Mutagenetix > Incidental Mutation

Incidental Mutation 'R6657:Zfp592'

526666

Institutional Source

Beutler Lab

Gene Symbol

Zfp592

Ensembl Gene

ENSMUSG00000005621

Gene Name

zinc finger protein 592

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.920) question?

Stock #

R6657 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

80993681-81045164 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 81025486 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 733 (T733S)

Ref Sequence

ENSEMBL: ENSMUSP00000102976 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107353]

AlphaFold

Q8BHZ4

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107353
AA Change: T733S

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000102976
Gene: ENSMUSG00000005621
AA Change: T733S

Domain	Start	End	E-Value	Type
low complexity region	170	180	N/A	INTRINSIC
low complexity region	200	211	N/A	INTRINSIC
low complexity region	314	333	N/A	INTRINSIC
low complexity region	343	369	N/A	INTRINSIC
low complexity region	484	500	N/A	INTRINSIC
low complexity region	514	525	N/A	INTRINSIC
ZnF_C2H2	587	612	8.98e0	SMART
ZnF_C2H2	615	639	2.61e1	SMART
low complexity region	664	686	N/A	INTRINSIC
ZnF_C2H2	711	731	1.24e2	SMART
ZnF_C2H2	740	762	2.82e0	SMART
ZnF_C2H2	768	792	4.99e1	SMART
ZnF_C2H2	799	822	1.73e0	SMART
ZnF_C2H2	827	850	7.89e0	SMART
ZnF_C2H2	892	915	3.89e-3	SMART
low complexity region	924	935	N/A	INTRINSIC
low complexity region	965	979	N/A	INTRINSIC
ZnF_C2H2	983	1006	4.11e-2	SMART
ZnF_C2H2	1013	1036	7.37e-4	SMART
ZnF_C2H2	1043	1069	7.68e0	SMART
ZnF_C2H2	1124	1146	1.51e0	SMART
ZnF_C2H2	1153	1176	1.23e0	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176477

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.9%
20x: 94.0%

Validation Efficiency

98% (48/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to play a role in a complex developmental pathway and the regulation of genes involved in cerebellar development. Mutations in this gene have been associated with autosomal recessive spinocerebellar ataxia. [provided by RefSeq, Jan 2011]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933405L10Rik	T	G	8: 105,708,818	L36R	probably damaging	Het
Akr1b3	C	T	6: 34,310,004	V206M	possibly damaging	Het
Akr1b7	A	C	6: 34,416,200	D106A	probably damaging	Het
Bhlhe40	TG	TGG	6: 108,664,857	254	probably null	Het
Chst5	C	T	8: 111,890,274	R238Q	probably benign	Het
Cpxm2	T	C	7: 132,049,077	Y618C	probably damaging	Het
Csnk1d	T	C	11: 120,964,994	E405G	possibly damaging	Het
Ctsh	A	T	9: 90,060,502	M37L	probably benign	Het
Eml5	T	G	12: 98,791,405	I1843L	probably damaging	Het
Ep400	C	A	5: 110,693,545		probably benign	Het
Fbln2	A	G	6: 91,259,750	N749S	possibly damaging	Het
Gpc5	A	G	14: 115,370,198	H404R	probably benign	Het
Hyal6	A	G	6: 24,734,758	D230G	possibly damaging	Het
Itga5	T	C	15: 103,350,795	D735G	probably damaging	Het
Kansl2	T	A	15: 98,524,670	Q339L	possibly damaging	Het
Lrp4	T	A	2: 91,492,053	M1078K	probably benign	Het
Mmp24	A	T	2: 155,798,179	Y143F	probably damaging	Het
Mroh7	A	T	4: 106,702,500	C743*	probably null	Het
Myh14	T	C	7: 44,637,846	N618D	probably damaging	Het
Myo19	A	T	11: 84,897,196	M324L	probably benign	Het
Nectin2	T	C	7: 19,738,140	N108S	probably benign	Het
Nrg2	A	G	18: 36,196,589	I191T	probably damaging	Het
Odf4	T	C	11: 68,926,812	N18D	probably benign	Het
Olfr1109	T	A	2: 87,093,059	I113F	probably benign	Het
Pcsk2	T	G	2: 143,690,366	L145V	probably damaging	Het
Pdzrn3	C	A	6: 101,151,022	Q894H	probably benign	Het
Pfpl	G	A	19: 12,429,926	V514I	probably benign	Het
Plbd1	A	T	6: 136,617,252	M333K	probably damaging	Het
Plec	A	T	15: 76,178,156	M2554K	possibly damaging	Het
Psmb5	A	G	14: 54,614,383	Y115H	possibly damaging	Het
Rictor	A	G	15: 6,759,496	N198D	possibly damaging	Het
Rsrc2	A	G	5: 123,739,567		probably benign	Het
Sec16a	C	T	2: 26,425,864	W262*	probably null	Het
Sfmbt1	A	G	14: 30,766,096	D8G	possibly damaging	Het
Sptbn5	T	G	2: 120,076,400		probably benign	Het
Sqor	A	G	2: 122,807,594	D139G	possibly damaging	Het
Sugt1	A	T	14: 79,607,261	T139S	probably benign	Het
Tcp11	G	A	17: 28,071,672	P159S	probably damaging	Het
Tmem262	A	G	19: 6,080,512	T89A	possibly damaging	Het
Tnfaip6	C	A	2: 52,043,783	T50N	probably damaging	Het
Ttll9	T	C	2: 152,984,262	Y131H	probably damaging	Het
Vmn1r173	T	A	7: 23,702,895	M185K	probably damaging	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Vmn2r52	G	A	7: 10,159,163	T683I	probably damaging	Het
Vps53	A	T	11: 76,134,427	I197N	probably damaging	Het
Washc4	T	A	10: 83,558,618	F269L	possibly damaging	Het
Wdfy4	C	T	14: 33,047,251	V2086M	possibly damaging	Het
Zfp599	A	G	9: 22,250,242	F209S	probably damaging	Het

