Mutagenetix > Incidental Mutation

Incidental Mutation 'R6499:Ptprt'

519615

Institutional Source

Beutler Lab

Gene Symbol

Ptprt

Ensembl Gene

ENSMUSG00000053141

Gene Name

protein tyrosine phosphatase, receptor type, T

Synonyms

RPTPrho

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.101) question?

Stock #

R6499 (G1)

Quality Score

126.008

Status

Validated

Chromosome

Chromosomal Location

161521990-162661147 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 161534587 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 1298 (M1298T)

Ref Sequence

ENSEMBL: ENSMUSP00000105068 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109441] [ENSMUST00000109442] [ENSMUST00000109443] [ENSMUST00000109445]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000109441
AA Change: M1299T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000105067
Gene: ENSMUSG00000053141
AA Change: M1299T

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
MAM	31	195	2.21e-71	SMART
IG	202	290	3.94e-2	SMART
FN3	292	375	3.35e-3	SMART
FN3	388	477	4.06e-2	SMART
FN3	489	579	1.2e-4	SMART
transmembrane domain	753	772	N/A	INTRINSIC
PTPc	882	1159	3.64e-129	SMART
PTPc	1188	1453	4.24e-98	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000109442
AA Change: M1298T

PolyPhen 2 Score 0.321 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000105068
Gene: ENSMUSG00000053141
AA Change: M1298T

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
MAM	31	195	2.21e-71	SMART
IG	202	290	3.94e-2	SMART
FN3	292	375	3.35e-3	SMART
FN3	388	477	4.06e-2	SMART
FN3	489	579	1.2e-4	SMART
low complexity region	738	749	N/A	INTRINSIC
transmembrane domain	772	791	N/A	INTRINSIC
PTPc	901	1158	5.56e-134	SMART
PTPc	1187	1452	4.24e-98	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000109443
AA Change: M1289T

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000105069
Gene: ENSMUSG00000053141
AA Change: M1289T

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
MAM	31	195	2.21e-71	SMART
IG	202	290	3.94e-2	SMART
FN3	292	375	3.35e-3	SMART
FN3	388	477	4.06e-2	SMART
FN3	489	579	1.2e-4	SMART
low complexity region	778	792	N/A	INTRINSIC
PTPc	892	1149	5.56e-134	SMART
PTPc	1178	1443	4.24e-98	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000109445
AA Change: M1279T

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000105071
Gene: ENSMUSG00000053141
AA Change: M1279T

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
MAM	31	195	2.21e-71	SMART
IG	202	290	3.94e-2	SMART
FN3	292	375	3.35e-3	SMART
FN3	388	477	4.06e-2	SMART
FN3	489	579	1.2e-4	SMART
transmembrane domain	753	772	N/A	INTRINSIC
PTPc	882	1139	5.56e-134	SMART
PTPc	1168	1433	4.24e-98	SMART

Meta Mutation Damage Score

0.0664

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.7%

Validation Efficiency

98% (43/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. The protein domain structure and the expression pattern of the mouse counterpart of this PTP suggest its roles in both signal transduction and cellular adhesion in the central nervous system. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are highly susceptible to carcinogen azoxymethane-induced colon tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	C	T	3: 138,068,800	T1250M	probably damaging	Het
Actn1	C	T	12: 80,168,417	A857T	possibly damaging	Het
Adam2	C	T	14: 66,058,790	V207I	probably damaging	Het
Angpt2	T	C	8: 18,694,517	T404A	probably benign	Het
Ank3	T	C	10: 69,991,744		probably benign	Het
B4galt4	T	A	16: 38,757,822	D210E	probably benign	Het
Brinp3	A	T	1: 146,901,693	H626L	possibly damaging	Het
Ccna2	T	G	3: 36,570,963	D68A	probably damaging	Het
Cd163	G	A	6: 124,304,744	G2D	probably benign	Het
Chrm5	A	T	2: 112,480,480	V97D	probably benign	Het
Dctn5	G	A	7: 122,135,097	V55I	probably benign	Het
Dnm3	A	T	1: 162,313,595	I365N	probably damaging	Het
Esyt2	A	G	12: 116,321,170	D184G	probably damaging	Het
Fam214a	C	A	9: 75,023,648	Q958K	probably damaging	Het
Ifi214	C	A	1: 173,525,031	K277N	probably damaging	Het
Il11ra1	C	T	4: 41,765,412	P169L	probably benign	Het
Inhbb	C	T	1: 119,417,339	E407K	probably damaging	Het
Lama2	T	A	10: 27,031,158	T2336S	probably damaging	Het
Ldhb	A	T	6: 142,494,121	V231E	possibly damaging	Het
Lrit2	T	C	14: 37,068,810	F149L	probably damaging	Het
Malrd1	T	A	2: 15,931,689	S1575T	probably benign	Het
Naip5	A	G	13: 100,221,594	C1045R	probably benign	Het
Nefl	A	G	14: 68,084,585	E208G	probably damaging	Het
Olfr20	T	A	11: 73,354,185	L144Q	probably damaging	Het
Olfr507	G	T	7: 108,622,506	M231I	probably benign	Het
Olfr812	T	C	10: 129,842,584	I153V	probably benign	Het
Olfr859	A	G	9: 19,808,551	I78V	probably benign	Het
Oog4	A	C	4: 143,437,978	S328A	probably damaging	Het
Pbrm1	A	G	14: 31,061,509	N528D	probably damaging	Het
Pls1	A	G	9: 95,754,745	I558T	probably damaging	Het
Polq	T	C	16: 37,060,827	S839P	probably benign	Het
Psmg1	A	G	16: 95,988,097	F87L	probably damaging	Het
Rbm27	T	A	18: 42,337,011	W958R	probably damaging	Het
Skint5	T	G	4: 113,539,355	D1207A	unknown	Het
Stx17	T	A	4: 48,183,478		probably null	Het
Tas2r114	A	T	6: 131,689,136	*310R	probably null	Het
Tmem130	T	A	5: 144,752,414	N139I	probably damaging	Het
Trpc1	T	C	9: 95,726,437	E267G	probably damaging	Het
Trrap	T	A	5: 144,857,002	M3398K	probably damaging	Het
Vrtn	T	G	12: 84,650,316	D613E	probably benign	Het
Vsx1	G	T	2: 150,688,521	T147K	probably benign	Het
Wdr55	T	C	18: 36,762,178	V103A	probably benign	Het
Zfp712	A	T	13: 67,052,336	D28E	probably benign	Het

