Incidental Mutation 'R6364:Rif1'
ID513377
Institutional Source Beutler Lab
Gene Symbol Rif1
Ensembl Gene ENSMUSG00000036202
Gene Namereplication timing regulatory factor 1
Synonyms6530403D07Rik, 5730435J01Rik, D2Ertd145e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6364 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location52072832-52122383 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 52107669 bp
ZygosityHeterozygous
Amino Acid Change Serine to Isoleucine at position 1000 (S1000I)
Ref Sequence ENSEMBL: ENSMUSP00000108313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069794] [ENSMUST00000112693]
Predicted Effect probably damaging
Transcript: ENSMUST00000069794
AA Change: S1000I

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000064155
Gene: ENSMUSG00000036202
AA Change: S1000I

DomainStartEndE-ValueType
Pfam:Rif1_N 22 368 3.3e-78 PFAM
low complexity region 432 444 N/A INTRINSIC
low complexity region 586 598 N/A INTRINSIC
low complexity region 1018 1038 N/A INTRINSIC
low complexity region 1180 1205 N/A INTRINSIC
low complexity region 1310 1321 N/A INTRINSIC
low complexity region 1423 1446 N/A INTRINSIC
low complexity region 1576 1586 N/A INTRINSIC
low complexity region 1677 1690 N/A INTRINSIC
low complexity region 1702 1712 N/A INTRINSIC
low complexity region 2176 2195 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112693
AA Change: S1000I

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108313
Gene: ENSMUSG00000036202
AA Change: S1000I

DomainStartEndE-ValueType
Pfam:Rif1_N 18 381 1.4e-85 PFAM
low complexity region 432 444 N/A INTRINSIC
low complexity region 586 598 N/A INTRINSIC
low complexity region 1018 1038 N/A INTRINSIC
low complexity region 1180 1205 N/A INTRINSIC
low complexity region 1310 1321 N/A INTRINSIC
low complexity region 1423 1446 N/A INTRINSIC
low complexity region 1576 1586 N/A INTRINSIC
low complexity region 1677 1690 N/A INTRINSIC
low complexity region 1702 1712 N/A INTRINSIC
low complexity region 2176 2195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125322
Predicted Effect probably benign
Transcript: ENSMUST00000125376
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145130
Predicted Effect probably benign
Transcript: ENSMUST00000152178
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that shares homology with the yeast teleomere binding protein, Rap1 interacting factor 1. This protein localizes to aberrant telomeres may be involved in DNA repair. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice homozygous for a gene trap allele exhibit embryonic and postnatal lethality, reduced fertility, and decreased cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 89,721,814 Y234C possibly damaging Het
Als2cr12 G T 1: 58,658,372 A403D probably damaging Het
Ambra1 C A 2: 91,773,316 H548Q possibly damaging Het
Ap3d1 T C 10: 80,710,494 probably null Het
Apol11b A G 15: 77,638,058 V13A possibly damaging Het
Arhgdib C T 6: 136,932,255 probably null Het
B3galt1 T A 2: 68,118,672 S244T probably damaging Het
Bace2 A G 16: 97,413,433 I274V probably benign Het
Bfsp2 A T 9: 103,448,628 V272D probably damaging Het
Blm A T 7: 80,494,526 C782* probably null Het
Cfi G A 3: 129,872,846 S406N probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cic C A 7: 25,272,823 H660N possibly damaging Het
Cops3 A G 11: 59,835,404 probably benign Het
Dlec1 G A 9: 119,121,871 V502I possibly damaging Het
Epop A G 11: 97,628,687 S199P probably benign Het
Evi5 G T 5: 107,842,113 P80Q probably damaging Het
Faf1 T C 4: 109,961,800 V623A possibly damaging Het
Fam129c G A 8: 71,599,089 G23S probably benign Het
Fam83c T C 2: 155,834,523 D109G probably damaging Het
Fam83d T C 2: 158,783,259 probably null Het
Foxn3 T C 12: 99,388,693 N71D probably benign Het
Gm7298 A G 6: 121,779,443 R1016G possibly damaging Het
Grin2d T C 7: 45,858,454 E396G possibly damaging Het
