Incidental Mutation 'R3715:Otof'
ID 259843
Institutional Source Beutler Lab
Gene Symbol Otof
Ensembl Gene ENSMUSG00000062372
Gene Name otoferlin
Synonyms
MMRRC Submission 040708-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R3715 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 30524406-30619276 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 30534215 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 1397 (K1397*)
Ref Sequence ENSEMBL: ENSMUSP00000110395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074171] [ENSMUST00000114747]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000074171
AA Change: K1402*
SMART Domains Protein: ENSMUSP00000073803
Gene: ENSMUSG00000062372
AA Change: K1402*

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 254 352 3.76e-11 SMART
FerI 338 409 7.91e-38 SMART
C2 417 528 1.75e-11 SMART
low complexity region 607 618 N/A INTRINSIC
FerB 841 917 5.13e-46 SMART
C2 960 1067 1.77e-7 SMART
low complexity region 1191 1202 N/A INTRINSIC
low complexity region 1265 1276 N/A INTRINSIC
low complexity region 1293 1323 N/A INTRINSIC
low complexity region 1370 1385 N/A INTRINSIC
low complexity region 1436 1447 N/A INTRINSIC
C2 1493 1592 6.54e-11 SMART
C2 1733 1863 4.02e0 SMART
Pfam:Ferlin_C 1895 1994 7.2e-33 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000114747
AA Change: K1397*
SMART Domains Protein: ENSMUSP00000110395
Gene: ENSMUSG00000062372
AA Change: K1397*

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 269 367 3.76e-11 SMART
FerI 353 424 7.91e-38 SMART
C2 432 543 1.75e-11 SMART
low complexity region 622 633 N/A INTRINSIC
FerB 856 932 5.13e-46 SMART
C2 975 1082 1.77e-7 SMART
Pfam:C2 1153 1236 1.8e-1 PFAM
low complexity region 1260 1271 N/A INTRINSIC
low complexity region 1288 1318 N/A INTRINSIC
low complexity region 1365 1380 N/A INTRINSIC
low complexity region 1431 1442 N/A INTRINSIC
C2 1488 1587 6.54e-11 SMART
C2 1728 1858 4.02e0 SMART
low complexity region 1903 1915 N/A INTRINSIC
transmembrane domain 1959 1981 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144125
SMART Domains Protein: ENSMUSP00000120679
Gene: ENSMUSG00000062372

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 254 352 3.76e-11 SMART
FerI 338 409 7.91e-38 SMART
C2 417 528 1.75e-11 SMART
low complexity region 607 618 N/A INTRINSIC
FerB 841 917 5.13e-46 SMART
C2 960 1067 1.77e-7 SMART
low complexity region 1191 1202 N/A INTRINSIC
low complexity region 1265 1276 N/A INTRINSIC
low complexity region 1293 1323 N/A INTRINSIC
low complexity region 1370 1385 N/A INTRINSIC
low complexity region 1436 1447 N/A INTRINSIC
C2 1493 1592 6.54e-11 SMART
C2 1733 1863 4.02e0 SMART
Pfam:Ferlin_C 1895 1994 7.2e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150734
