Incidental Mutation 'R6364:Rdm1'
ID 513432
Institutional Source Beutler Lab
Gene Symbol Rdm1
Ensembl Gene ENSMUSG00000010362
Gene Name RAD52 motif 1
Synonyms Rad52b, 2410008M22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock # R6364 (G1)
Quality Score 217.009
Status Validated
Chromosome 11
Chromosomal Location 101627195-101636100 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 101630242 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 94 (R94H)
Ref Sequence ENSEMBL: ENSMUSP00000010506 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010506]
AlphaFold Q9CQK3
Predicted Effect probably benign
Transcript: ENSMUST00000010506
AA Change: R94H

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000010506
Gene: ENSMUSG00000010362
AA Change: R94H

DomainStartEndE-ValueType
RRM 16 94 6.2e-6 SMART
low complexity region 248 259 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083833
Predicted Effect unknown
Transcript: ENSMUST00000133727
AA Change: R23H
SMART Domains Protein: ENSMUSP00000118996
Gene: ENSMUSG00000010362
AA Change: R23H

DomainStartEndE-ValueType
Pfam:Rad52_Rad22 14 118 1.9e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155222
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in the cellular response to cisplatin, a drug commonly used in chemotherapy. The protein encoded by this gene contains two motifs: a motif found in RAD52, a protein that functions in DNA double-strand breaks and homologous recombination, and an RNA recognition motif (RRM) that is not found in RAD52. The RAD52 motif region in RAD52 is important for protein function and may be involved in DNA binding or oligomerization. Alternatively spliced transcript variants encoding different isoforms have been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 89,721,814 Y234C possibly damaging Het
Als2cr12 G T 1: 58,658,372 A403D probably damaging Het
Ambra1 C A 2: 91,773,316 H548Q possibly damaging Het
Ap3d1 T C 10: 80,710,494 probably null Het
Apol11b A G 15: 77,638,058 V13A possibly damaging Het
Arhgdib C T 6: 136,932,255 probably null Het
B3galt1 T A 2: 68,118,672 S244T probably damaging Het
Bace2 A G 16: 97,413,433 I274V probably benign Het
Bfsp2 A T 9: 103,448,628 V272D probably damaging Het
Blm A T 7: 80,494,526 C782* probably null Het
Cfi G A 3: 129,872,846 S406N probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cic C A 7: 25,272,823 H660N possibly damaging Het
Cops3 A G 11: 59,835,404 probably benign Het
Dlec1 G A 9: 119,121,871 V502I possibly damaging Het
Epop A G 11: 97,628,687 S199P probably benign Het
Evi5 G T 5: 107,842,113 P80Q probably damaging Het
Faf1 T C 4: 109,961,800 V623A possibly damaging Het
Fam129c G A 8: 71,599,089 G23S probably benign Het
Fam83c T C 2: 155,834,523 D109G probably damaging Het
Fam83d T C 2: 158,783,259 probably null Het
Foxn3 T C 12: 99,388,693 N71D probably benign Het
Gm7298 A G 6: 121,779,443 R1016G possibly damaging Het
Grin2d T C 7: 45,858,454 E396G possibly damaging Het
Htra2 C A 6: 83,053,046 V311F probably damaging Het
Kif6 A T 17: 49,620,623 T33S probably benign Het
Kmt2c T C 5: 25,309,636 I3070V probably null Het
Krtap5-2 A T 7: 142,175,063 C293* probably null Het
Lrp3 T A 7: 35,203,709 D404V probably benign Het
Mc2r T G 18: 68,407,536 I229L probably benign Het
Mtnr1b A G 9: 15,863,004 M253T possibly damaging Het
Nfat5 A G 8: 107,368,277 N531S probably benign Het
Npr2 T A 4: 43,643,622 I550N probably damaging Het
