Incidental Mutation 'R6657:Tmem262'
ID 526690
Institutional Source Beutler Lab
Gene Symbol Tmem262
Ensembl Gene ENSMUSG00000047733
Gene Name transmembrane protein 262
Synonyms BC048609
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock # R6657 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 6080033-6080788 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 6080512 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 89 (T89A)
Ref Sequence ENSEMBL: ENSMUSP00000121339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025704] [ENSMUST00000025707] [ENSMUST00000025711] [ENSMUST00000143303] [ENSMUST00000149347] [ENSMUST00000159832] [ENSMUST00000159859] [ENSMUST00000160233] [ENSMUST00000160590] [ENSMUST00000160712] [ENSMUST00000161548] [ENSMUST00000160977] [ENSMUST00000160448]
AlphaFold D3Z338
Predicted Effect probably benign
Transcript: ENSMUST00000025704
SMART Domains Protein: ENSMUSP00000025704
Gene: ENSMUSG00000024791

DomainStartEndE-ValueType
low complexity region 17 34 N/A INTRINSIC
Pfam:Sororin 88 228 4.1e-31 PFAM
low complexity region 251 264 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000025707
SMART Domains Protein: ENSMUSP00000025707
Gene: ENSMUSG00000024792

DomainStartEndE-ValueType
RING 53 100 1.14e-1 SMART
low complexity region 149 160 N/A INTRINSIC
low complexity region 184 193 N/A INTRINSIC
transmembrane domain 265 287 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000025711
SMART Domains Protein: ENSMUSP00000025711
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:COG2 56 191 2.6e-10 PFAM
Pfam:DUF2450 62 250 2.3e-14 PFAM
Pfam:Vps51 63 149 1.1e-26 PFAM
Pfam:Dor1 75 246 1.8e-19 PFAM
Pfam:Zw10 83 291 2.2e-8 PFAM
Pfam:Sec5 101 275 6.5e-24 PFAM
low complexity region 377 391 N/A INTRINSIC
low complexity region 523 532 N/A INTRINSIC
low complexity region 743 758 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000143303
AA Change: T89A

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121339
Gene: ENSMUSG00000047733
AA Change: T89A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
transmembrane domain 82 99 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149347
SMART Domains Protein: ENSMUSP00000116436
Gene: ENSMUSG00000047733

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159211
Predicted Effect probably benign
Transcript: ENSMUST00000159832
SMART Domains Protein: ENSMUSP00000123994
Gene: ENSMUSG00000024797

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:COG2 56 191 2e-10 PFAM
Pfam:DUF2450 62 250 1.9e-14 PFAM
Pfam:Vps51 63 149 8.3e-27 PFAM
Pfam:Dor1 75 246 1.8e-19 PFAM
Pfam:Sec5 101 275 1.6e-19 PFAM
low complexity region 276 292 N/A INTRINSIC
low complexity region 377 391 N/A INTRINSIC
low complexity region 523 532 N/A INTRINSIC
low complexity region 743 758 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159859
SMART Domains Protein: ENSMUSP00000124857
Gene: ENSMUSG00000024792

DomainStartEndE-ValueType
RING 53 100 1.14e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160131
Predicted Effect probably benign
Transcript: ENSMUST00000160233
SMART Domains Protein: ENSMUSP00000124842
Gene: ENSMUSG00000024797

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160357
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160444
Predicted Effect probably benign
Transcript: ENSMUST00000162374
Predicted Effect probably benign
Transcript: ENSMUST00000160590
SMART Domains Protein: ENSMUSP00000123857
Gene: ENSMUSG00000024797

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:Vps51 63 121 2.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160712
SMART Domains Protein: ENSMUSP00000125085
Gene: ENSMUSG00000024792

DomainStartEndE-ValueType
RING 53 100 1.14e-1 SMART
low complexity region 149 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161548
SMART Domains Protein: ENSMUSP00000125459
Gene: ENSMUSG00000024792

DomainStartEndE-ValueType
RING 53 100 1.14e-1 SMART
low complexity region 149 160 N/A INTRINSIC
low complexity region 184 193 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160977
SMART Domains Protein: ENSMUSP00000125176
Gene: ENSMUSG00000024792

