Mutagenetix > Incidental Mutation

Incidental Mutation 'R6701:Otof'

528731

Institutional Source

Beutler Lab

Gene Symbol

Otof

Ensembl Gene

ENSMUSG00000062372

Gene Name

otoferlin

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.129) question?

Stock #

R6701 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

30367062-30461932 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 30370797 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 1901 (K1901*)

Ref Sequence

ENSEMBL: ENSMUSP00000110395 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074171] [ENSMUST00000101448] [ENSMUST00000114747]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000074171
AA Change: K1906*

SMART Domains

Protein: ENSMUSP00000073803
Gene: ENSMUSG00000062372
AA Change: K1906*

Domain	Start	End	E-Value	Type
C2	2	97	6.83e-1	SMART
C2	254	352	3.76e-11	SMART
FerI	338	409	7.91e-38	SMART
C2	417	528	1.75e-11	SMART
low complexity region	607	618	N/A	INTRINSIC
FerB	841	917	5.13e-46	SMART
C2	960	1067	1.77e-7	SMART
low complexity region	1191	1202	N/A	INTRINSIC
low complexity region	1265	1276	N/A	INTRINSIC
low complexity region	1293	1323	N/A	INTRINSIC
low complexity region	1370	1385	N/A	INTRINSIC
low complexity region	1436	1447	N/A	INTRINSIC
C2	1493	1592	6.54e-11	SMART
C2	1733	1863	4.02e0	SMART
Pfam:Ferlin_C	1895	1994	7.2e-33	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000101448

SMART Domains

Protein: ENSMUSP00000098992
Gene: ENSMUSG00000073102

Domain	Start	End	E-Value	Type
low complexity region	33	55	N/A	INTRINSIC
low complexity region	62	79	N/A	INTRINSIC
Pfam:NYD-SP28	100	200	1.7e-33	PFAM
coiled coil region	280	318	N/A	INTRINSIC
low complexity region	455	473	N/A	INTRINSIC
low complexity region	559	569	N/A	INTRINSIC
low complexity region	599	612	N/A	INTRINSIC
Pfam:NYD-SP28_assoc	673	732	2.2e-25	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000114747
AA Change: K1901*

SMART Domains

Protein: ENSMUSP00000110395
Gene: ENSMUSG00000062372
AA Change: K1901*

Domain	Start	End	E-Value	Type
C2	2	97	6.83e-1	SMART
C2	269	367	3.76e-11	SMART
FerI	353	424	7.91e-38	SMART
C2	432	543	1.75e-11	SMART
low complexity region	622	633	N/A	INTRINSIC
FerB	856	932	5.13e-46	SMART
C2	975	1082	1.77e-7	SMART
Pfam:C2	1153	1236	1.8e-1	PFAM
low complexity region	1260	1271	N/A	INTRINSIC
low complexity region	1288	1318	N/A	INTRINSIC
low complexity region	1365	1380	N/A	INTRINSIC
low complexity region	1431	1442	N/A	INTRINSIC
C2	1488	1587	6.54e-11	SMART
C2	1728	1858	4.02e0	SMART
low complexity region	1903	1915	N/A	INTRINSIC
transmembrane domain	1959	1981	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144125

SMART Domains

Protein: ENSMUSP00000120679
Gene: ENSMUSG00000062372

Domain	Start	End	E-Value	Type
C2	2	97	6.83e-1	SMART
C2	254	352	3.76e-11	SMART
FerI	338	409	7.91e-38	SMART
C2	417	528	1.75e-11	SMART
low complexity region	607	618	N/A	INTRINSIC
FerB	841	917	5.13e-46	SMART
C2	960	1067	1.77e-7	SMART
low complexity region	1191	1202	N/A	INTRINSIC
low complexity region	1265	1276	N/A	INTRINSIC
low complexity region	1293	1323	N/A	INTRINSIC
low complexity region	1370	1385	N/A	INTRINSIC
low complexity region	1436	1447	N/A	INTRINSIC
C2	1493	1592	6.54e-11	SMART
C2	1733	1863	4.02e0	SMART
Pfam:Ferlin_C	1895	1994	7.2e-33	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150734