Npy6r T C 18: 44,276,511 I333T possibly damaging Het
Nup88 C T 11: 70,947,786 R468Q probably benign Het
Nup98 G A 7: 102,176,315 T422I probably damaging Het
Olfr433 T A 1: 174,042,212 H87Q possibly damaging Het
Oraov1 A G 7: 144,919,268 D105G probably benign Het
Otud4 A G 8: 79,646,341 N96S probably damaging Het
Paqr6 T C 3: 88,365,958 F86L probably damaging Het
Ppp4r3b A T 11: 29,188,035 T90S probably benign Het
Ptbp2 A T 3: 119,740,442 N23K probably damaging Het
Ralgapb G T 2: 158,462,109 G596V probably damaging Het
Rergl A T 6: 139,500,748 F28I probably damaging Het
Rif1 G T 2: 52,107,669 S1000I probably damaging Het
Rnf141 C T 7: 110,821,309 A163T possibly damaging Het
Scaf4 G A 16: 90,260,248 Q72* probably null Het
Sdk1 G T 5: 141,962,709 S603I probably benign Het
Sdsl T C 5: 120,460,609 I147M probably damaging Het
Serpina6 T C 12: 103,654,236 N85D probably benign Het
Serpinf2 A G 11: 75,436,489 I204T probably damaging Het
Shank2 A G 7: 144,410,409 S795G probably benign Het
Simc1 C T 13: 54,524,600 Q254* probably null Het
Slc30a3 G A 5: 31,088,739 P216S possibly damaging Het
Smim14 T A 5: 65,453,296 I53F probably benign Het
Sp3 T C 2: 72,970,941 T243A probably benign Het
Srpk2 A G 5: 23,540,467 F164L probably damaging Het
Stard9 T C 2: 120,713,429 F4403L probably damaging Het
Tbc1d30 T C 10: 121,294,725 T267A possibly damaging Het
Tgm7 T A 2: 121,096,397 R424* probably null Het
Tmbim6 T C 15: 99,406,185 L113P probably damaging Het
Tmcc1 G A 6: 116,043,761 probably benign Het
Tomm7 A G 5: 23,844,030 L15P probably damaging Het
Tpcn1 T C 5: 120,553,810 Y263C probably damaging Het
Trim34b T C 7: 104,336,526 F456S probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vmn2r108 A G 17: 20,470,998 I421T probably benign Het
Wdr43 A G 17: 71,657,654 E676G probably damaging Het
Wdr60 A T 12: 116,241,732 D412E probably damaging Het
Zcchc14 G T 8: 121,604,859 probably benign Het
Zfp64 C A 2: 168,912,266 G25V probably damaging Het
Zswim8 C A 14: 20,713,011 P326H probably damaging Het
Other mutations in Rdm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Rdm1 APN 11 101635754 missense possibly damaging 0.58
IGL02153:Rdm1 APN 11 101628454 critical splice donor site probably null
IGL02589:Rdm1 APN 11 101628005 missense possibly damaging 0.80
R0532:Rdm1 UTSW 11 101635835 missense probably benign 0.11
R1111:Rdm1 UTSW 11 101633895 missense probably benign 0.19
R1532:Rdm1 UTSW 11 101633817 missense probably damaging 1.00
R1618:Rdm1 UTSW 11 101628391 missense possibly damaging 0.83
R1696:Rdm1 UTSW 11 101630868 missense probably benign 0.43
R2205:Rdm1 UTSW 11 101634803 missense probably damaging 1.00
R2921:Rdm1 UTSW 11 101630890 missense possibly damaging 0.90
R2922:Rdm1 UTSW 11 101630890 missense possibly damaging 0.90
R2923:Rdm1 UTSW 11 101630890 missense possibly damaging 0.90
R4327:Rdm1 UTSW 11 101630908 missense probably damaging 1.00
R4329:Rdm1 UTSW 11 101630908 missense probably damaging 1.00
R7109:Rdm1 UTSW 11 101633828 missense probably damaging 1.00
R8063:Rdm1 UTSW 11 101630868 missense probably benign 0.43
R8485:Rdm1 UTSW 11 101627990 missense probably benign 0.28
R9209:Rdm1 UTSW 11 101628031 missense probably benign
X0010:Rdm1 UTSW 11 101627970 start codon destroyed probably null 0.99
Predicted Primers PCR Primer
(F):5'- TTCAAGGTACTATTGGGAAGTGAG -3'
(R):5'- GCCCTGTAAAAGCCTCCTTG -3'

Sequencing Primer
(F):5'- AGCACAGGTTAGCCTTGTAC -3'
(R):5'- AAAGCCTCCTTGAAGTCTAGG -3'
Posted On 2018-04-27