DomainStartEndE-ValueType
RING 53 100 1.14e-1 SMART
low complexity region 149 160 N/A INTRINSIC
low complexity region 184 193 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160519
Predicted Effect probably benign
Transcript: ENSMUST00000160448
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik T G 8: 105,708,818 L36R probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Akr1b7 A C 6: 34,416,200 D106A probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 254 probably null Het
Chst5 C T 8: 111,890,274 R238Q probably benign Het
Cpxm2 T C 7: 132,049,077 Y618C probably damaging Het
Csnk1d T C 11: 120,964,994 E405G possibly damaging Het
Ctsh A T 9: 90,060,502 M37L probably benign Het
Eml5 T G 12: 98,791,405 I1843L probably damaging Het
Ep400 C A 5: 110,693,545 probably benign Het
Fbln2 A G 6: 91,259,750 N749S possibly damaging Het
Gpc5 A G 14: 115,370,198 H404R probably benign Het
Hyal6 A G 6: 24,734,758 D230G possibly damaging Het
Itga5 T C 15: 103,350,795 D735G probably damaging Het
Kansl2 T A 15: 98,524,670 Q339L possibly damaging Het
Lrp4 T A 2: 91,492,053 M1078K probably benign Het
Mmp24 A T 2: 155,798,179 Y143F probably damaging Het
Mroh7 A T 4: 106,702,500 C743* probably null Het
Myh14 T C 7: 44,637,846 N618D probably damaging Het
Myo19 A T 11: 84,897,196 M324L probably benign Het
Nectin2 T C 7: 19,738,140 N108S probably benign Het
Nrg2 A G 18: 36,196,589 I191T probably damaging Het
Odf4 T C 11: 68,926,812 N18D probably benign Het
Olfr1109 T A 2: 87,093,059 I113F probably benign Het
Pcsk2 T G 2: 143,690,366 L145V probably damaging Het
Pdzrn3 C A 6: 101,151,022 Q894H probably benign Het
Pfpl G A 19: 12,429,926 V514I probably benign Het
Plbd1 A T 6: 136,617,252 M333K probably damaging Het
Plec A T 15: 76,178,156 M2554K possibly damaging Het
Psmb5 A G 14: 54,614,383 Y115H possibly damaging Het
Rictor A G 15: 6,759,496 N198D possibly damaging Het
Rsrc2 A G 5: 123,739,567 probably benign Het
Sec16a C T 2: 26,425,864 W262* probably null Het
Sfmbt1 A G 14: 30,766,096 D8G possibly damaging Het
Sptbn5 T G 2: 120,076,400 probably benign Het
Sqor A G 2: 122,807,594 D139G possibly damaging Het
Sugt1 A T 14: 79,607,261 T139S probably benign Het
Tcp11 G A 17: 28,071,672 P159S probably damaging Het
Tnfaip6 C A 2: 52,043,783 T50N probably damaging Het
Ttll9 T C 2: 152,984,262 Y131H probably damaging Het
Vmn1r173 T A 7: 23,702,895 M185K probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r52 G A 7: 10,159,163 T683I probably damaging Het
Vps53 A T 11: 76,134,427 I197N probably damaging Het
Washc4 T A 10: 83,558,618 F269L possibly damaging Het
Wdfy4 C T 14: 33,047,251 V2086M possibly damaging Het
Zfp592 A T 7: 81,025,486 T733S possibly damaging Het
Zfp599 A G 9: 22,250,242 F209S probably damaging Het
Other mutations in Tmem262
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01455:Tmem262 APN 19 6080159 missense probably damaging 0.99
R4789:Tmem262 UTSW 19 6080422 missense possibly damaging 0.94
R6212:Tmem262 UTSW 19 6080638 missense possibly damaging 0.89
R6228:Tmem262 UTSW 19 6080537 splice site probably null
R6919:Tmem262 UTSW 19 6080737 missense probably benign
R8005:Tmem262 UTSW 19 6080477 missense possibly damaging 0.91
R8828:Tmem262 UTSW 19 6080088 intron probably benign
Z1176:Tmem262 UTSW 19 6080121 intron probably benign
Predicted Primers PCR Primer
(F):5'- ACCACATGAGCTTCCGTTAC -3'
(R):5'- TTGATGGCCAGAAACTCCAG -3'

Sequencing Primer
(F):5'- ACACGGTTGTACTGATAGTAGGTC -3'
(R):5'- GAAACTCCAGGCACAGGCG -3'
Posted On 2018-07-23