Incidental Mutation 'R6657:Vps53'
ID 526674
Institutional Source Beutler Lab
Gene Symbol Vps53
Ensembl Gene ENSMUSG00000017288
Gene Name VPS53 GARP complex subunit
Synonyms 2310040I21Rik, 3100002B05Rik, 2010002A08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6657 (G1)
Quality Score 187.009
Status Validated
Chromosome 11
Chromosomal Location 76046226-76179647 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 76134427 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 197 (I197N)
Ref Sequence ENSEMBL: ENSMUSP00000130499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056601] [ENSMUST00000094015] [ENSMUST00000108419] [ENSMUST00000163878] [ENSMUST00000166752] [ENSMUST00000167114] [ENSMUST00000169734] [ENSMUST00000170730]
AlphaFold Q8CCB4
Predicted Effect probably damaging
Transcript: ENSMUST00000056601
AA Change: I197N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061317
Gene: ENSMUSG00000017288
AA Change: I197N

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
Pfam:DUF2450 25 225 5.9e-11 PFAM
Pfam:Vps53_N 39 453 1.9e-176 PFAM
low complexity region 520 533 N/A INTRINSIC
low complexity region 820 832 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000094015
AA Change: I168N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091554
Gene: ENSMUSG00000017288
AA Change: I168N

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
Pfam:Vps53_N 39 96 6.2e-21 PFAM
Pfam:Vps53_N 93 424 1.4e-133 PFAM
low complexity region 491 504 N/A INTRINSIC
low complexity region 791 803 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108419
AA Change: I197N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104057
Gene: ENSMUSG00000017288
AA Change: I197N

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
Pfam:DUF2450 25 224 4e-11 PFAM
Pfam:Vps53_N 39 233 5.2e-87 PFAM
Pfam:Vps53_N 226 276 1.6e-14 PFAM
low complexity region 343 356 N/A INTRINSIC
low complexity region 643 655 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141773
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143459
Predicted Effect probably benign
Transcript: ENSMUST00000163878
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166084
Predicted Effect unknown
Transcript: ENSMUST00000166436
AA Change: I125N
SMART Domains Protein: ENSMUSP00000131387
Gene: ENSMUSG00000017288
AA Change: I125N

DomainStartEndE-ValueType
Pfam:DUF2450 1 155 1.6e-8 PFAM
Pfam:Vps53_N 1 204 6.1e-91 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166752
AA Change: I197N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129159
Gene: ENSMUSG00000017288
AA Change: I197N

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
Pfam:DUF2450 25 225 8.2e-12 PFAM
Pfam:Vps53_N 39 230 6e-87 PFAM
Pfam:Vps53_N 226 405 1.4e-60 PFAM
low complexity region 472 485 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167114
SMART Domains Protein: ENSMUSP00000131663
Gene: ENSMUSG00000017288

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
Pfam:Vps53_N 39 101 1.2e-21 PFAM
Pfam:Vps53_N 104 176 3.1e-15 PFAM
low complexity region 243 256 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169532
Predicted Effect probably damaging
Transcript: ENSMUST00000169734
AA Change: I197N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130499
Gene: ENSMUSG00000017288
AA Change: I197N

DomainStartEndE-ValueType
Pfam:DUF2450 5 225 5.1e-12 PFAM
Pfam:Vps53_N 39 329 1e-137 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170143
Predicted Effect probably benign
Transcript: ENSMUST00000170730
SMART Domains Protein: ENSMUSP00000127364
Gene: ENSMUSG00000017288

