Incidental Mutation 'R6657:Lrp4'
ID 526646
Institutional Source Beutler Lab
Gene Symbol Lrp4
Ensembl Gene ENSMUSG00000027253
Gene Name low density lipoprotein receptor-related protein 4
Synonyms mdig, Megf7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.835) question?
Stock # R6657 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 91457511-91513779 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 91492053 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1078 (M1078K)
Ref Sequence ENSEMBL: ENSMUSP00000028689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028689]
AlphaFold Q8VI56
Predicted Effect probably benign
Transcript: ENSMUST00000028689
AA Change: M1078K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000028689
Gene: ENSMUSG00000027253
AA Change: M1078K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LDLa 26 68 5.77e-10 SMART
LDLa 70 107 4.05e-14 SMART
LDLa 109 145 1.9e-10 SMART
LDLa 147 184 1.51e-13 SMART
LDLa 190 227 6.83e-12 SMART
LDLa 230 267 2.45e-13 SMART
LDLa 269 306 6.32e-16 SMART
LDLa 311 351 3.24e-13 SMART
EGF 357 394 1.4e0 SMART
EGF_CA 395 434 1.05e-8 SMART
LY 460 502 7.01e-10 SMART
LY 503 545 4.41e-16 SMART
LY 546 589 1.04e-12 SMART
LY 590 632 5.07e-16 SMART
LY 633 674 3.12e-7 SMART
EGF 701 737 9.27e-1 SMART
LY 765 807 7.29e-8 SMART
LY 808 850 1.92e-16 SMART
LY 851 894 3.05e-10 SMART
LY 895 937 6.69e-16 SMART
LY 938 979 8.71e-6 SMART
EGF 1005 1044 1.64e-1 SMART
LY 1073 1115 2.58e-8 SMART
LY 1116 1158 1.57e-12 SMART
LY 1159 1202 7.4e-9 SMART
LY 1203 1245 9.39e-11 SMART
LY 1246 1285 6.11e-1 SMART
EGF 1312 1349 1.53e-1 SMART
LY 1377 1419 4.42e-7 SMART
LY 1420 1462 1.04e-12 SMART
LY 1463 1506 2.11e-13 SMART
LY 1507 1549 4.66e-15 SMART
LY 1550 1590 2.02e-1 SMART
EGF_like 1616 1649 5.79e1 SMART
low complexity region 1674 1690 N/A INTRINSIC
transmembrane domain 1724 1746 N/A INTRINSIC
low complexity region 1857 1870 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low-density lipoprotein receptor-related protein family. The encoded protein may be a regulator of Wnt signaling. Mutations in this gene are associated with Cenani-Lenz syndrome. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutations of this gene cause polysyndactyly. Additional phenotypes may include growth retardation, abnormal incisor development, kidney agenesis, and neonatal lethality associated with respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik T G 8: 105,708,818 L36R probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Akr1b7 A C 6: 34,416,200 D106A probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 254 probably null Het
Chst5 C T 8: 111,890,274 R238Q probably benign Het
Cpxm2 T C 7: 132,049,077 Y618C probably damaging Het
Csnk1d T C 11: 120,964,994 E405G possibly damaging Het
Ctsh A T 9: 90,060,502 M37L probably benign Het
Eml5 T G 12: 98,791,405 I1843L probably damaging Het
Ep400 C A 5: 110,693,545 probably benign Het
Fbln2 A G 6: 91,259,750 N749S possibly damaging Het
Gpc5 A G 14: 115,370,198 H404R probably benign Het
Hyal6 A G 6: 24,734,758 D230G possibly damaging Het
Itga5 T C 15: 103,350,795 D735G probably damaging Het
Kansl2 T A 15: 98,524,670 Q339L possibly damaging Het
Mmp24 A T 2: 155,798,179 Y143F probably damaging Het
Mroh7 A T 4: 106,702,500 C743* probably null Het
Myh14 T C 7: 44,637,846 N618D probably damaging Het
Myo19 A T 11: 84,897,196 M324L probably benign Het
Nectin2 T C 7: 19,738,140 N108S probably benign Het
Nrg2 A G 18: 36,196,589 I191T probably damaging Het
Odf4 T C 11: 68,926,812 N18D probably benign Het
Olfr1109 T A 2: 87,093,059 I113F probably benign Het
Pcsk2 T G 2: 143,690,366 L145V probably damaging Het
Pdzrn3 C A 6: 101,151,022 Q894H probably benign Het
