Incidental Mutation 'R5706:Sorbs1'
ID 452000
Institutional Source Beutler Lab
Gene Symbol Sorbs1
Ensembl Gene ENSMUSG00000025006
Gene Name sorbin and SH3 domain containing 1
Synonyms c-Cbl-associated protein, Ponsin, CAP, 2310065E01Rik, 9530001P15Rik, Sh3d5
MMRRC Submission 043331-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.751) question?
Stock # R5706 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 40283197-40502223 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 40365325 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 153 (T153A)
Ref Sequence ENSEMBL: ENSMUSP00000153313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099466] [ENSMUST00000099467] [ENSMUST00000165212] [ENSMUST00000165469] [ENSMUST00000224233] [ENSMUST00000225153] [ENSMUST00000226047] [ENSMUST00000224583] [ENSMUST00000225786] [ENSMUST00000224247] [ENSMUST00000225148] [ENSMUST00000224667]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000099466
SMART Domains Protein: ENSMUSP00000097065
Gene: ENSMUSG00000025006

DomainStartEndE-ValueType
low complexity region 45 63 N/A INTRINSIC
Sorb 203 249 1.07e-26 SMART
SH3 502 557 2.72e-18 SMART
SH3 576 633 9.32e-17 SMART
low complexity region 647 660 N/A INTRINSIC
SH3 682 739 3.7e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099467
AA Change: T153A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097066
Gene: ENSMUSG00000025006
AA Change: T153A

DomainStartEndE-ValueType
low complexity region 45 63 N/A INTRINSIC
low complexity region 192 213 N/A INTRINSIC
Sorb 327 373 1.24e-22 SMART
coiled coil region 558 584 N/A INTRINSIC
SH3 700 755 2.72e-18 SMART
SH3 774 831 9.32e-17 SMART
low complexity region 845 858 N/A INTRINSIC
SH3 880 937 3.7e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165212
SMART Domains Protein: ENSMUSP00000126460
Gene: ENSMUSG00000025006

DomainStartEndE-ValueType
low complexity region 45 63 N/A INTRINSIC
Sorb 193 239 1.07e-26 SMART
SH3 486 541 2.72e-18 SMART
SH3 560 617 9.32e-17 SMART
low complexity region 631 644 N/A INTRINSIC
SH3 666 723 3.7e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165469
SMART Domains Protein: ENSMUSP00000125768
Gene: ENSMUSG00000025006

DomainStartEndE-ValueType
low complexity region 75 93 N/A INTRINSIC
Sorb 233 279 1.07e-26 SMART
SH3 476 531 2.72e-18 SMART
SH3 550 607 9.32e-17 SMART
low complexity region 621 634 N/A INTRINSIC
SH3 656 713 3.7e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223724
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224227
Predicted Effect probably benign
Transcript: ENSMUST00000224233
Predicted Effect probably benign
Transcript: ENSMUST00000225153
AA Change: T153A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225593
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225766
Predicted Effect probably benign
Transcript: ENSMUST00000226047
Predicted Effect probably benign
Transcript: ENSMUST00000224583
Predicted Effect probably benign
Transcript: ENSMUST00000225786
Predicted Effect probably benign
Transcript: ENSMUST00000224247
Predicted Effect probably benign
Transcript: ENSMUST00000225148
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225879
Predicted Effect probably benign
Transcript: ENSMUST00000224667
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225858