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
Pfam:Vps53_N 54 123 3e-34 PFAM
Meta Mutation Damage Score 0.9159 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to the yeast Vps53p protein. Vps53p is involved in retrograde vesicle trafficking in late Golgi. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality prior to E12.5 with trophoblast cell hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik T G 8: 105,708,818 L36R probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Akr1b7 A C 6: 34,416,200 D106A probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 254 probably null Het
Chst5 C T 8: 111,890,274 R238Q probably benign Het
Cpxm2 T C 7: 132,049,077 Y618C probably damaging Het
Csnk1d T C 11: 120,964,994 E405G possibly damaging Het
Ctsh A T 9: 90,060,502 M37L probably benign Het
Eml5 T G 12: 98,791,405 I1843L probably damaging Het
Ep400 C A 5: 110,693,545 probably benign Het
Fbln2 A G 6: 91,259,750 N749S possibly damaging Het
Gpc5 A G 14: 115,370,198 H404R probably benign Het
Hyal6 A G 6: 24,734,758 D230G possibly damaging Het
Itga5 T C 15: 103,350,795 D735G probably damaging Het
Kansl2 T A 15: 98,524,670 Q339L possibly damaging Het
Lrp4 T A 2: 91,492,053 M1078K probably benign Het
Mmp24 A T 2: 155,798,179 Y143F probably damaging Het
Mroh7 A T 4: 106,702,500 C743* probably null Het
Myh14 T C 7: 44,637,846 N618D probably damaging Het
Myo19 A T 11: 84,897,196 M324L probably benign Het
Nectin2 T C 7: 19,738,140 N108S probably benign Het
Nrg2 A G 18: 36,196,589 I191T probably damaging Het
Odf4 T C 11: 68,926,812 N18D probably benign Het
Olfr1109 T A 2: 87,093,059 I113F probably benign Het
Pcsk2 T G 2: 143,690,366 L145V probably damaging Het
Pdzrn3 C A 6: 101,151,022 Q894H probably benign Het
Pfpl G A 19: 12,429,926 V514I probably benign Het
Plbd1 A T 6: 136,617,252 M333K probably damaging Het
Plec A T 15: 76,178,156 M2554K possibly damaging Het
Psmb5 A G 14: 54,614,383 Y115H possibly damaging Het
Rictor A G 15: 6,759,496 N198D possibly damaging Het
Rsrc2 A G 5: 123,739,567 probably benign Het
Sec16a C T 2: 26,425,864 W262* probably null Het
Sfmbt1 A G 14: 30,766,096 D8G possibly damaging Het
Sptbn5 T G 2: 120,076,400 probably benign Het
Sqor A G 2: 122,807,594 D139G possibly damaging Het
Sugt1 A T 14: 79,607,261 T139S probably benign Het
Tcp11 G A 17: 28,071,672 P159S probably damaging Het
Tmem262 A G 19: 6,080,512 T89A possibly damaging Het
Tnfaip6 C A 2: 52,043,783 T50N probably damaging Het
Ttll9 T C 2: 152,984,262 Y131H probably damaging Het
Vmn1r173 T A 7: 23,702,895 M185K probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r52 G A 7: 10,159,163 T683I probably damaging Het
Washc4 T A 10: 83,558,618 F269L possibly damaging Het
Wdfy4 C T 14: 33,047,251 V2086M possibly damaging Het
Zfp592 A T 7: 81,025,486 T733S possibly damaging Het
Zfp599 A G 9: 22,250,242 F209S probably damaging Het
Other mutations in Vps53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Vps53 APN 11 76077035 splice site probably null
IGL01596:Vps53 APN 11 76063037 missense probably damaging 1.00
IGL01655:Vps53 APN 11 76063034 missense probably damaging 0.97
IGL02275:Vps53 APN 11 76047123 missense probably benign 0.03
IGL02321:Vps53 APN 11 76048538 missense possibly damaging 0.60
IGL02581:Vps53 APN 11 76102057 missense probably damaging 0.99
IGL02821:Vps53 APN 11 76136317 splice site probably benign
IGL02958:Vps53 APN 11 76117711 missense probably damaging 1.00
IGL03001:Vps53 APN 11 76138324 missense probably damaging 1.00
PIT4519001:Vps53 UTSW 11 76117173 missense probably damaging 1.00
R0257:Vps53 UTSW 11 76177385 intron probably benign
R0391:Vps53 UTSW 11 76121579 missense probably benign 0.31
R0421:Vps53 UTSW 11 76082670 missense probably damaging 1.00
R0882:Vps53 UTSW 11 76082659 missense probably damaging 1.00
R2509:Vps53 UTSW 11 76066835 missense possibly damaging 0.49
R3622:Vps53 UTSW 11 76117783 missense probably benign 0.00
R5137:Vps53 UTSW 11 76166248 missense probably damaging 1.00
R5338:Vps53 UTSW 11 76081208 missense probably damaging 1.00
R5756:Vps53 UTSW 11 76092330 splice site probably benign
R5786:Vps53 UTSW 11 76063007 missense probably benign 0.08
R5961:Vps53 UTSW 11 76048490 missense probably damaging 1.00
R6059:Vps53 UTSW 11 76066867 missense possibly damaging 0.57
R6273:Vps53 UTSW 11 76102018 missense probably benign 0.16
R6490:Vps53 UTSW 11 76077055 missense probably benign 0.03
R6671:Vps53 UTSW 11 76134506 missense probably damaging 1.00
R6772:Vps53 UTSW 11 76179498 start codon destroyed probably null
R7378:Vps53 UTSW 11 76077074 missense possibly damaging 0.88
R7735:Vps53 UTSW 11 76047136 missense probably damaging 1.00
R8066:Vps53 UTSW 11 76136307 missense probably damaging 1.00
Z1177:Vps53 UTSW 11 76136198 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCAGACAATGGAGAGTTGTGC -3'
(R):5'- GATATCTGGGTCTCGCAAGTC -3'

Sequencing Primer
(F):5'- CACATGAGTGTACTAGTTGACTTG -3'
(R):5'- GTCTCGCAAGTCGTCCCAC -3'
Posted On 2018-07-23