Incidental Mutation 'IGL03014:Efl1'
ID 453316
Institutional Source Beutler Lab
Gene Symbol Efl1
Ensembl Gene ENSMUSG00000038563
Gene Name elongation factor like GTPase 1
Synonyms D7Ertd791e, 6030468D11Rik, 4932434J20Rik, Eftud1
Accession Numbers
Essential gene? Probably essential (E-score: 0.878) question?
Stock # IGL03014 (G1)
Quality Score 214
Status Validated
Chromosome 7
Chromosomal Location 82297822-82427060 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 82301094 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 33 (T33A)
Ref Sequence ENSEMBL: ENSMUSP00000146350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039881] [ENSMUST00000056728] [ENSMUST00000126478] [ENSMUST00000141726] [ENSMUST00000179489] [ENSMUST00000207693] [ENSMUST00000207868]
AlphaFold Q8C0D5
Predicted Effect probably damaging
Transcript: ENSMUST00000039881
AA Change: T33A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046046
Gene: ENSMUSG00000038563
AA Change: T33A

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 365 7.4e-62 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:EFG_II 614 687 4.3e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000056728
SMART Domains Protein: ENSMUSP00000057993
Gene: ENSMUSG00000038570

DomainStartEndE-ValueType
Pfam:STOP 4 201 3.6e-42 PFAM
Pfam:STOP 237 390 4.3e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125245
Predicted Effect probably benign
Transcript: ENSMUST00000126478
Predicted Effect probably damaging
Transcript: ENSMUST00000141726
AA Change: T33A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121909
Gene: ENSMUSG00000038563
AA Change: T33A

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 222 2.3e-57 PFAM
Pfam:MMR_HSR1 21 147 2e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156720
Predicted Effect probably damaging
Transcript: ENSMUST00000179489
AA Change: T33A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137061
Gene: ENSMUSG00000038563
AA Change: T33A