Htra2 C A 6: 83,053,046 V311F probably damaging Het
Kif6 A T 17: 49,620,623 T33S probably benign Het
Kmt2c T C 5: 25,309,636 I3070V probably null Het
Krtap5-2 A T 7: 142,175,063 C293* probably null Het
Lrp3 T A 7: 35,203,709 D404V probably benign Het
Mc2r T G 18: 68,407,536 I229L probably benign Het
Mtnr1b A G 9: 15,863,004 M253T possibly damaging Het
Nfat5 A G 8: 107,368,277 N531S probably benign Het
Npr2 T A 4: 43,643,622 I550N probably damaging Het
Npy6r T C 18: 44,276,511 I333T possibly damaging Het
Nup88 C T 11: 70,947,786 R468Q probably benign Het
Nup98 G A 7: 102,176,315 T422I probably damaging Het
Olfr433 T A 1: 174,042,212 H87Q possibly damaging Het
Oraov1 A G 7: 144,919,268 D105G probably benign Het
Otud4 A G 8: 79,646,341 N96S probably damaging Het
Paqr6 T C 3: 88,365,958 F86L probably damaging Het
Ppp4r3b A T 11: 29,188,035 T90S probably benign Het
Ptbp2 A T 3: 119,740,442 N23K probably damaging Het
Ralgapb G T 2: 158,462,109 G596V probably damaging Het
Rdm1 G A 11: 101,630,242 R94H probably benign Het
Rergl A T 6: 139,500,748 F28I probably damaging Het
Rnf141 C T 7: 110,821,309 A163T possibly damaging Het
Scaf4 G A 16: 90,260,248 Q72* probably null Het
Sdk1 G T 5: 141,962,709 S603I probably benign Het
Sdsl T C 5: 120,460,609 I147M probably damaging Het
Serpina6 T C 12: 103,654,236 N85D probably benign Het
Serpinf2 A G 11: 75,436,489 I204T probably damaging Het
Shank2 A G 7: 144,410,409 S795G probably benign Het
Simc1 C T 13: 54,524,600 Q254* probably null Het
Slc30a3 G A 5: 31,088,739 P216S possibly damaging Het
Smim14 T A 5: 65,453,296 I53F probably benign Het
Sp3 T C 2: 72,970,941 T243A probably benign Het
Srpk2 A G 5: 23,540,467 F164L probably damaging Het
Stard9 T C 2: 120,713,429 F4403L probably damaging Het
Tbc1d30 T C 10: 121,294,725 T267A possibly damaging Het
Tgm7 T A 2: 121,096,397 R424* probably null Het
Tmbim6 T C 15: 99,406,185 L113P probably damaging Het
Tmcc1 G A 6: 116,043,761 probably benign Het
Tomm7 A G 5: 23,844,030 L15P probably damaging Het
Tpcn1 T C 5: 120,553,810 Y263C probably damaging Het
Trim34b T C 7: 104,336,526 F456S probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vmn2r108 A G 17: 20,470,998 I421T probably benign Het
Wdr43 A G 17: 71,657,654 E676G probably damaging Het
Wdr60 A T 12: 116,241,732 D412E probably damaging Het
Zcchc14 G T 8: 121,604,859 probably benign Het
Zfp64 C A 2: 168,912,266 G25V probably damaging Het
Zswim8 C A 14: 20,713,011 P326H probably damaging Het
Other mutations in Rif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Rif1 APN 2 52121007 missense probably damaging 0.96
IGL00711:Rif1 APN 2 52111070 missense probably benign 0.00
IGL00721:Rif1 APN 2 52119117 missense probably damaging 1.00
IGL01085:Rif1 APN 2 52085140 missense possibly damaging 0.71
IGL01093:Rif1 APN 2 52095948 missense probably damaging 1.00
IGL01107:Rif1 APN 2 52111303 missense probably benign 0.00
IGL01138:Rif1 APN 2 52111522 missense probably damaging 1.00
IGL01844:Rif1 APN 2 52112543 missense probably benign 0.07
IGL02441:Rif1 APN 2 52105515 missense probably benign 0.00
IGL02448:Rif1 APN 2 52116696 missense probably damaging 0.99
IGL02563:Rif1 APN 2 52077065 missense probably damaging 1.00
IGL02704:Rif1 APN 2 52093576 missense probably damaging 1.00
IGL02946:Rif1 APN 2 52110125 nonsense probably null
IGL03060:Rif1 APN 2 52112137 missense probably damaging 0.97
IGL03206:Rif1 APN 2 52103622 missense probably damaging 1.00
IGL03263:Rif1 APN 2 52090261 missense probably damaging 0.99
IGL03267:Rif1 APN 2 52076988 missense possibly damaging 0.94
IGL03280:Rif1 APN 2 52112599 missense probably benign 0.32
hifi UTSW 2 52110324 unclassified probably benign
nietzsche UTSW 2 52077020 missense probably benign 0.08
PIT4305001:Rif1 UTSW 2 52111958 missense
R0017:Rif1 UTSW 2 52116674 missense probably benign 0.18