Meta Mutation Damage Score 0.9711 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene are a cause of neurosensory nonsyndromic recessive deafness, DFNB9. The short form of the encoded protein has 3 C2 domains, a single carboxy-terminal transmembrane domain found also in the C. elegans spermatogenesis factor FER-1 and human dysferlin, while the long form has 6 C2 domains. The homology suggests that this protein may be involved in vesicle membrane fusion. Several transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants have no detectable auditory brainstem response at any frequency tested. Otoacoustic transmission distortion products are detected. Direct electrical stimulation of cochlear ganglia elicits brainstem responses. On depolarization, inner hair cells release almost no neurotransmitter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik T C 16: 88,424,081 (GRCm39) M137V probably benign Het
9930111J21Rik1 T C 11: 48,838,803 (GRCm39) T595A possibly damaging Het
Aaas T C 15: 102,248,771 (GRCm39) I236V probably benign Het
Abcd4 C T 12: 84,658,533 (GRCm39) M223I probably benign Het
Adamtsl1 T A 4: 86,135,213 (GRCm39) I246N probably benign Het
Ak9 A G 10: 41,233,508 (GRCm39) D582G probably damaging Het
Aqr A G 2: 113,949,150 (GRCm39) probably benign Het
Bmal2 A G 6: 146,724,187 (GRCm39) K360E probably damaging Het
Cacna2d3 T C 14: 29,068,880 (GRCm39) I282M probably damaging Het
Cers3 G T 7: 66,435,823 (GRCm39) A261S probably benign Het
Dexi A T 16: 10,360,553 (GRCm39) M1K probably null Het
Dlat A G 9: 50,549,354 (GRCm39) V510A probably damaging Het
Eaf1 T C 14: 31,224,402 (GRCm39) I173T possibly damaging Het
Elavl3 G T 9: 21,929,895 (GRCm39) D336E probably benign Het
Epm2a A G 10: 11,219,420 (GRCm39) Y69C probably benign Het
Fam168a A G 7: 100,473,432 (GRCm39) N107S probably damaging Het
Fam43b G C 4: 138,122,409 (GRCm39) R304G probably benign Het
Fras1 T C 5: 96,793,829 (GRCm39) probably null Het
Fscn3 C T 6: 28,428,091 (GRCm39) T26I possibly damaging Het
Glt8d2 C A 10: 82,488,571 (GRCm39) A300S probably benign Het
Hcn4 G A 9: 58,751,319 (GRCm39) R315H unknown Het
Lipk A G 19: 34,017,829 (GRCm39) N289S probably damaging Het
Lyg1 G T 1: 37,989,759 (GRCm39) R43S probably damaging Het
Marchf6 A G 15: 31,465,405 (GRCm39) L833P probably benign Het
Mc4r T A 18: 66,992,892 (GRCm39) N74Y probably damaging Het
Med17 G A 9: 15,175,062 (GRCm39) probably benign Het
Mink1 G T 11: 70,499,776 (GRCm39) R773L possibly damaging Het
Myo15a A T 11: 60,370,057 (GRCm39) E939V possibly damaging Het
Ndst4 A T 3: 125,355,154 (GRCm39) H354L possibly damaging Het
Or2t26 T C 11: 49,039,642 (GRCm39) L186P probably damaging Het
Or4c15 A G 2: 88,759,757 (GRCm39) W301R probably benign Het
Or4p22 C A 2: 88,317,787 (GRCm39) T237N probably damaging Het
Rangap1 C A 15: 81,594,661 (GRCm39) E389D probably benign Het
Rbfox2 A G 15: 76,983,451 (GRCm39) I270T probably damaging Het
Rnf217 G T 10: 31,410,728 (GRCm39) C322* probably null Het
Sbk1 A G 7: 125,889,183 (GRCm39) T50A probably benign Het
Shmt1 T C 11: 60,688,402 (GRCm39) T248A probably damaging Het
Smim29 G A 17: 27,785,043 (GRCm39) probably benign Het
Sox30 C T 11: 45,875,619 (GRCm39) T457I probably damaging Het
Stox2 T A 8: 47,866,187 (GRCm39) I52F possibly damaging Het
Syncrip A T 9: 88,361,738 (GRCm39) probably benign Het
Tars3 G A 7: 65,338,700 (GRCm39) probably null Het
Tdrd12 T C 7: 35,204,405 (GRCm39) E235G probably benign Het
Tmem82 A T 4: 141,344,945 (GRCm39) probably null Het
Tro T C X: 149,437,230 (GRCm39) T476A probably damaging Het
Ttn G A 2: 76,561,363 (GRCm39) P27302S probably damaging Het
Ttn C T 2: 76,571,610 (GRCm39) V26428I probably damaging Het
