)	missense	unknown
R7784:Trio	UTSW	15	27,763,994 (GRCm38)	missense	probably damaging	1.00
R7817:Trio	UTSW	15	27,749,866 (GRCm38)	missense	probably benign	0.35
R7833:Trio	UTSW	15	27,774,086 (GRCm38)	missense	probably damaging	0.99
R7873:Trio	UTSW	15	27,805,684 (GRCm38)	missense	possibly damaging	0.83
R7879:Trio	UTSW	15	27,851,924 (GRCm38)	missense	possibly damaging	0.94
R7989:Trio	UTSW	15	27,772,935 (GRCm38)	missense	probably damaging	0.97
R8022:Trio	UTSW	15	27,749,866 (GRCm38)	missense	probably benign	0.35
R8050:Trio	UTSW	15	27,891,454 (GRCm38)	missense	unknown
R8217:Trio	UTSW	15	27,818,969 (GRCm38)	missense	probably damaging	0.97
R8280:Trio	UTSW	15	27,902,910 (GRCm38)	missense	unknown
R8283:Trio	UTSW	15	27,756,542 (GRCm38)	missense	possibly damaging	0.79
R8300:Trio	UTSW	15	27,855,022 (GRCm38)	missense	possibly damaging	0.66
R8321:Trio	UTSW	15	27,881,326 (GRCm38)	missense	possibly damaging	0.90
R8477:Trio	UTSW	15	27,773,952 (GRCm38)	missense	possibly damaging	0.83
R8479:Trio	UTSW	15	27,901,200 (GRCm38)	missense	probably benign	0.25
R8682:Trio	UTSW	15	27,905,192 (GRCm38)	missense	unknown
R8688:Trio	UTSW	15	27,748,238 (GRCm38)	missense	possibly damaging	0.61
R8708:Trio	UTSW	15	27,732,546 (GRCm38)	missense	probably damaging	0.99
R8709:Trio	UTSW	15	27,919,237 (GRCm38)	missense	unknown
R8713:Trio	UTSW	15	27,743,951 (GRCm38)	critical splice donor site	probably benign
R8798:Trio	UTSW	15	27,851,837 (GRCm38)	missense	possibly damaging	0.92
R8812:Trio	UTSW	15	27,905,225 (GRCm38)	missense	unknown
R8816:Trio	UTSW	15	27,741,271 (GRCm38)	missense	probably damaging	0.96
R8828:Trio	UTSW	15	27,741,064 (GRCm38)	missense	possibly damaging	0.93
R8987:Trio	UTSW	15	27,732,687 (GRCm38)	missense	probably benign	0.23
R9051:Trio	UTSW	15	27,732,684 (GRCm38)	missense	possibly damaging	0.78
R9069:Trio	UTSW	15	27,852,011 (GRCm38)	missense	possibly damaging	0.83
R9075:Trio	UTSW	15	27,773,936 (GRCm38)	nonsense	probably null
R9079:Trio	UTSW	15	27,732,937 (GRCm38)	missense	possibly damaging	0.52
R9139:Trio	UTSW	15	27,749,836 (GRCm38)	nonsense	probably null
R9494:Trio	UTSW	15	27,846,757 (GRCm38)	missense	probably benign	0.00
R9680:Trio	UTSW	15	27,744,072 (GRCm38)	missense	possibly damaging	0.93
R9720:Trio	UTSW	15	27,847,409 (GRCm38)	missense	probably benign	0.00
R9726:Trio	UTSW	15	27,912,666 (GRCm38)	missense	unknown
X0024:Trio	UTSW	15	27,765,726 (GRCm38)	missense	possibly damaging	0.91
Z1176:Trio	UTSW	15	27,771,387 (GRCm38)	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCTGGAGAGGACACTGGAAC -3'
(R):5'- AGTTGCTGGACTCTTCAGGAC -3'

Sequencing Primer
(F):5'- TCTGGAGAGGACACTGGAACTATTTG -3'
(R):5'- GGACTCTTCAGGACGCTCTC -3'

Posted On

2016-09-01