R0017:Rif1 UTSW 2 52116674 missense probably benign 0.18
R0060:Rif1 UTSW 2 52111117 missense probably damaging 1.00
R0060:Rif1 UTSW 2 52111117 missense probably damaging 1.00
R0104:Rif1 UTSW 2 52110092 missense possibly damaging 0.77
R0268:Rif1 UTSW 2 52090286 critical splice donor site probably null
R0276:Rif1 UTSW 2 52110324 unclassified probably benign
R0278:Rif1 UTSW 2 52110324 unclassified probably benign
R0288:Rif1 UTSW 2 52110013 missense probably damaging 1.00
R0314:Rif1 UTSW 2 52110324 unclassified probably benign
R0345:Rif1 UTSW 2 52110324 unclassified probably benign
R0346:Rif1 UTSW 2 52110324 unclassified probably benign
R0383:Rif1 UTSW 2 52085141 missense probably damaging 0.96
R0384:Rif1 UTSW 2 52110324 unclassified probably benign
R0387:Rif1 UTSW 2 52110324 unclassified probably benign
R0388:Rif1 UTSW 2 52110324 unclassified probably benign
R0456:Rif1 UTSW 2 52110324 unclassified probably benign
R0477:Rif1 UTSW 2 52110324 unclassified probably benign
R0505:Rif1 UTSW 2 52110737 missense probably damaging 0.99
R0510:Rif1 UTSW 2 52110324 unclassified probably benign
R0511:Rif1 UTSW 2 52110324 unclassified probably benign
R0512:Rif1 UTSW 2 52110324 unclassified probably benign
R0633:Rif1 UTSW 2 52112563 missense probably benign 0.00
R0637:Rif1 UTSW 2 52110324 unclassified probably benign
R0638:Rif1 UTSW 2 52111588 missense probably benign 0.12
R0666:Rif1 UTSW 2 52110324 unclassified probably benign
R0675:Rif1 UTSW 2 52110324 unclassified probably benign
R0707:Rif1 UTSW 2 52110324 unclassified probably benign
R0726:Rif1 UTSW 2 52110353 missense possibly damaging 0.52
R0743:Rif1 UTSW 2 52110324 unclassified probably benign
R0744:Rif1 UTSW 2 52110324 unclassified probably benign
R0938:Rif1 UTSW 2 52110324 unclassified probably benign
R0939:Rif1 UTSW 2 52110324 unclassified probably benign
R0940:Rif1 UTSW 2 52110324 unclassified probably benign
R0941:Rif1 UTSW 2 52110324 unclassified probably benign
R0942:Rif1 UTSW 2 52110324 unclassified probably benign
R0943:Rif1 UTSW 2 52110324 unclassified probably benign
R1006:Rif1 UTSW 2 52085029 missense probably damaging 0.99
R1052:Rif1 UTSW 2 52111562 missense probably benign 0.01
R1061:Rif1 UTSW 2 52110324 unclassified probably benign
R1175:Rif1 UTSW 2 52107628 unclassified probably benign
R1183:Rif1 UTSW 2 52110324 unclassified probably benign
R1184:Rif1 UTSW 2 52110324 unclassified probably benign
R1271:Rif1 UTSW 2 52110324 unclassified probably benign
R1332:Rif1 UTSW 2 52078314 missense probably benign 0.06
R1336:Rif1 UTSW 2 52078314 missense probably benign 0.06
R1351:Rif1 UTSW 2 52111555 missense possibly damaging 0.74
R1517:Rif1 UTSW 2 52110324 unclassified probably benign
R1527:Rif1 UTSW 2 52110324 unclassified probably benign
R1560:Rif1 UTSW 2 52111131 missense probably damaging 1.00
R1563:Rif1 UTSW 2 52073223 missense probably damaging 0.99
R1571:Rif1 UTSW 2 52110324 unclassified probably benign
R1625:Rif1 UTSW 2 52103640 missense probably benign 0.25
R1679:Rif1 UTSW 2 52110324 unclassified probably benign
R1689:Rif1 UTSW 2 52110324 unclassified probably benign
R1731:Rif1 UTSW 2 52110324 unclassified probably benign
R1744:Rif1 UTSW 2 52112392 missense possibly damaging 0.56
R1746:Rif1 UTSW 2 52110324 unclassified probably benign
R1748:Rif1 UTSW 2 52110324 unclassified probably benign
R1831:Rif1 UTSW 2 52078495 nonsense probably null
R1902:Rif1 UTSW 2 52116673 missense possibly damaging 0.93
R1964:Rif1 UTSW 2 52098409 missense probably benign 0.01
R1978:Rif1 UTSW 2 52110324 unclassified probably benign
R2000:Rif1 UTSW 2 52081298 missense probably damaging 0.99
R2030:Rif1 UTSW 2 52092346 missense probably damaging 1.00
R2056:Rif1 UTSW 2 52093576 missense probably damaging 1.00
R2106:Rif1 UTSW 2 52110324 unclassified probably benign
R2109:Rif1 UTSW 2 52110324 unclassified probably benign
R2125:Rif1 UTSW 2 52110324 unclassified probably benign