Pfpl G A 19: 12,429,926 V514I probably benign Het
Plbd1 A T 6: 136,617,252 M333K probably damaging Het
Plec A T 15: 76,178,156 M2554K possibly damaging Het
Psmb5 A G 14: 54,614,383 Y115H possibly damaging Het
Rictor A G 15: 6,759,496 N198D possibly damaging Het
Rsrc2 A G 5: 123,739,567 probably benign Het
Sec16a C T 2: 26,425,864 W262* probably null Het
Sfmbt1 A G 14: 30,766,096 D8G possibly damaging Het
Sptbn5 T G 2: 120,076,400 probably benign Het
Sqor A G 2: 122,807,594 D139G possibly damaging Het
Sugt1 A T 14: 79,607,261 T139S probably benign Het
Tcp11 G A 17: 28,071,672 P159S probably damaging Het
Tmem262 A G 19: 6,080,512 T89A possibly damaging Het
Tnfaip6 C A 2: 52,043,783 T50N probably damaging Het
Ttll9 T C 2: 152,984,262 Y131H probably damaging Het
Vmn1r173 T A 7: 23,702,895 M185K probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r52 G A 7: 10,159,163 T683I probably damaging Het
Vps53 A T 11: 76,134,427 I197N probably damaging Het
Washc4 T A 10: 83,558,618 F269L possibly damaging Het
Wdfy4 C T 14: 33,047,251 V2086M possibly damaging Het
Zfp592 A T 7: 81,025,486 T733S possibly damaging Het
Zfp599 A G 9: 22,250,242 F209S probably damaging Het
Other mutations in Lrp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Lrp4 APN 2 91495026 missense probably benign
IGL00509:Lrp4 APN 2 91486174 splice site probably benign
IGL01145:Lrp4 APN 2 91487051 missense probably damaging 1.00
IGL01287:Lrp4 APN 2 91473948 missense probably damaging 1.00
IGL01531:Lrp4 APN 2 91511553 missense probably damaging 1.00
IGL01534:Lrp4 APN 2 91473641 missense probably damaging 1.00
IGL01544:Lrp4 APN 2 91477551 missense probably damaging 1.00
IGL01761:Lrp4 APN 2 91481981 critical splice donor site probably null
IGL01885:Lrp4 APN 2 91501107 missense probably benign 0.05
IGL01909:Lrp4 APN 2 91494184 missense possibly damaging 0.50
IGL02111:Lrp4 APN 2 91506059 missense probably damaging 1.00
IGL02385:Lrp4 APN 2 91474720 missense possibly damaging 0.89
IGL02403:Lrp4 APN 2 91508582 missense probably benign 0.05
IGL02431:Lrp4 APN 2 91476637 missense possibly damaging 0.95
IGL02452:Lrp4 APN 2 91474002 missense probably damaging 1.00
IGL02798:Lrp4 APN 2 91476710 missense probably benign 0.02
IGL02828:Lrp4 APN 2 91475294 missense probably benign
IGL02832:Lrp4 APN 2 91511580 missense probably damaging 1.00
IGL02893:Lrp4 APN 2 91474816 missense possibly damaging 0.76
F5770:Lrp4 UTSW 2 91488518 missense possibly damaging 0.96
R0037:Lrp4 UTSW 2 91471203 missense probably benign 0.22
R0037:Lrp4 UTSW 2 91471203 missense probably benign 0.22
R0137:Lrp4 UTSW 2 91494982 missense probably damaging 1.00
R0265:Lrp4 UTSW 2 91490670 missense probably damaging 1.00
R0368:Lrp4 UTSW 2 91477734 missense probably damaging 0.99
R0531:Lrp4 UTSW 2 91475178 splice site probably benign
R0827:Lrp4 UTSW 2 91495041 missense probably damaging 1.00
R1029:Lrp4 UTSW 2 91487027 splice site probably benign
R1183:Lrp4 UTSW 2 91477519 critical splice acceptor site probably null
R1587:Lrp4 UTSW 2 91476305 missense probably benign 0.26
R1693:Lrp4 UTSW 2 91492353 missense probably damaging 1.00
R1747:Lrp4 UTSW 2 91492621 missense probably damaging 0.98
R1863:Lrp4 UTSW 2 91498363 missense probably benign 0.15
R1908:Lrp4 UTSW 2 91498408 missense possibly damaging 0.93
R1909:Lrp4 UTSW 2 91498408 missense possibly damaging 0.93
R1932:Lrp4 UTSW 2 91497355 nonsense probably null
R1934:Lrp4 UTSW 2 91480432 missense probably damaging 1.00
R2358:Lrp4 UTSW 2 91501954 missense probably benign 0.01
R2433:Lrp4 UTSW 2 91506015 missense probably benign 0.00
R2698:Lrp4 UTSW 2 91475212 missense probably damaging 0.99
R2919:Lrp4 UTSW 2 91490730 missense probably benign 0.01
R3105:Lrp4 UTSW 2 91501049 missense probably benign