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200001

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.4%
20x: 96.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene are a cause of neurosensory nonsyndromic recessive deafness, DFNB9. The short form of the encoded protein has 3 C2 domains, a single carboxy-terminal transmembrane domain found also in the C. elegans spermatogenesis factor FER-1 and human dysferlin, while the long form has 6 C2 domains. The homology suggests that this protein may be involved in vesicle membrane fusion. Several transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants have no detectable auditory brainstem response at any frequency tested. Otoacoustic transmission distortion products are detected. Direct electrical stimulation of cochlear ganglia elicits brainstem responses. On depolarization, inner hair cells release almost no neurotransmitter. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap12	A	T	10: 4,355,243	K684N	probably damaging	Het
Akna	C	T	4: 63,395,280	G202D	probably benign	Het
Alpk1	T	A	3: 127,729,336	D19V	probably damaging	Het
Arid4a	A	T	12: 71,087,512	K1196I	probably damaging	Het
Asic3	A	T	5: 24,414,129	M140L	possibly damaging	Het
BC055324	T	C	1: 163,971,843		probably null	Het
Bfsp2	C	T	9: 103,479,878	V117M	possibly damaging	Het
Cd244	C	A	1: 171,574,155	L150M	possibly damaging	Het
Cd3e	T	C	9: 45,001,053	Y131C	probably damaging	Het
Clptm1l	T	C	13: 73,608,906	I202T	probably benign	Het
Cnot4	G	T	6: 35,068,604	T224K	probably damaging	Het
Col24a1	A	G	3: 145,314,380	T171A	probably benign	Het
Col6a3	C	T	1: 90,792,462	R1552Q	probably benign	Het
Dcc	T	A	18: 71,809,120	T309S	probably benign	Het
Ddx21	T	C	10: 62,590,691	Y461C	probably damaging	Het
Dnah10	G	A	5: 124,760,159	V989M	probably benign	Het
Dppa4	A	T	16: 48,291,311	K220*	probably null	Het
Dysf	G	A	6: 84,112,190	G912S	probably damaging	Het
Efhb	A	T	17: 53,399,063	N815K	probably benign	Het
Eml6	T	A	11: 29,785,748	L1139F	probably damaging	Het
Eprs	T	G	1: 185,370,890	I78S	probably damaging	Het
Fat1	C	A	8: 44,950,681	S156R	probably damaging	Het
Frzb	G	A	2: 80,446,819	R8W	possibly damaging	Het
Guf1	T	A	5: 69,558,253	D47E	probably damaging	Het
Haus3	A	T	5: 34,167,734	F194I	probably damaging	Het
Hivep3	C	T	4: 120,094,540	R18W	probably damaging	Het
Hnf1b	A	G	11: 83,889,094	T392A	probably damaging	Het
Hsd17b1	C	A	11: 101,080,155	C312*	probably null	Het
Ighg2b	T	C	12: 113,307,079	T144A	unknown	Het