Other mutations in Zfp592

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01331:Zfp592	APN	7	81041548	nonsense	probably null
IGL01984:Zfp592	APN	7	81038644	missense	probably benign	0.00
IGL02079:Zfp592	APN	7	81039230	missense	probably benign	0.20
IGL02096:Zfp592	APN	7	81025048	missense	probably damaging	1.00
IGL02125:Zfp592	APN	7	81038184	missense	probably benign	0.00
IGL02374:Zfp592	APN	7	81024983	missense	probably damaging	1.00
IGL02419:Zfp592	APN	7	81038245	missense	probably damaging	1.00
IGL02466:Zfp592	APN	7	81023998	missense	probably damaging	1.00
IGL02485:Zfp592	APN	7	81037970	splice site	probably benign
IGL02500:Zfp592	APN	7	81041726	missense	probably benign
IGL02876:Zfp592	APN	7	81038127	missense	probably benign	0.01
IGL02940:Zfp592	APN	7	81024827	missense	probably damaging	1.00
R0326:Zfp592	UTSW	7	81024889	missense	possibly damaging	0.83
R0634:Zfp592	UTSW	7	81038071	missense	probably damaging	1.00
R0684:Zfp592	UTSW	7	81037875	missense	probably benign	0.00
R0750:Zfp592	UTSW	7	81024745	missense	probably benign
R1346:Zfp592	UTSW	7	81038064	missense	possibly damaging	0.54
R1457:Zfp592	UTSW	7	81024479	missense	probably damaging	0.99
R1650:Zfp592	UTSW	7	81038100	missense	probably benign	0.04
R1804:Zfp592	UTSW	7	81023695	missense	probably damaging	1.00
R1918:Zfp592	UTSW	7	81037420	nonsense	probably null
R2114:Zfp592	UTSW	7	81024796	missense	probably damaging	1.00
R2144:Zfp592	UTSW	7	81038202	missense	probably benign	0.01
R2164:Zfp592	UTSW	7	81041438	missense	possibly damaging	0.87
R2246:Zfp592	UTSW	7	81041613	missense	possibly damaging	0.91
R3701:Zfp592	UTSW	7	81037411	nonsense	probably null
R3809:Zfp592	UTSW	7	81024532	missense	probably benign	0.00
R4574:Zfp592	UTSW	7	81023786	missense	possibly damaging	0.87
R4866:Zfp592	UTSW	7	81041859	missense	probably damaging	1.00
R5023:Zfp592	UTSW	7	81024347	missense	probably damaging	1.00
R5121:Zfp592	UTSW	7	81023561	missense	probably damaging	1.00
R5174:Zfp592	UTSW	7	81038325	missense	probably damaging	1.00
R5794:Zfp592	UTSW	7	81025033	missense	probably benign	0.00
R5946:Zfp592	UTSW	7	81037897	missense	possibly damaging	0.95
R6312:Zfp592	UTSW	7	81023436	missense	probably benign	0.05
R6814:Zfp592	UTSW	7	81023828	missense	probably benign	0.02
R6872:Zfp592	UTSW	7	81023828	missense	probably benign	0.02
R7056:Zfp592	UTSW	7	81023319	missense	probably damaging	1.00
R7295:Zfp592	UTSW	7	81024322	missense	probably damaging	1.00
R7351:Zfp592	UTSW	7	81041691	missense	probably benign	0.00
R7475:Zfp592	UTSW	7	81023452	missense	probably damaging	0.99
R7509:Zfp592	UTSW	7	81038340	missense	probably damaging	0.99
R7552:Zfp592	UTSW	7	81023642	missense	probably benign	0.01
R7737:Zfp592	UTSW	7	81025193	missense	probably damaging	1.00
R7752:Zfp592	UTSW	7	81024721	missense	probably benign	0.13
R7901:Zfp592	UTSW	7	81024721	missense	probably benign	0.13
R8100:Zfp592	UTSW	7	81024192	missense	probably benign	0.05
R8440:Zfp592	UTSW	7	81041523	missense	possibly damaging	0.89
R8710:Zfp592	UTSW	7	81023573	missense	probably damaging	1.00
R8766:Zfp592	UTSW	7	81024605	missense	probably benign	0.00
R9083:Zfp592	UTSW	7	81024896	missense	possibly damaging	0.95
R9141:Zfp592	UTSW	7	81024457	missense	probably damaging	1.00
R9194:Zfp592	UTSW	7	81024601	missense	probably benign
R9197:Zfp592	UTSW	7	81024319	missense	possibly damaging	0.73
R9246:Zfp592	UTSW	7	81041781	missense	probably benign	0.03
R9321:Zfp592	UTSW	7	81041478	missense	possibly damaging	0.65
R9426:Zfp592	UTSW	7	81024457	missense	probably damaging	1.00
R9785:Zfp592	UTSW	7	81023497	missense	probably damaging	1.00
X0022:Zfp592	UTSW	7	81038187	nonsense	probably null
X0028:Zfp592	UTSW	7	81024014	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGCGGACCAGATGTTTGTG -3'
(R):5'- CACCAGTATGGGTAGGATTATCTTC -3'

Sequencing Primer
(F):5'- GCTCCCGTGAACTCCACTG -3'
(R):5'- TGGGTAGGATTATCTTCCCAAATAAG -3'

Posted On

2018-07-23