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 364 8.7e-58 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:GTP_EFTU_D2 504 599 1e-7 PFAM
Pfam:EFG_II 614 687 1.8e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207693
Predicted Effect probably damaging
Transcript: ENSMUST00000207868
AA Change: T33A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.8511 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 96% (51/53)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit late-onset and progressive gait abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416I08Rik TCC TCCC X: 52,692,862 (GRCm39) noncoding transcript Het
AW112010 A G 19: 11,025,456 (GRCm39) noncoding transcript Het
Ccdc134 T C 15: 82,014,306 (GRCm39) L13P probably damaging Het
Ccdc150 G T 1: 54,329,861 (GRCm39) V395F probably damaging Het
Cdh22 G T 2: 164,954,331 (GRCm39) S730* probably null Het
Cfap20dc A G 14: 8,431,608 (GRCm38) *675Q probably null Het
Chrng G T 1: 87,138,759 (GRCm39) probably null Het
Cilp TGGG TGG 9: 65,187,412 (GRCm39) probably null Het
Crb1 CG C 1: 139,164,824 (GRCm39) probably null Het
Csmd2 G T 4: 128,190,222 (GRCm39) M387I probably benign Het
Cux1 T C 5: 136,594,379 (GRCm39) probably benign Het
D130043K22Rik C T 13: 25,042,075 (GRCm39) P335S possibly damaging Het
Dctn1 A G 6: 83,174,351 (GRCm39) probably benign Het
Dock11 G T X: 35,310,699 (GRCm39) probably benign Het
Dsn1 A T 2: 156,838,739 (GRCm39) M292K possibly damaging Het
Efemp1 A G 11: 28,876,218 (GRCm39) Y461C probably damaging Het
Fbln2 T C 6: 91,242,901 (GRCm39) probably benign Het
Fcna G C 2: 25,520,693 (GRCm39) probably benign Het
Hecw1 T A 13: 14,420,393 (GRCm39) Y1010F probably damaging Het
Igha A G 12: 113,222,713 (GRCm39) V236A unknown Het
Igsf9b T C 9: 27,233,932 (GRCm39) M377T probably benign Het
Itga9 A G 9: 118,457,212 (GRCm39) T108A probably benign Het
Kcna3 A T 3: 106,945,206 (GRCm39) M490L probably benign Het
Lama3 A T 18: 12,673,024 (GRCm39) Y886F possibly damaging Het
Lcorl T C 5: 45,931,371 (GRCm39) probably benign Het
Lyl1 C T 8: 85,429,300 (GRCm39) P3L possibly damaging Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Odr4 C A 1: 150,258,804 (GRCm39) probably benign Het
Or1a1b G A 11: 74,097,653 (GRCm39) L130F probably damaging Het
Or51a39 A T 7: 102,362,753 (GRCm39) V289E probably null Het
Pex10 A G 4: 155,155,076 (GRCm39) probably benign Het
Plcl2 G A 17: 50,918,029 (GRCm39) V943M possibly damaging Het
Prkcd T A 14: 30,329,294 (GRCm39) T164S probably damaging Het
Ptprn2 T A 12: 117,212,308 (GRCm39) L910Q probably damaging Het
Rab1b T C 19: 5,154,923 (GRCm39) I41V probably benign Het
Scpep1 T A 11: 88,824,271 (GRCm39) probably null Het
Sergef T C 7: 46,240,180 (GRCm39) T288A probably damaging Het
Setdb1 G A 3: 95,248,726 (GRCm39) P397S probably damaging Het
Setx T A 2: 29,029,423 (GRCm39) D230E probably damaging Het
Sin3a C A 9: 57,002,539 (GRCm39) probably benign Het
Smad5 T C 13: 56,883,754 (GRCm39) L380P probably damaging Het
Speer4c1 A C 5: 15,919,214 (GRCm39) probably benign Het
Stard9 A T 2: 120,532,675 (GRCm39) probably benign Het
Tek A G 4: 94,715,500 (GRCm39) D346G probably benign Het
Trav7d-4 T A 14: 53,007,353 (GRCm39) W12R unknown Het
Trmt1l G T 1: 151,333,681 (GRCm39) W728L probably damaging Het
Ubash3a C A 17: 31,458,198 (GRCm39) T559K probably damaging Het
Vmn1r72 T A 7: 11,403,711 (GRCm39) I246F possibly damaging Het
Zfp618 A T 4: 62,998,325 (GRCm39) Q109L probably damaging Het
Other mutations in Efl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00541:Efl1 APN 7 82,307,319 (GRCm39) missense probably damaging 1.00
IGL00696:Efl1 APN 7 82,301,080 (GRCm39) splice site probably benign
IGL01344:Efl1 APN 7 82,330,688 (GRCm39) splice site probably benign