Iqub	T	A	6: 24,449,745	N707I	probably damaging	Het
Jhy	T	C	9: 40,917,591	R340G	probably damaging	Het
Klra3	C	G	6: 130,330,253	V144L	probably benign	Het
Lamp5	C	G	2: 136,059,563	N102K	possibly damaging	Het
Lrmp	G	T	6: 145,144,976	E61*	probably null	Het
Lrrc4	A	G	6: 28,830,906	F237L	possibly damaging	Het
Lyst	T	A	13: 13,681,485	C2464S	probably benign	Het
Maml1	T	C	11: 50,266,682	E222G	probably damaging	Het
Med15	C	T	16: 17,671,583		probably benign	Het
Naalad2	T	C	9: 18,385,148	I69V	probably null	Het
Neb	T	C	2: 52,291,208	K1129R	probably damaging	Het
Nsun6	A	T	2: 15,036,302	N159K	probably benign	Het
Nup153	A	T	13: 46,687,065	N1022K	probably benign	Het
Olfr1009	A	G	2: 85,722,331	K309E	probably benign	Het
Olfr1138	C	T	2: 87,737,409	R305K	probably benign	Het
Olfr389	T	C	11: 73,776,470	N286D	probably damaging	Het
Pde1c	A	T	6: 56,181,700	Y136N	probably damaging	Het
Phc1	G	T	6: 122,325,774	N263K	probably damaging	Het
Plxna1	A	T	6: 89,319,448	D1871E	probably damaging	Het
Prdm6	T	A	18: 53,536,679	M123K	possibly damaging	Het
Ranbp17	T	C	11: 33,475,066	D430G	probably damaging	Het
Rsl24d1	C	A	9: 73,114,997	T287K	probably damaging	Het
Scn1a	G	A	2: 66,337,960	R101W	probably damaging	Het
Scn8a	A	G	15: 101,040,096	D1741G	probably damaging	Het
Serpinb1c	T	C	13: 32,896,941	Q53R	probably benign	Het
Serpinf2	C	T	11: 75,432,443	R479H	probably damaging	Het
Sis	T	A	3: 72,949,527	D448V	probably damaging	Het
Slc27a6	T	A	18: 58,579,875	D256E	probably benign	Het
Slc30a8	A	G	15: 52,331,574	Y243C	possibly damaging	Het
Slc35f5	T	C	1: 125,562,610	V103A	probably damaging	Het
Slc44a2	T	C	9: 21,320,853		probably null	Het
Slc7a9	T	C	7: 35,459,849	L327P	probably damaging	Het
Stat4	A	G	1: 52,102,974	Y660C	probably damaging	Het
Terb1	T	C	8: 104,472,756	T519A	possibly damaging	Het
Tonsl	A	T	15: 76,629,300	S1245T	probably damaging	Het
Ttn	A	T	2: 76,788,818	S16072R	probably damaging	Het
Ttn	A	T	2: 76,909,246	Y3650N	probably benign	Het
Uhrf1bp1	T	A	17: 27,887,357	C952*	probably null	Het
Uso1	T	C	5: 92,166,585	F117S	probably damaging	Het
Vmn1r211	T	C	13: 22,851,609	H296R	probably benign	Het
Vmn2r67	G	A	7: 85,152,815	P93S	probably damaging	Het
Xirp2	A	T	2: 67,516,225	I2937F	possibly damaging	Het
Zc2hc1c	C	A	12: 85,289,672		probably null	Het
Zfp12	T	C	5: 143,244,464	V182A	probably benign	Het
Zfp473	G	T	7: 44,732,794	A705D	possibly damaging	Het
Zfp937	G	T	2: 150,239,216	G389C	probably damaging	Het
Zfp990	A	G	4: 145,538,178	D582G	probably benign	Het