Usp53 T C 3: 122,742,968 (GRCm39) E656G probably benign Het
Vmn2r100 A G 17: 19,752,272 (GRCm39) R772G probably damaging Het
Xkr5 T C 8: 18,984,474 (GRCm39) E190G probably benign Het
Zfp236 A G 18: 82,651,095 (GRCm39) probably benign Het
Zfr2 T G 10: 81,081,913 (GRCm39) V493G probably benign Het
Zp2 A T 7: 119,741,057 (GRCm39) S156T possibly damaging Het
Zswim5 A G 4: 116,819,755 (GRCm39) T387A probably benign Het
Other mutations in Otof
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Otof APN 5 30,533,248 (GRCm39) missense probably damaging 1.00
IGL00391:Otof APN 5 30,532,967 (GRCm39) missense probably damaging 1.00
IGL00579:Otof APN 5 30,556,666 (GRCm39) missense possibly damaging 0.88
IGL00671:Otof APN 5 30,543,097 (GRCm39) critical splice donor site probably null
IGL01019:Otof APN 5 30,562,560 (GRCm39) missense probably benign 0.01
IGL01025:Otof APN 5 30,541,597 (GRCm39) missense possibly damaging 0.82
IGL01086:Otof APN 5 30,533,617 (GRCm39) critical splice donor site probably null
IGL01110:Otof APN 5 30,619,069 (GRCm39) missense probably damaging 1.00
IGL01160:Otof APN 5 30,538,879 (GRCm39) missense probably benign 0.00
IGL01285:Otof APN 5 30,562,527 (GRCm39) missense probably damaging 1.00
IGL01329:Otof APN 5 30,598,723 (GRCm39) missense probably benign 0.00
IGL01337:Otof APN 5 30,576,856 (GRCm39) missense probably benign 0.17
IGL01337:Otof APN 5 30,563,121 (GRCm39) missense possibly damaging 0.93
IGL01834:Otof APN 5 30,556,564 (GRCm39) missense probably damaging 1.00
IGL01872:Otof APN 5 30,536,598 (GRCm39) splice site probably benign
IGL01969:Otof APN 5 30,539,827 (GRCm39) splice site probably benign
IGL02075:Otof APN 5 30,528,070 (GRCm39) missense probably benign 0.23
IGL02077:Otof APN 5 30,556,579 (GRCm39) missense probably damaging 1.00
IGL02136:Otof APN 5 30,531,336 (GRCm39) missense possibly damaging 0.90
IGL02227:Otof APN 5 30,528,128 (GRCm39) missense probably damaging 1.00
IGL02475:Otof APN 5 30,534,026 (GRCm39) missense probably damaging 1.00
IGL02812:Otof APN 5 30,531,426 (GRCm39) missense probably benign 0.08
IGL02864:Otof APN 5 30,543,685 (GRCm39) missense probably damaging 0.99
IGL03176:Otof APN 5 30,562,520 (GRCm39) splice site probably null
R0285:Otof UTSW 5 30,536,877 (GRCm39) critical splice donor site probably null
R0421:Otof UTSW 5 30,528,912 (GRCm39) missense possibly damaging 0.94
R0570:Otof UTSW 5 30,529,225 (GRCm39) splice site probably benign
R0599:Otof UTSW 5 30,528,049 (GRCm39) missense probably damaging 1.00
R0675:Otof UTSW 5 30,539,705 (GRCm39) missense probably benign 0.01
R0715:Otof UTSW 5 30,552,041 (GRCm39) missense probably damaging 0.99
R1019:Otof UTSW 5 30,528,087 (GRCm39) missense probably damaging 0.96
R1183:Otof UTSW 5 30,529,256 (GRCm39) missense probably damaging 1.00
R1435:Otof UTSW 5 30,536,039 (GRCm39) missense probably benign 0.00
R1469:Otof UTSW 5 30,537,571 (GRCm39) missense probably benign 0.00
R1469:Otof UTSW 5 30,537,571 (GRCm39) missense probably benign 0.00
R1474:Otof UTSW 5 30,536,876 (GRCm39) critical splice donor site probably null
R1524:Otof UTSW 5 30,536,900 (GRCm39) missense probably benign 0.03
R1563:Otof UTSW 5 30,528,349 (GRCm39) missense probably benign 0.00