R3709:Lrp4 UTSW 2 91490466 missense possibly damaging 0.60
R3711:Lrp4 UTSW 2 91501954 missense probably benign 0.01
R3735:Lrp4 UTSW 2 91498371 missense probably damaging 1.00
R3808:Lrp4 UTSW 2 91476702 missense probably damaging 0.99
R3894:Lrp4 UTSW 2 91473949 missense probably damaging 1.00
R3895:Lrp4 UTSW 2 91473949 missense probably damaging 1.00
R4397:Lrp4 UTSW 2 91511670 missense probably benign 0.20
R4741:Lrp4 UTSW 2 91511567 missense probably damaging 1.00
R4948:Lrp4 UTSW 2 91485886 missense probably benign
R5050:Lrp4 UTSW 2 91492422 missense probably benign 0.22
R5096:Lrp4 UTSW 2 91485792 missense possibly damaging 0.65
R5110:Lrp4 UTSW 2 91497072 missense possibly damaging 0.48
R5141:Lrp4 UTSW 2 91478678 splice site probably benign
R5439:Lrp4 UTSW 2 91497073 missense probably benign 0.14
R5725:Lrp4 UTSW 2 91494895 missense probably damaging 1.00
R5795:Lrp4 UTSW 2 91474471 missense probably benign 0.01
R5820:Lrp4 UTSW 2 91492615 missense probably damaging 0.99
R5883:Lrp4 UTSW 2 91488433 missense probably benign 0.01
R5919:Lrp4 UTSW 2 91473207 missense probably damaging 1.00
R5925:Lrp4 UTSW 2 91511684 missense probably benign 0.01
R6080:Lrp4 UTSW 2 91502000 missense probably benign
R6189:Lrp4 UTSW 2 91475234 missense possibly damaging 0.63
R6192:Lrp4 UTSW 2 91508488 missense probably benign 0.00
R6319:Lrp4 UTSW 2 91480321 missense probably damaging 1.00
R6378:Lrp4 UTSW 2 91493829 missense probably benign 0.18
R6479:Lrp4 UTSW 2 91487084 missense probably damaging 0.96
R6500:Lrp4 UTSW 2 91492420 missense possibly damaging 0.90
R6643:Lrp4 UTSW 2 91501995 missense probably benign
R6696:Lrp4 UTSW 2 91497345 missense probably benign 0.03
R6714:Lrp4 UTSW 2 91476365 missense possibly damaging 0.90
R6734:Lrp4 UTSW 2 91485897 missense possibly damaging 0.79
R6770:Lrp4 UTSW 2 91497303 missense probably benign 0.33
R6774:Lrp4 UTSW 2 91511504 missense probably benign 0.01
R6957:Lrp4 UTSW 2 91487042 missense probably damaging 0.99
R6978:Lrp4 UTSW 2 91491998 missense probably damaging 1.00
R7065:Lrp4 UTSW 2 91511580 missense probably damaging 1.00
R7142:Lrp4 UTSW 2 91494994 missense probably damaging 0.99
R7219:Lrp4 UTSW 2 91492023 missense probably damaging 1.00
R7237:Lrp4 UTSW 2 91473183 missense probably benign 0.04
R7387:Lrp4 UTSW 2 91476614 missense probably benign
R7585:Lrp4 UTSW 2 91492588 missense probably damaging 1.00
R7835:Lrp4 UTSW 2 91495042 missense possibly damaging 0.82
R7872:Lrp4 UTSW 2 91490716 missense possibly damaging 0.54
R7968:Lrp4 UTSW 2 91494079 missense possibly damaging 0.74
R8222:Lrp4 UTSW 2 91474741 missense probably damaging 1.00
R8338:Lrp4 UTSW 2 91492368 missense probably benign 0.15
R8342:Lrp4 UTSW 2 91488445 missense probably damaging 1.00
R8435:Lrp4 UTSW 2 91477653 missense probably damaging 1.00
R8720:Lrp4 UTSW 2 91494114 missense probably damaging 1.00
R8774:Lrp4 UTSW 2 91477698 missense probably benign 0.09
R8774-TAIL:Lrp4 UTSW 2 91477698 missense probably benign 0.09
R8792:Lrp4 UTSW 2 91494955 missense possibly damaging 0.71
R8913:Lrp4 UTSW 2 91501440 missense probably benign 0.11
R9017:Lrp4 UTSW 2 91494052 missense possibly damaging 0.51
R9062:Lrp4 UTSW 2 91473580 missense possibly damaging 0.46
R9118:Lrp4 UTSW 2 91478582 missense possibly damaging 0.91
V7580:Lrp4 UTSW 2 91488518 missense possibly damaging 0.96
V7581:Lrp4 UTSW 2 91488518 missense possibly damaging 0.96
V7582:Lrp4 UTSW 2 91488518 missense possibly damaging 0.96
V7583:Lrp4 UTSW 2 91488518 missense possibly damaging 0.96
X0021:Lrp4 UTSW 2 91501062 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- AGTATTGGACTTCAGTTAGCCTG -3'
(R):5'- CACAACTGACTCAGAGCCTG -3'

Sequencing Primer
(F):5'- GGACTTCAGTTAGCCTGCCTCC -3'
(R):5'- TCAGAGCCTGAGACACTGG -3'
Posted On 2018-07-23