Other mutations in Otof

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Otof	APN	5	30375904	missense	probably damaging	1.00
IGL00391:Otof	APN	5	30375623	missense	probably damaging	1.00
IGL00579:Otof	APN	5	30399322	missense	possibly damaging	0.88
IGL00671:Otof	APN	5	30385753	critical splice donor site	probably null
IGL01019:Otof	APN	5	30405216	missense	probably benign	0.01
IGL01025:Otof	APN	5	30384253	missense	possibly damaging	0.82
IGL01086:Otof	APN	5	30376273	critical splice donor site	probably null
IGL01110:Otof	APN	5	30461725	missense	probably damaging	1.00
IGL01160:Otof	APN	5	30381535	missense	probably benign	0.00
IGL01285:Otof	APN	5	30405183	missense	probably damaging	1.00
IGL01329:Otof	APN	5	30441379	missense	probably benign	0.00
IGL01337:Otof	APN	5	30405777	missense	possibly damaging	0.93
IGL01337:Otof	APN	5	30419512	missense	probably benign	0.17
IGL01834:Otof	APN	5	30399220	missense	probably damaging	1.00
IGL01872:Otof	APN	5	30379254	splice site	probably benign
IGL01969:Otof	APN	5	30382483	splice site	probably benign
IGL02075:Otof	APN	5	30370726	missense	probably benign	0.23
IGL02077:Otof	APN	5	30399235	missense	probably damaging	1.00
IGL02136:Otof	APN	5	30373992	missense	possibly damaging	0.90
IGL02227:Otof	APN	5	30370784	missense	probably damaging	1.00
IGL02475:Otof	APN	5	30376682	missense	probably damaging	1.00
IGL02812:Otof	APN	5	30374082	missense	probably benign	0.08
IGL02864:Otof	APN	5	30386341	missense	probably damaging	0.99
IGL03176:Otof	APN	5	30405176	splice site	probably null
R0285:Otof	UTSW	5	30379533	critical splice donor site	probably null
R0421:Otof	UTSW	5	30371568	missense	possibly damaging	0.94
R0570:Otof	UTSW	5	30371881	splice site	probably benign
R0599:Otof	UTSW	5	30370705	missense	probably damaging	1.00
R0675:Otof	UTSW	5	30382361	missense	probably benign	0.01
R0715:Otof	UTSW	5	30394697	missense	probably damaging	0.99
R1019:Otof	UTSW	5	30370743	missense	probably damaging	0.96
R1183:Otof	UTSW	5	30371912	missense	probably damaging	1.00
R1435:Otof	UTSW	5	30378695	missense	probably benign	0.00
R1469:Otof	UTSW	5	30380227	missense	probably benign	0.00
R1469:Otof	UTSW	5	30380227	missense	probably benign	0.00
R1474:Otof	UTSW	5	30379532	critical splice donor site	probably null
R1524:Otof	UTSW	5	30379556	missense	probably benign	0.03
R1563:Otof	UTSW	5	30371005	missense	probably benign	0.00
R1732:Otof	UTSW	5	30386471	missense	probably damaging	1.00
R1822:Otof	UTSW	5	30378710	missense	probably benign	0.00
R1845:Otof	UTSW	5	30371723	nonsense	probably null
R1925:Otof	UTSW	5	30394188	missense	probably benign	0.37
R1938:Otof	UTSW	5	30376369	missense	probably benign	0.00
R1968:Otof	UTSW	5	30388654	missense	probably damaging	1.00
R1996:Otof	UTSW	5	30421037	missense	probably benign	0.01
R1999:Otof	UTSW	5	30388772	missense	probably benign	0.19
R2027:Otof	UTSW	5	30421014	missense	probably benign	0.08
R2138:Otof	UTSW	5	30461770	missense	probably benign	0.01
R2173:Otof	UTSW	5	30386374	missense	probably damaging	1.00
R2245:Otof	UTSW	5	30370207	missense	probably damaging	1.00
R3011:Otof	UTSW	5	30382840	missense	probably damaging	1.00
R3105:Otof	UTSW	5	30381801	missense	probably benign	0.03
R3442:Otof	UTSW	5	30371689	missense	probably damaging	1.00
R3710:Otof	UTSW	5	30385266	missense	probably benign
R3715:Otof	UTSW	5	30376871	nonsense	probably null
R3806:Otof	UTSW	5	30386499	critical splice acceptor site	probably null
R3975:Otof	UTSW	5	30370712	missense	probably damaging	1.00
R4067:Otof	UTSW	5	30399291	missense	probably damaging	1.00
R4077:Otof	UTSW	5	30419506	missense	possibly damaging	0.89
R4166:Otof	UTSW	5	30382418	missense	probably damaging	1.00
R4451:Otof	UTSW	5	30385164	missense	possibly damaging	0.77
R4485:Otof	UTSW	5	30375000	missense	possibly damaging	0.77