R1732:Otof UTSW 5 30,543,815 (GRCm39) missense probably damaging 1.00
R1822:Otof UTSW 5 30,536,054 (GRCm39) missense probably benign 0.00
R1845:Otof UTSW 5 30,529,067 (GRCm39) nonsense probably null
R1925:Otof UTSW 5 30,551,532 (GRCm39) missense probably benign 0.37
R1938:Otof UTSW 5 30,533,713 (GRCm39) missense probably benign 0.00
R1968:Otof UTSW 5 30,545,998 (GRCm39) missense probably damaging 1.00
R1996:Otof UTSW 5 30,578,381 (GRCm39) missense probably benign 0.01
R1999:Otof UTSW 5 30,546,116 (GRCm39) missense probably benign 0.19
R2027:Otof UTSW 5 30,578,358 (GRCm39) missense probably benign 0.08
R2138:Otof UTSW 5 30,619,114 (GRCm39) missense probably benign 0.01
R2173:Otof UTSW 5 30,543,718 (GRCm39) missense probably damaging 1.00
R2245:Otof UTSW 5 30,527,551 (GRCm39) missense probably damaging 1.00
R3011:Otof UTSW 5 30,540,184 (GRCm39) missense probably damaging 1.00
R3105:Otof UTSW 5 30,539,145 (GRCm39) missense probably benign 0.03
R3442:Otof UTSW 5 30,529,033 (GRCm39) missense probably damaging 1.00
R3710:Otof UTSW 5 30,542,610 (GRCm39) missense probably benign
R3806:Otof UTSW 5 30,543,843 (GRCm39) critical splice acceptor site probably null
R3975:Otof UTSW 5 30,528,056 (GRCm39) missense probably damaging 1.00
R4067:Otof UTSW 5 30,556,635 (GRCm39) missense probably damaging 1.00
R4077:Otof UTSW 5 30,576,850 (GRCm39) missense possibly damaging 0.89
R4166:Otof UTSW 5 30,539,762 (GRCm39) missense probably damaging 1.00
R4451:Otof UTSW 5 30,542,508 (GRCm39) missense possibly damaging 0.77
R4485:Otof UTSW 5 30,532,344 (GRCm39) missense possibly damaging 0.77
R4600:Otof UTSW 5 30,529,244 (GRCm39) missense probably damaging 1.00
R4646:Otof UTSW 5 30,540,914 (GRCm39) missense possibly damaging 0.82
R4648:Otof UTSW 5 30,540,914 (GRCm39) missense possibly damaging 0.82
R4669:Otof UTSW 5 30,578,318 (GRCm39) critical splice donor site probably null
R4773:Otof UTSW 5 30,552,026 (GRCm39) missense probably benign 0.05
R4839:Otof UTSW 5 30,576,748 (GRCm39) missense probably damaging 0.99
R4907:Otof UTSW 5 30,536,005 (GRCm39) critical splice donor site probably null
R4961:Otof UTSW 5 30,540,837 (GRCm39) intron probably benign
R4991:Otof UTSW 5 30,551,525 (GRCm39) missense probably damaging 1.00
R5015:Otof UTSW 5 30,540,238 (GRCm39) missense probably damaging 1.00
R5036:Otof UTSW 5 30,541,783 (GRCm39) missense possibly damaging 0.54
R5038:Otof UTSW 5 30,541,783 (GRCm39) missense possibly damaging 0.54
R5253:Otof UTSW 5 30,527,483 (GRCm39) missense probably damaging 1.00
R5336:Otof UTSW 5 30,534,064 (GRCm39) missense probably benign 0.01
R5365:Otof UTSW 5 30,539,144 (GRCm39) missense probably damaging 0.99
R5901:Otof UTSW 5 30,532,323 (GRCm39) missense probably damaging 1.00
R6211:Otof UTSW 5 30,529,244 (GRCm39) missense probably damaging 0.99
R6318:Otof UTSW 5 30,571,888 (GRCm39) missense probably damaging 1.00
R6331:Otof UTSW 5 30,529,279 (GRCm39) missense possibly damaging 0.94
R6671:Otof UTSW 5 30,576,877 (GRCm39) missense probably benign
R6701:Otof UTSW 5 30,528,141 (GRCm39) nonsense probably null
R6792:Otof UTSW 5 30,532,978 (GRCm39) missense probably damaging 1.00
R6853:Otof UTSW 5 30,545,583 (GRCm39) missense probably damaging 1.00
