Incidental Mutation 'R6499:Fam214a'
ID519632
Institutional Source Beutler Lab
Gene Symbol Fam214a
Ensembl Gene ENSMUSG00000034858
Gene Namefamily with sequence similarity 214, member A
SynonymsBC031353, C130047D21Rik, 6330415I01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.467) question?
Stock #R6499 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location74952884-75032468 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 75023648 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 958 (Q958K)
Ref Sequence ENSEMBL: ENSMUSP00000150065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081746] [ENSMUST00000170846] [ENSMUST00000214755] [ENSMUST00000215370]
Predicted Effect probably damaging
Transcript: ENSMUST00000081746
AA Change: Q965K

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000080442
Gene: ENSMUSG00000034858
AA Change: Q965K

DomainStartEndE-ValueType
low complexity region 349 360 N/A INTRINSIC
internal_repeat_1 361 458 7.22e-14 PROSPERO
internal_repeat_1 473 570 7.22e-14 PROSPERO
low complexity region 840 859 N/A INTRINSIC
DUF4210 885 943 8.5e-29 SMART
Pfam:Chromosome_seg 1024 1081 3.5e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170846
AA Change: Q958K

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129319
Gene: ENSMUSG00000034858
AA Change: Q958K

DomainStartEndE-ValueType
low complexity region 342 353 N/A INTRINSIC
internal_repeat_1 354 451 8.38e-14 PROSPERO
internal_repeat_1 466 563 8.38e-14 PROSPERO
low complexity region 833 852 N/A INTRINSIC
DUF4210 878 936 8.5e-29 SMART
Pfam:Chromosome_seg 1016 1074 1.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214755
AA Change: Q958K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000215370
AA Change: Q958K