R4600:Otof	UTSW	5	30371900	missense	probably damaging	1.00
R4646:Otof	UTSW	5	30383570	missense	possibly damaging	0.82
R4648:Otof	UTSW	5	30383570	missense	possibly damaging	0.82
R4669:Otof	UTSW	5	30420974	critical splice donor site	probably null
R4773:Otof	UTSW	5	30394682	missense	probably benign	0.05
R4839:Otof	UTSW	5	30419404	missense	probably damaging	0.99
R4907:Otof	UTSW	5	30378661	critical splice donor site	probably null
R4961:Otof	UTSW	5	30383493	intron	probably benign
R4991:Otof	UTSW	5	30394181	missense	probably damaging	1.00
R5015:Otof	UTSW	5	30382894	missense	probably damaging	1.00
R5036:Otof	UTSW	5	30384439	missense	possibly damaging	0.54
R5038:Otof	UTSW	5	30384439	missense	possibly damaging	0.54
R5253:Otof	UTSW	5	30370139	missense	probably damaging	1.00
R5336:Otof	UTSW	5	30376720	missense	probably benign	0.01
R5365:Otof	UTSW	5	30381800	missense	probably damaging	0.99
R5901:Otof	UTSW	5	30374979	missense	probably damaging	1.00
R6211:Otof	UTSW	5	30371900	missense	probably damaging	0.99
R6318:Otof	UTSW	5	30414544	missense	probably damaging	1.00
R6331:Otof	UTSW	5	30371935	missense	possibly damaging	0.94
R6671:Otof	UTSW	5	30419533	missense	probably benign
R6792:Otof	UTSW	5	30375634	missense	probably damaging	1.00
R6853:Otof	UTSW	5	30388239	missense	probably damaging	1.00
R6940:Otof	UTSW	5	30371643	missense	probably damaging	0.96
R7037:Otof	UTSW	5	30381538	missense	probably benign	0.32
R7060:Otof	UTSW	5	30388356	missense	possibly damaging	0.84
R7089:Otof	UTSW	5	30371568	missense	possibly damaging	0.94
R7165:Otof	UTSW	5	30375620	missense	probably damaging	0.99
R7178:Otof	UTSW	5	30383534	missense	possibly damaging	0.50
R7298:Otof	UTSW	5	30388270	missense	probably damaging	1.00
R7393:Otof	UTSW	5	30370270	missense	probably benign	0.45
R7397:Otof	UTSW	5	30375707	missense	probably damaging	1.00
R7400:Otof	UTSW	5	30385188	missense	probably benign	0.04
R7428:Otof	UTSW	5	30389825	missense	probably damaging	1.00
R7456:Otof	UTSW	5	30394661	missense	probably damaging	1.00
R7505:Otof	UTSW	5	30371020	missense	probably benign	0.00
R7714:Otof	UTSW	5	30370253	missense	probably damaging	0.99
R8002:Otof	UTSW	5	30380610	missense	probably benign	0.10
R8032:Otof	UTSW	5	30461798	start codon destroyed	probably benign	0.07
R8153:Otof	UTSW	5	30388735	missense	probably damaging	1.00
R8158:Otof	UTSW	5	30380194	missense	probably benign	0.37
R8159:Otof	UTSW	5	30380194	missense	probably benign	0.37
R8441:Otof	UTSW	5	30380856	missense	probably damaging	0.99
R8738:Otof	UTSW	5	30388624	nonsense	probably null
R8813:Otof	UTSW	5	30382898	missense	probably benign	0.02
R8835:Otof	UTSW	5	30370920	missense	probably benign	0.44
R8852:Otof	UTSW	5	30371700	missense	possibly damaging	0.94
R8869:Otof	UTSW	5	30420981	missense	probably benign	0.08
R9029:Otof	UTSW	5	30370075	critical splice donor site	probably null
R9031:Otof	UTSW	5	30380188	missense	probably benign
R9061:Otof	UTSW	5	30388657	missense	possibly damaging	0.50
R9100:Otof	UTSW	5	30382352	missense	possibly damaging	0.80
R9121:Otof	UTSW	5	30379118	missense	probably benign	0.04
R9188:Otof	UTSW	5	30376751	missense	probably damaging	1.00
R9218:Otof	UTSW	5	30385125	missense	probably benign
R9280:Otof	UTSW	5	30371550	missense	probably damaging	0.98
R9395:Otof	UTSW	5	30375632	missense	probably damaging	1.00
R9400:Otof	UTSW	5	30383519	critical splice donor site	probably null
R9407:Otof	UTSW	5	30380921	missense	probably damaging	1.00
Z1176:Otof	UTSW	5	30371586	missense	probably damaging	0.98
Z1177:Otof	UTSW	5	30376297	missense	probably damaging	1.00
Z1177:Otof	UTSW	5	30383658	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGCCTCTGAAGTAAGGGCAAG -3'
(R):5'- AGCAGTGCACCATGGAGATG -3'

Sequencing Primer
(F):5'- CCTCTGAAGTAAGGGCAAGAAGAC -3'
(R):5'- GTGGACGTACCCCTGGTTTC -3'

Posted On

2018-07-24