Other mutations in Ptprt

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Ptprt	APN	2	161810624	missense	probably benign	0.00
IGL00565:Ptprt	APN	2	161560191	missense	probably damaging	1.00
IGL00925:Ptprt	APN	2	161656163	missense	possibly damaging	0.52
IGL01344:Ptprt	APN	2	161551817	missense	probably damaging	1.00
IGL01432:Ptprt	APN	2	162268079	splice site	probably benign
IGL02008:Ptprt	APN	2	161927673	missense	probably benign	0.02
IGL02040:Ptprt	APN	2	162238072	missense	probably damaging	1.00
IGL02172:Ptprt	APN	2	161555502	missense	probably damaging	1.00
IGL02231:Ptprt	APN	2	162238060	missense	probably damaging	1.00
IGL02231:Ptprt	APN	2	162278046	critical splice donor site	probably null
IGL02232:Ptprt	APN	2	161530517	missense	probably damaging	0.96
IGL02277:Ptprt	APN	2	161547381	missense	probably damaging	1.00
IGL02447:Ptprt	APN	2	162278107	missense	probably benign	0.01
IGL02601:Ptprt	APN	2	161766307	missense	probably benign	0.10
IGL02623:Ptprt	APN	2	161607452	splice site	probably benign
IGL03379:Ptprt	APN	2	161555459	nonsense	probably null
Poverina	UTSW	2	161901497	missense	possibly damaging	0.70
IGL03055:Ptprt	UTSW	2	161533613	missense	probably damaging	0.96
R0064:Ptprt	UTSW	2	161927791	splice site	probably benign
R0129:Ptprt	UTSW	2	162278070	missense	probably benign	0.35
R0131:Ptprt	UTSW	2	162278110	missense	probably benign	0.00
R0131:Ptprt	UTSW	2	162278110	missense	probably benign	0.00
R0132:Ptprt	UTSW	2	162278110	missense	probably benign	0.00
R0316:Ptprt	UTSW	2	161607319	missense	probably damaging	1.00
R0454:Ptprt	UTSW	2	161553822	missense	probably damaging	0.96
R0488:Ptprt	UTSW	2	161553825	missense	probably damaging	0.99
R0573:Ptprt	UTSW	2	161551748	missense	probably damaging	1.00
R0614:Ptprt	UTSW	2	161812120	missense	possibly damaging	0.59
R0834:Ptprt	UTSW	2	161812139	splice site	probably null
R1023:Ptprt	UTSW	2	161558943	missense	probably damaging	1.00
R1184:Ptprt	UTSW	2	161927772	missense	possibly damaging	0.82
R1253:Ptprt	UTSW	2	162278226	missense	probably damaging	1.00
R1476:Ptprt	UTSW	2	161927484	missense	probably damaging	1.00
R1515:Ptprt	UTSW	2	162238034	missense	probably damaging	1.00
R1595:Ptprt	UTSW	2	161810549	critical splice donor site	probably null
R1939:Ptprt	UTSW	2	161927640	missense	probably benign	0.45
R1987:Ptprt	UTSW	2	161558898	missense	probably damaging	1.00
R1987:Ptprt	UTSW	2	161766321	missense	possibly damaging	0.48
R2049:Ptprt	UTSW	2	161534545	missense	probably damaging	1.00
R2140:Ptprt	UTSW	2	161811988	missense	probably damaging	1.00
R2421:Ptprt	UTSW	2	162278040	splice site	probably benign
R3432:Ptprt	UTSW	2	161927529	missense	probably damaging	1.00
R3619:Ptprt	UTSW	2	161566157	missense	probably damaging	1.00
R3757:Ptprt	UTSW	2	161812030	missense	probably damaging	1.00
R3758:Ptprt	UTSW	2	161812030	missense	probably damaging	1.00
R3834:Ptprt	UTSW	2	161547387	missense	probably damaging	1.00
R3835:Ptprt	UTSW	2	161547387	missense	probably damaging	1.00
R3915:Ptprt	UTSW	2	161555555	splice site	probably benign
R4003:Ptprt	UTSW	2	161566117	splice site	probably benign
R4387:Ptprt	UTSW	2	161927650	missense	probably damaging	1.00
R4519:Ptprt	UTSW	2	161564689	missense	probably damaging	1.00