R6940:Otof UTSW 5 30,528,987 (GRCm39) missense probably damaging 0.96
R7037:Otof UTSW 5 30,538,882 (GRCm39) missense probably benign 0.32
R7060:Otof UTSW 5 30,545,700 (GRCm39) missense possibly damaging 0.84
R7089:Otof UTSW 5 30,528,912 (GRCm39) missense possibly damaging 0.94
R7165:Otof UTSW 5 30,532,964 (GRCm39) missense probably damaging 0.99
R7178:Otof UTSW 5 30,540,878 (GRCm39) missense possibly damaging 0.50
R7298:Otof UTSW 5 30,545,614 (GRCm39) missense probably damaging 1.00
R7393:Otof UTSW 5 30,527,614 (GRCm39) missense probably benign 0.45
R7397:Otof UTSW 5 30,533,051 (GRCm39) missense probably damaging 1.00
R7400:Otof UTSW 5 30,542,532 (GRCm39) missense probably benign 0.04
R7428:Otof UTSW 5 30,547,169 (GRCm39) missense probably damaging 1.00
R7456:Otof UTSW 5 30,552,005 (GRCm39) missense probably damaging 1.00
R7505:Otof UTSW 5 30,528,364 (GRCm39) missense probably benign 0.00
R7714:Otof UTSW 5 30,527,597 (GRCm39) missense probably damaging 0.99
R8002:Otof UTSW 5 30,537,954 (GRCm39) missense probably benign 0.10
R8032:Otof UTSW 5 30,619,142 (GRCm39) start codon destroyed probably benign 0.07
R8153:Otof UTSW 5 30,546,079 (GRCm39) missense probably damaging 1.00
R8158:Otof UTSW 5 30,537,538 (GRCm39) missense probably benign 0.37
R8159:Otof UTSW 5 30,537,538 (GRCm39) missense probably benign 0.37
R8441:Otof UTSW 5 30,538,200 (GRCm39) missense probably damaging 0.99
R8738:Otof UTSW 5 30,545,968 (GRCm39) nonsense probably null
R8813:Otof UTSW 5 30,540,242 (GRCm39) missense probably benign 0.02
R8835:Otof UTSW 5 30,528,264 (GRCm39) missense probably benign 0.44
R8852:Otof UTSW 5 30,529,044 (GRCm39) missense possibly damaging 0.94
R8869:Otof UTSW 5 30,578,325 (GRCm39) missense probably benign 0.08
R9029:Otof UTSW 5 30,527,419 (GRCm39) critical splice donor site probably null
R9031:Otof UTSW 5 30,537,532 (GRCm39) missense probably benign
R9061:Otof UTSW 5 30,546,001 (GRCm39) missense possibly damaging 0.50
R9100:Otof UTSW 5 30,539,696 (GRCm39) missense possibly damaging 0.80
R9121:Otof UTSW 5 30,536,462 (GRCm39) missense probably benign 0.04
R9188:Otof UTSW 5 30,534,095 (GRCm39) missense probably damaging 1.00
R9218:Otof UTSW 5 30,542,469 (GRCm39) missense probably benign
R9280:Otof UTSW 5 30,528,894 (GRCm39) missense probably damaging 0.98
R9395:Otof UTSW 5 30,532,976 (GRCm39) missense probably damaging 1.00
R9400:Otof UTSW 5 30,540,863 (GRCm39) critical splice donor site probably null
R9407:Otof UTSW 5 30,538,265 (GRCm39) missense probably damaging 1.00
R9616:Otof UTSW 5 30,539,708 (GRCm39) missense possibly damaging 0.95
R9665:Otof UTSW 5 30,584,895 (GRCm39) missense probably benign 0.22
R9748:Otof UTSW 5 30,540,998 (GRCm39) missense probably damaging 1.00
R9783:Otof UTSW 5 30,536,576 (GRCm39) missense probably benign
Z1176:Otof UTSW 5 30,528,930 (GRCm39) missense probably damaging 0.98
Z1177:Otof UTSW 5 30,541,002 (GRCm39) missense probably damaging 1.00
Z1177:Otof UTSW 5 30,533,641 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCAGTCCTCAAAGCTGTC -3'
(R):5'- CCTTGTGGAATGCATTGAGAC -3'

Sequencing Primer
(F):5'- GCTGTCAAACTCCGATTCCAG -3'
(R):5'- TTGTGGAATGCATTGAGACTCCAAAG -3'
Posted On 2015-01-23