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
Meta Mutation Damage Score 0.6393 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,068,800 T1250M probably damaging Het
Actn1 C T 12: 80,168,417 A857T possibly damaging Het
Adam2 C T 14: 66,058,790 V207I probably damaging Het
Angpt2 T C 8: 18,694,517 T404A probably benign Het
Ank3 T C 10: 69,991,744 probably benign Het
B4galt4 T A 16: 38,757,822 D210E probably benign Het
Brinp3 A T 1: 146,901,693 H626L possibly damaging Het
Ccna2 T G 3: 36,570,963 D68A probably damaging Het
Cd163 G A 6: 124,304,744 G2D probably benign Het
Chrm5 A T 2: 112,480,480 V97D probably benign Het
Dctn5 G A 7: 122,135,097 V55I probably benign Het
Dnm3 A T 1: 162,313,595 I365N probably damaging Het
Esyt2 A G 12: 116,321,170 D184G probably damaging Het
Ifi214 C A 1: 173,525,031 K277N probably damaging Het
Il11ra1 C T 4: 41,765,412 P169L probably benign Het
Inhbb C T 1: 119,417,339 E407K probably damaging Het
Lama2 T A 10: 27,031,158 T2336S probably damaging Het
Ldhb A T 6: 142,494,121 V231E possibly damaging Het
Lrit2 T C 14: 37,068,810 F149L probably damaging Het
Malrd1 T A 2: 15,931,689 S1575T probably benign Het
Naip5 A G 13: 100,221,594 C1045R probably benign Het
Nefl A G 14: 68,084,585 E208G probably damaging Het
Olfr20 T A 11: 73,354,185 L144Q probably damaging Het
Olfr507 G T 7: 108,622,506 M231I probably benign Het
Olfr812 T C 10: 129,842,584 I153V probably benign Het
Olfr859 A G 9: 19,808,551 I78V probably benign Het
Oog4 A C 4: 143,437,978 S328A probably damaging Het
Pbrm1 A G 14: 31,061,509 N528D probably damaging Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Polq T C 16: 37,060,827 S839P probably benign Het
Psmg1 A G 16: 95,988,097 F87L probably damaging Het
Ptprt A G 2: 161,534,587 M1298T probably benign Het
Rbm27 T A 18: 42,337,011 W958R probably damaging Het
Skint5 T G 4: 113,539,355 D1207A unknown Het
Stx17 T A 4: 48,183,478 probably null Het
Tas2r114 A T 6: 131,689,136 *310R probably null Het
Tmem130 T A 5: 144,752,414 N139I probably damaging Het
Trpc1 T C 9: 95,726,437 E267G probably damaging Het
Trrap T A 5: 144,857,002 M3398K probably damaging Het
Vrtn T G 12: 84,650,316 D613E probably benign Het
Vsx1 G T 2: 150,688,521 T147K probably benign Het
Wdr55 T C 18: 36,762,178 V103A probably benign Het
Zfp712 A T 13: 67,052,336 D28E probably benign Het
Other mutations in Fam214a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Fam214a APN 9 75025790 missense probably benign 0.28
IGL00588:Fam214a APN 9 75009581 missense probably damaging 1.00
IGL01887:Fam214a APN 9 75017057 missense probably benign 0.39
IGL02828:Fam214a APN 9 75006432 missense probably damaging 1.00
IGL03060:Fam214a APN 9 75010168 missense probably damaging 0.96
IGL03277:Fam214a APN 9 75009232 missense probably damaging 1.00
R0052:Fam214a UTSW 9 75018983 splice site probably benign
R0052:Fam214a UTSW 9 75018983 splice site probably benign
R0615:Fam214a UTSW 9 75004288 missense probably damaging 1.00
R0723:Fam214a UTSW 9 75009451 missense probably damaging 1.00
R1428:Fam214a UTSW 9 75006321 missense probably benign 0.07
R1448:Fam214a UTSW 9 75010174 nonsense probably null
R1656:Fam214a UTSW 9 75008959 missense probably benign 0.00
R2024:Fam214a UTSW 9 75010390 missense probably damaging 0.98
R3147:Fam214a UTSW 9 75008838 missense probably benign 0.25
R3745:Fam214a UTSW 9 75009862 missense probably benign 0.00
R4105:Fam214a UTSW 9 75008776 missense probably damaging 1.00
R4224:Fam214a UTSW 9 75008726 missense probably damaging 1.00
R4496:Fam214a UTSW 9 75031531 missense probably damaging 0.99
R4519:Fam214a UTSW 9 75023647 missense probably damaging 1.00
R4715:Fam214a UTSW 9 75012968 missense probably damaging 1.00
R4885:Fam214a UTSW 9 75006367 missense probably damaging 1.00
R5009:Fam214a UTSW 9 75008889 missense probably damaging 0.98
R5574:Fam214a UTSW 9 75010390 missense probably damaging 1.00
R5645:Fam214a UTSW 9 75025679 missense probably damaging 1.00
R5696:Fam214a UTSW 9 75010117 missense probably benign 0.01
R5891:Fam214a UTSW 9 75004386 missense probably damaging 1.00
R5936:Fam214a UTSW 9 75009304 missense probably benign 0.00
R6165:Fam214a UTSW 9 75025672 missense probably damaging 0.96
R6228:Fam214a UTSW 9 75006363 missense possibly damaging 0.94
R6419:Fam214a UTSW 9 75009337 missense probably benign 0.20
R6631:Fam214a UTSW 9 74953825 missense possibly damaging 0.71
R6649:Fam214a UTSW 9 75010150 missense probably damaging 0.96
R6849:Fam214a UTSW 9 75009312 missense probably damaging 0.96
R7189:Fam214a UTSW 9 75004351 missense probably damaging 0.99
R7402:Fam214a UTSW 9 75006386 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACAGCTTCATACTCGCAGAATG -3'
(R):5'- TTTCCTTTAATGGAGGCCCC -3'

Sequencing Primer
(F):5'- CTCGCAGAATGTAGCTCTTAATGC -3'
(R):5'- CCAAAATGCTCATTCCTGGGG -3'
Posted On2018-06-06