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a CBL-associated protein which functions in the signaling and stimulation of insulin. Mutations in this gene may be associated with human disorders of insulin resistance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased triglyceride levels, altered glucose homeostasis, decreased white blood cells and resistance to developing glucose intolerance induced by a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 121,847,910 (GRCm39) M77K probably benign Het
Amy1 A G 3: 113,349,769 (GRCm39) V467A probably damaging Het
Atf4 T C 15: 80,140,531 (GRCm39) V11A possibly damaging Het
B4galt1 T C 4: 40,807,268 (GRCm39) N373D probably damaging Het
Bpifa3 A G 2: 153,977,498 (GRCm39) K112R probably damaging Het
Chd2 T A 7: 73,141,105 (GRCm39) Y596F possibly damaging Het
Clspn T C 4: 126,472,211 (GRCm39) S962P probably damaging Het
Cyp2c68 T C 19: 39,722,762 (GRCm39) D262G possibly damaging Het
Dcaf11 T C 14: 55,803,152 (GRCm39) I282T probably damaging Het
Dmxl1 T C 18: 50,090,462 (GRCm39) probably null Het
Dnah11 T G 12: 117,987,670 (GRCm39) K2411Q probably damaging Het
Elf3 A G 1: 135,184,220 (GRCm39) V196A probably benign Het
Fhad1 T G 4: 141,681,427 (GRCm39) T538P probably damaging Het
Fkbp10 A G 11: 100,311,849 (GRCm39) D174G probably damaging Het
Gas6 A G 8: 13,527,098 (GRCm39) S217P probably damaging Het
Heatr5b C T 17: 79,074,304 (GRCm39) probably null Het
Iqgap3 A G 3: 88,023,215 (GRCm39) E502G probably benign Het
Klc1 T C 12: 111,762,061 (GRCm39) V577A possibly damaging Het
Lck T C 4: 129,445,431 (GRCm39) probably null Het
Mc3r C A 2: 172,091,610 (GRCm39) Y277* probably null Het
Mlxipl T C 5: 135,162,458 (GRCm39) V640A probably benign Het
Mrc2 A T 11: 105,223,169 (GRCm39) N471Y probably damaging Het
Ncan T A 8: 70,554,667 (GRCm39) H1050L probably damaging Het
Nrl C A 14: 55,759,889 (GRCm39) V13F probably damaging Het
Obscn T A 11: 58,967,082 (GRCm39) Y546F probably damaging Het
Or52u1 T G 7: 104,237,097 (GRCm39) S46A probably benign Het
Or6c209 A G 10: 129,483,960 (GRCm39) probably null Het
Or6d14 A G 6: 116,534,074 (GRCm39) I229M probably damaging Het
Pde3b G A 7: 114,120,927 (GRCm39) G684D probably damaging Het
Prkaa1 C T 15: 5,203,823 (GRCm39) T244I probably benign Het
Scfd2 A T 5: 74,367,059 (GRCm39) probably null Het
Slc22a30 G A 19: 8,321,757 (GRCm39) Q436* probably null Het
Smg1 A T 7: 117,744,813 (GRCm39) V3113D possibly damaging Het
Spag16 A G 1: 69,909,448 (GRCm39) T182A probably benign Het
Spopfm1 T A 3: 94,173,959 (GRCm39) H322Q possibly damaging Het
Svs5 T C 2: 164,079,589 (GRCm39) K106R possibly damaging Het
Tenm1 A G X: 42,163,572 (GRCm39) V107A possibly damaging Het
Topaz1 A T 9: 122,628,550 (GRCm39) I1546F possibly damaging Het
Tubgcp2 C A 7: 139,612,138 (GRCm39) E78* probably null Het
Vars1 A G 17: 35,224,457 (GRCm39) probably null Het
Vmn2r109 A T 17: 20,774,567 (GRCm39) W263R probably benign Het
Other mutations in Sorbs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Sorbs1 APN 19 40,306,473 (GRCm39) missense probably damaging 1.00
IGL00776:Sorbs1 APN 19 40,332,795 (GRCm39) splice site probably null
IGL00788:Sorbs1 APN 19 40,325,487 (GRCm39) splice site probably benign
IGL00943:Sorbs1 APN 19 40,283,484 (GRCm39) utr 3 prime probably benign
IGL01525:Sorbs1 APN 19 40,338,422 (GRCm39) missense probably damaging 1.00
IGL01530:Sorbs1 APN 19 40,365,091 (GRCm39) missense probably benign 0.01
IGL01951:Sorbs1 APN 19 40,306,460 (GRCm39) splice site probably benign
IGL02159:Sorbs1 APN 19 40,316,040 (GRCm39) missense probably damaging 0.96
IGL02252:Sorbs1 APN 19 40,302,841 (GRCm39) missense probably damaging 1.00