R2126:Rif1 UTSW 2 52110324 unclassified probably benign
R2145:Rif1 UTSW 2 52111400 missense possibly damaging 0.63
R2152:Rif1 UTSW 2 52110324 unclassified probably benign
R2153:Rif1 UTSW 2 52110324 unclassified probably benign
R2213:Rif1 UTSW 2 52110324 unclassified probably benign
R2327:Rif1 UTSW 2 52110324 unclassified probably benign
R2512:Rif1 UTSW 2 52110324 unclassified probably benign
R2513:Rif1 UTSW 2 52110324 unclassified probably benign
R2516:Rif1 UTSW 2 52110324 unclassified probably benign
R2520:Rif1 UTSW 2 52110324 unclassified probably benign
R2905:Rif1 UTSW 2 52098504 missense probably damaging 0.99
R3005:Rif1 UTSW 2 52082764 missense probably damaging 1.00
R3155:Rif1 UTSW 2 52110324 unclassified probably benign
R3156:Rif1 UTSW 2 52110324 unclassified probably benign
R3429:Rif1 UTSW 2 52110324 unclassified probably benign
R3707:Rif1 UTSW 2 52093580 missense probably damaging 1.00
R3907:Rif1 UTSW 2 52112545 missense probably benign 0.03
R3978:Rif1 UTSW 2 52116747 critical splice donor site probably null
R4023:Rif1 UTSW 2 52121087 missense probably benign 0.01
R4052:Rif1 UTSW 2 52098471 nonsense probably null
R4668:Rif1 UTSW 2 52111952 missense probably benign 0.01
R4674:Rif1 UTSW 2 52106942 missense probably null 1.00
R4715:Rif1 UTSW 2 52073139 utr 5 prime probably benign
R4766:Rif1 UTSW 2 52098934 missense probably damaging 1.00
R4783:Rif1 UTSW 2 52112747 missense probably damaging 0.96
R4785:Rif1 UTSW 2 52112747 missense probably damaging 0.96
R4869:Rif1 UTSW 2 52093611 intron probably benign
R4911:Rif1 UTSW 2 52110518 missense probably damaging 0.98
R4951:Rif1 UTSW 2 52084986 splice site probably null
R5044:Rif1 UTSW 2 52109928 missense probably damaging 0.99
R5088:Rif1 UTSW 2 52092295 missense possibly damaging 0.91
R5151:Rif1 UTSW 2 52120309 missense probably damaging 1.00
R5187:Rif1 UTSW 2 52081289 missense probably damaging 1.00
R5222:Rif1 UTSW 2 52077020 missense probably benign 0.08
R5243:Rif1 UTSW 2 52111824 missense possibly damaging 0.86
R5436:Rif1 UTSW 2 52120971 intron probably benign
R5476:Rif1 UTSW 2 52089595 missense probably damaging 1.00
R5496:Rif1 UTSW 2 52098916 missense probably damaging 1.00
R5641:Rif1 UTSW 2 52121158 missense possibly damaging 0.80
R5883:Rif1 UTSW 2 52105639 critical splice donor site probably null
R5987:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R5990:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R5992:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R6019:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R6020:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R6255:Rif1 UTSW 2 52085053 missense probably damaging 1.00
R6342:Rif1 UTSW 2 52119156 missense probably damaging 0.97
R6747:Rif1 UTSW 2 52078263 splice site probably null
R6928:Rif1 UTSW 2 52095961 missense probably damaging 1.00
R6954:Rif1 UTSW 2 52112691 missense probably benign 0.00
R7003:Rif1 UTSW 2 52076989 missense probably benign 0.06
R7310:Rif1 UTSW 2 52105619 missense probably benign 0.12
R7549:Rif1 UTSW 2 52078507 missense possibly damaging 0.52
R7603:Rif1 UTSW 2 52076175 missense probably damaging 1.00
R7673:Rif1 UTSW 2 52088654 missense probably damaging 1.00
R7741:Rif1 UTSW 2 52085141 missense probably damaging 0.96
R7777:Rif1 UTSW 2 52116356 missense probably benign 0.00
R7910:Rif1 UTSW 2 52078387 nonsense probably null
R7962:Rif1 UTSW 2 52074276 missense probably damaging 1.00
R8264:Rif1 UTSW 2 52090278 missense noncoding transcript
R8390:Rif1 UTSW 2 52110923 missense probably damaging 1.00
X0064:Rif1 UTSW 2 52074315 missense probably benign 0.00
X0064:Rif1 UTSW 2 52094633 missense probably damaging 0.96
Z1177:Rif1 UTSW 2 52088648 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGGCACAGTCTGTCTTTG -3'
(R):5'- CTGGGCTTCTACATCTACAAGC -3'

Sequencing Primer
(F):5'- GTTTTCAGTAGACTTCTGCTCAG -3'
(R):5'- CTTTGGCCGACAGTTTCA -3'
Posted On2018-04-27