R4618:Ptprt	UTSW	2	161553845	missense	probably damaging	1.00
R4677:Ptprt	UTSW	2	161901446	critical splice donor site	probably null
R4866:Ptprt	UTSW	2	161560239	missense	probably damaging	1.00
R5088:Ptprt	UTSW	2	162238175	missense	probably benign	0.01
R5173:Ptprt	UTSW	2	161927756	missense	probably benign	0.01
R5215:Ptprt	UTSW	2	162278164	missense	probably damaging	1.00
R5383:Ptprt	UTSW	2	161698049	missense	probably damaging	1.00
R5398:Ptprt	UTSW	2	161927592	missense	probably damaging	1.00
R5518:Ptprt	UTSW	2	162278223	missense	probably damaging	0.99
R5711:Ptprt	UTSW	2	161810604	missense	probably damaging	0.98
R5735:Ptprt	UTSW	2	161534564	missense	probably damaging	0.98
R5834:Ptprt	UTSW	2	161560269	missense	probably damaging	1.00
R5872:Ptprt	UTSW	2	162135218	missense	probably damaging	1.00
R5926:Ptprt	UTSW	2	161564686	missense	probably benign	0.00
R6210:Ptprt	UTSW	2	162268029	missense	probably damaging	1.00
R6285:Ptprt	UTSW	2	161901497	missense	possibly damaging	0.70
R6298:Ptprt	UTSW	2	161553859	missense	probably damaging	1.00
R6406:Ptprt	UTSW	2	161553783	missense	probably damaging	0.98
R6613:Ptprt	UTSW	2	161530447	missense	probably damaging	1.00
R6622:Ptprt	UTSW	2	161553840	missense	probably damaging	1.00
R7218:Ptprt	UTSW	2	161547364	missense	probably damaging	1.00
R7247:Ptprt	UTSW	2	161533523	missense	probably benign	0.15
R7576:Ptprt	UTSW	2	161607305	missense	possibly damaging	0.88
R7733:Ptprt	UTSW	2	161575787	missense	probably damaging	1.00
R7735:Ptprt	UTSW	2	161575741	missense	probably damaging	1.00
R7813:Ptprt	UTSW	2	161530493	missense	probably damaging	1.00
R8031:Ptprt	UTSW	2	162135457	missense	probably damaging	1.00
R8074:Ptprt	UTSW	2	161927661	missense	possibly damaging	0.77
R8151:Ptprt	UTSW	2	162278085	missense	probably damaging	1.00
R8236:Ptprt	UTSW	2	161687068	critical splice donor site	probably null
R8308:Ptprt	UTSW	2	161927646	missense	probably benign	0.00
R8348:Ptprt	UTSW	2	161558886	missense	probably damaging	1.00
R8362:Ptprt	UTSW	2	161551747	missense	probably damaging	1.00
R8365:Ptprt	UTSW	2	161901531	missense	probably benign	0.05
R8448:Ptprt	UTSW	2	161558886	missense	probably damaging	1.00
R8512:Ptprt	UTSW	2	161558863	missense	probably benign	0.00
R8715:Ptprt	UTSW	2	161530543	missense	probably damaging	1.00
R9004:Ptprt	UTSW	2	161766394	missense	probably benign	0.04
R9046:Ptprt	UTSW	2	161530441	missense	possibly damaging	0.58
R9222:Ptprt	UTSW	2	161560186	missense	probably damaging	1.00
R9297:Ptprt	UTSW	2	161575778	missense	probably benign
R9318:Ptprt	UTSW	2	161575778	missense	probably benign
R9476:Ptprt	UTSW	2	161555461	missense	probably damaging	1.00
R9510:Ptprt	UTSW	2	161555461	missense	probably damaging	1.00
R9571:Ptprt	UTSW	2	161553812	missense	probably benign	0.10
X0064:Ptprt	UTSW	2	161927483	missense	probably damaging	1.00
Z1088:Ptprt	UTSW	2	162238121	missense	possibly damaging	0.86
Z1177:Ptprt	UTSW	2	161732887	missense	probably damaging	1.00
Z1177:Ptprt	UTSW	2	162362948	missense	possibly damaging	0.77

Predicted Primers

PCR Primer
(F):5'- CAGACTCTTGGCGGTCTTAG -3'
(R):5'- CTGCCTCTATGCTCAAAGAGTTTAAC -3'

Sequencing Primer
(F):5'- CGGTCTTAGTGGGATCCTCTC -3'
(R):5'- CACGTGTCCTGCTCATAA -3'

Posted On

2018-06-06