IGL02613:Sorbs1 APN 19 40,315,991 (GRCm39) missense probably damaging 1.00
IGL02643:Sorbs1 APN 19 40,353,577 (GRCm39) missense possibly damaging 0.65
IGL02668:Sorbs1 APN 19 40,303,125 (GRCm39) missense probably damaging 1.00
IGL02738:Sorbs1 APN 19 40,365,348 (GRCm39) missense probably damaging 0.97
IGL02965:Sorbs1 APN 19 40,365,187 (GRCm39) missense probably benign 0.01
IGL03083:Sorbs1 APN 19 40,302,820 (GRCm39) missense probably damaging 1.00
IGL03173:Sorbs1 APN 19 40,351,706 (GRCm39) missense probably damaging 1.00
IGL03286:Sorbs1 APN 19 40,332,858 (GRCm39) missense probably damaging 0.99
IGL03292:Sorbs1 APN 19 40,362,009 (GRCm39) missense possibly damaging 0.79
R0016:Sorbs1 UTSW 19 40,303,182 (GRCm39) splice site probably benign
R0016:Sorbs1 UTSW 19 40,303,182 (GRCm39) splice site probably benign
R0306:Sorbs1 UTSW 19 40,332,855 (GRCm39) missense possibly damaging 0.94
R0526:Sorbs1 UTSW 19 40,338,392 (GRCm39) missense probably damaging 1.00
R0551:Sorbs1 UTSW 19 40,300,260 (GRCm39) missense probably damaging 1.00
R0688:Sorbs1 UTSW 19 40,351,706 (GRCm39) missense probably damaging 1.00
R1185:Sorbs1 UTSW 19 40,371,050 (GRCm39) missense probably damaging 1.00
R1185:Sorbs1 UTSW 19 40,371,050 (GRCm39) missense probably damaging 1.00
R1185:Sorbs1 UTSW 19 40,371,050 (GRCm39) missense probably damaging 1.00
R1891:Sorbs1 UTSW 19 40,381,904 (GRCm39) missense probably damaging 0.99
R2066:Sorbs1 UTSW 19 40,353,472 (GRCm39) splice site probably null
R2148:Sorbs1 UTSW 19 40,365,268 (GRCm39) missense possibly damaging 0.94
R2214:Sorbs1 UTSW 19 40,285,075 (GRCm39) missense probably damaging 1.00
R2410:Sorbs1 UTSW 19 40,361,959 (GRCm39) missense probably damaging 0.99
R2940:Sorbs1 UTSW 19 40,362,015 (GRCm39) missense probably damaging 1.00
R3847:Sorbs1 UTSW 19 40,302,887 (GRCm39) missense probably damaging 0.97
R4405:Sorbs1 UTSW 19 40,384,189 (GRCm39) missense probably benign 0.03
R4544:Sorbs1 UTSW 19 40,300,294 (GRCm39) missense probably damaging 0.99
R4618:Sorbs1 UTSW 19 40,361,962 (GRCm39) missense probably damaging 0.99
R4731:Sorbs1 UTSW 19 40,303,133 (GRCm39) missense probably benign 0.29
R4732:Sorbs1 UTSW 19 40,303,133 (GRCm39) missense probably benign 0.29
R4733:Sorbs1 UTSW 19 40,303,133 (GRCm39) missense probably benign 0.29
R4860:Sorbs1 UTSW 19 40,325,449 (GRCm39) missense probably benign 0.44
R4860:Sorbs1 UTSW 19 40,325,449 (GRCm39) missense probably benign 0.44
R4907:Sorbs1 UTSW 19 40,328,491 (GRCm39) nonsense probably null
R4912:Sorbs1 UTSW 19 40,300,171 (GRCm39) missense probably damaging 1.00
R5229:Sorbs1 UTSW 19 40,329,151 (GRCm39) missense probably damaging 1.00
R5285:Sorbs1 UTSW 19 40,310,334 (GRCm39) missense probably damaging 1.00
R5416:Sorbs1 UTSW 19 40,365,433 (GRCm39) missense probably benign 0.06
R5871:Sorbs1 UTSW 19 40,387,027 (GRCm39) missense probably damaging 1.00
R5936:Sorbs1 UTSW 19 40,313,216 (GRCm39) missense probably damaging 0.96
R6073:Sorbs1 UTSW 19 40,303,101 (GRCm39) missense probably damaging 1.00
R6324:Sorbs1 UTSW 19 40,310,263 (GRCm39) missense probably damaging 0.99
R6343:Sorbs1 UTSW 19 40,365,426 (GRCm39) critical splice donor site probably null
R6561:Sorbs1 UTSW 19 40,314,496 (GRCm39) missense probably benign
R6646:Sorbs1 UTSW 19 40,313,993 (GRCm39) missense probably damaging 1.00
R6768:Sorbs1 UTSW 19 40,315,991 (GRCm39) missense probably damaging 1.00