IGL01871:Efl1 APN 7 82,412,527 (GRCm39) missense possibly damaging 0.64
IGL01941:Efl1 APN 7 82,347,184 (GRCm39) missense probably benign 0.17
IGL02104:Efl1 APN 7 82,307,263 (GRCm39) critical splice acceptor site probably null
IGL02150:Efl1 APN 7 82,335,899 (GRCm39) missense probably benign
IGL02484:Efl1 APN 7 82,332,247 (GRCm39) missense probably damaging 0.98
IGL03140:Efl1 APN 7 82,342,089 (GRCm39) missense probably benign 0.00
IGL03188:Efl1 APN 7 82,320,909 (GRCm39) missense probably damaging 1.00
PIT4469001:Efl1 UTSW 7 82,307,373 (GRCm39) missense probably benign 0.14
R0148:Efl1 UTSW 7 82,320,878 (GRCm39) missense probably damaging 1.00
R0226:Efl1 UTSW 7 82,342,219 (GRCm39) splice site probably benign
R0638:Efl1 UTSW 7 82,301,095 (GRCm39) missense probably damaging 1.00
R0684:Efl1 UTSW 7 82,301,094 (GRCm39) missense probably damaging 1.00
R1018:Efl1 UTSW 7 82,412,221 (GRCm39) missense possibly damaging 0.94
R1290:Efl1 UTSW 7 82,320,936 (GRCm39) missense probably damaging 1.00
R1720:Efl1 UTSW 7 82,332,929 (GRCm39) missense possibly damaging 0.50
R1933:Efl1 UTSW 7 82,412,325 (GRCm39) nonsense probably null
R1973:Efl1 UTSW 7 82,412,085 (GRCm39) missense probably damaging 1.00
R2016:Efl1 UTSW 7 82,402,917 (GRCm39) missense probably damaging 1.00
R2124:Efl1 UTSW 7 82,342,121 (GRCm39) missense probably damaging 1.00
R2290:Efl1 UTSW 7 82,426,878 (GRCm39) missense probably damaging 1.00
R2415:Efl1 UTSW 7 82,347,175 (GRCm39) missense probably damaging 1.00
R3545:Efl1 UTSW 7 82,412,018 (GRCm39) missense probably benign 0.00
R3688:Efl1 UTSW 7 82,412,178 (GRCm39) missense probably benign 0.00
R4092:Efl1 UTSW 7 82,412,035 (GRCm39) missense probably benign 0.00
R4207:Efl1 UTSW 7 82,400,024 (GRCm39) missense probably damaging 0.98
R4347:Efl1 UTSW 7 82,347,174 (GRCm39) missense probably damaging 1.00
R4425:Efl1 UTSW 7 82,412,491 (GRCm39) missense probably damaging 0.99
R4816:Efl1 UTSW 7 82,320,927 (GRCm39) missense probably damaging 1.00
R4858:Efl1 UTSW 7 82,320,835 (GRCm39) missense probably damaging 1.00
R5077:Efl1 UTSW 7 82,307,295 (GRCm39) missense probably damaging 1.00
R5185:Efl1 UTSW 7 82,421,707 (GRCm39) missense probably damaging 1.00
R5319:Efl1 UTSW 7 82,323,714 (GRCm39) missense probably damaging 1.00
R5771:Efl1 UTSW 7 82,341,732 (GRCm39) missense probably benign 0.26
R5857:Efl1 UTSW 7 82,412,397 (GRCm39) missense probably benign
R5956:Efl1 UTSW 7 82,301,107 (GRCm39) missense probably damaging 1.00
R6433:Efl1 UTSW 7 82,323,776 (GRCm39) missense probably damaging 1.00
R7131:Efl1 UTSW 7 82,307,272 (GRCm39) missense probably damaging 1.00
R7143:Efl1 UTSW 7 82,411,888 (GRCm39) missense probably damaging 1.00
R7312:Efl1 UTSW 7 82,330,652 (GRCm39) missense probably benign 0.10
R7409:Efl1 UTSW 7 82,347,121 (GRCm39) missense probably damaging 0.98
R7422:Efl1 UTSW 7 82,330,587 (GRCm39) missense probably damaging 1.00
R7453:Efl1 UTSW 7 82,330,675 (GRCm39) missense possibly damaging 0.76
R7504:Efl1 UTSW 7 82,332,257 (GRCm39) missense probably damaging 1.00
R7884:Efl1 UTSW 7 82,307,307 (GRCm39) missense probably damaging 1.00
R7969:Efl1 UTSW 7 82,342,178 (GRCm39) missense probably benign 0.03
R8394:Efl1 UTSW 7 82,411,986 (GRCm39) missense probably benign 0.00
R8702:Efl1 UTSW 7 82,399,998 (GRCm39) critical splice acceptor site probably null
R8924:Efl1 UTSW 7 82,412,161 (GRCm39) missense probably benign 0.03
R9463:Efl1 UTSW 7 82,426,733 (GRCm39) missense probably damaging 1.00
R9762:Efl1 UTSW 7 82,412,596 (GRCm39) missense probably benign 0.09
Z1088:Efl1 UTSW 7 82,342,058 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGTTTCCCCATCAGTTACAAG -3'
(R):5'- GCAATATGGAAGTGAGCTTTTCTC -3'

Sequencing Primer
(F):5'- CCCCATCAGTTACAAGTCTTACTAAG -3'
(R):5'- AACTTAATGGGTTGTCAGTCCC -3'
Posted On 2017-02-01