R6849:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R6850:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R6878:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R6879:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R6880:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R6908:Sorbs1 UTSW 19 40,340,776 (GRCm39) missense probably damaging 1.00
R6980:Sorbs1 UTSW 19 40,316,060 (GRCm39) nonsense probably null
R7040:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R7041:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R7110:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R7122:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R7170:Sorbs1 UTSW 19 40,314,573 (GRCm39) nonsense probably null
R7180:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R7185:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R7187:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R7254:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R7255:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R7401:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R7595:Sorbs1 UTSW 19 40,303,097 (GRCm39) missense probably damaging 0.99
R7819:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R7876:Sorbs1 UTSW 19 40,285,032 (GRCm39) missense probably damaging 1.00
R7894:Sorbs1 UTSW 19 40,316,020 (GRCm39) missense probably benign 0.02
R7986:Sorbs1 UTSW 19 40,353,449 (GRCm39) missense probably damaging 0.99
R8031:Sorbs1 UTSW 19 40,314,933 (GRCm39) missense probably benign 0.17
R8082:Sorbs1 UTSW 19 40,353,527 (GRCm39) missense probably benign 0.08
R8282:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8283:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8446:Sorbs1 UTSW 19 40,314,602 (GRCm39) missense probably benign
R8526:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8527:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8528:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8539:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8540:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8542:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8543:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8544:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8545:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8684:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8699:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8702:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8752:Sorbs1 UTSW 19 40,349,872 (GRCm39) critical splice donor site probably null
R8937:Sorbs1 UTSW 19 40,362,006 (GRCm39) missense probably benign 0.02
R8956:Sorbs1 UTSW 19 40,351,660 (GRCm39) missense probably damaging 1.00
R8960:Sorbs1 UTSW 19 40,387,048 (GRCm39) missense probably damaging 0.98
R9175:Sorbs1 UTSW 19 40,315,018 (GRCm39) missense probably damaging 1.00
R9208:Sorbs1 UTSW 19 40,353,462 (GRCm39) start gained probably benign
R9211:Sorbs1 UTSW 19 40,332,798 (GRCm39) critical splice donor site probably null
R9371:Sorbs1 UTSW 19 40,315,324 (GRCm39) missense probably damaging 0.98
R9374:Sorbs1 UTSW 19 40,361,923 (GRCm39) nonsense probably null
R9377:Sorbs1 UTSW 19 40,387,048 (GRCm39) missense probably damaging 0.98
R9551:Sorbs1 UTSW 19 40,361,923 (GRCm39) nonsense probably null
R9552:Sorbs1 UTSW 19 40,361,923 (GRCm39) nonsense probably null
R9686:Sorbs1 UTSW 19 40,381,954 (GRCm39) missense probably damaging 1.00
Z1177:Sorbs1 UTSW 19 40,315,339 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTACGGTACTTGAGACAGCTCCC -3'
(R):5'- GCGTAACTGCGTAACAACCC -3'

Sequencing Primer
(F):5'- TTGAGACAGCTCCCGGGAG -3'
(R):5'- AACCCCTTATTTCCCACAGGGTG -3'
Posted On 2017-01-03