Mutagenetix > Incidental Mutation

Incidental Mutation 'R1524:Otof'

167703

Institutional Source

Beutler Lab

Gene Symbol

Otof

Ensembl Gene

ENSMUSG00000062372

Gene Name

otoferlin

Synonyms

MMRRC Submission

039565-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.276) question?

Stock #

R1524 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30367062-30461932 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 30379556 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 1285 (D1285V)

Ref Sequence

ENSEMBL: ENSMUSP00000110395 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074171] [ENSMUST00000114747]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000074171
AA Change: D1290V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000073803
Gene: ENSMUSG00000062372
AA Change: D1290V

Domain	Start	End	E-Value	Type
C2	2	97	6.83e-1	SMART
C2	254	352	3.76e-11	SMART
FerI	338	409	7.91e-38	SMART
C2	417	528	1.75e-11	SMART
low complexity region	607	618	N/A	INTRINSIC
FerB	841	917	5.13e-46	SMART
C2	960	1067	1.77e-7	SMART
low complexity region	1191	1202	N/A	INTRINSIC
low complexity region	1265	1276	N/A	INTRINSIC
low complexity region	1293	1323	N/A	INTRINSIC
low complexity region	1370	1385	N/A	INTRINSIC
low complexity region	1436	1447	N/A	INTRINSIC
C2	1493	1592	6.54e-11	SMART
C2	1733	1863	4.02e0	SMART
Pfam:Ferlin_C	1895	1994	7.2e-33	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000114747
AA Change: D1285V

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000110395
Gene: ENSMUSG00000062372
AA Change: D1285V

Domain	Start	End	E-Value	Type
C2	2	97	6.83e-1	SMART
C2	269	367	3.76e-11	SMART
FerI	353	424	7.91e-38	SMART
C2	432	543	1.75e-11	SMART
low complexity region	622	633	N/A	INTRINSIC
FerB	856	932	5.13e-46	SMART
C2	975	1082	1.77e-7	SMART
Pfam:C2	1153	1236	1.8e-1	PFAM
low complexity region	1260	1271	N/A	INTRINSIC
low complexity region	1288	1318	N/A	INTRINSIC
low complexity region	1365	1380	N/A	INTRINSIC
low complexity region	1431	1442	N/A	INTRINSIC
C2	1488	1587	6.54e-11	SMART
C2	1728	1858	4.02e0	SMART
low complexity region	1903	1915	N/A	INTRINSIC
transmembrane domain	1959	1981	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144125

SMART Domains

Protein: ENSMUSP00000120679
Gene: ENSMUSG00000062372

Domain	Start	End	E-Value	Type
C2	2	97	6.83e-1	SMART
C2	254	352	3.76e-11	SMART
FerI	338	409	7.91e-38	SMART
C2	417	528	1.75e-11	SMART
low complexity region	607	618	N/A	INTRINSIC
FerB	841	917	5.13e-46	SMART
C2	960	1067	1.77e-7	SMART
low complexity region	1191	1202	N/A	INTRINSIC
low complexity region	1265	1276	N/A	INTRINSIC
low complexity region	1293	1323	N/A	INTRINSIC
low complexity region	1370	1385	N/A	INTRINSIC
low complexity region	1436	1447	N/A	INTRINSIC
C2	1493	1592	6.54e-11	SMART
C2	1733	1863	4.02e0	SMART
Pfam:Ferlin_C	1895	1994	7.2e-33	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150734

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.5%

Validation Efficiency

97% (68/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene are a cause of neurosensory nonsyndromic recessive deafness, DFNB9. The short form of the encoded protein has 3 C2 domains, a single carboxy-terminal transmembrane domain found also in the C. elegans spermatogenesis factor FER-1 and human dysferlin, while the long form has 6 C2 domains. The homology suggests that this protein may be involved in vesicle membrane fusion. Several transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants have no detectable auditory brainstem response at any frequency tested. Otoacoustic transmission distortion products are detected. Direct electrical stimulation of cochlear ganglia elicits brainstem responses. On depolarization, inner hair cells release almost no neurotransmitter. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310003L06Rik	G	T	5: 87,971,689	V102L	probably benign	Het
Adck1	T	C	12: 88,402,084	Y111H	probably damaging	Het
Adcy10	G	T	1: 165,518,403	K340N	probably damaging	Het
Aebp1	T	C	11: 5,870,089	V355A	probably damaging	Het
Atp2b2	T	C	6: 113,774,201		probably benign	Het
Atrn	T	C	2: 130,957,080	V390A	probably benign	Het
Bpifc	T	A	10: 85,977,735	Q315L	probably benign	Het
C1qtnf6	T	G	15: 78,524,892		probably null	Het
Cab39l	A	G	14: 59,519,737		probably benign	Het
Capn12	T	A	7: 28,882,764		probably benign	Het
Ceacam18	A	C	7: 43,639,355	T177P	possibly damaging	Het
Ces5a	A	T	8: 93,525,665	F200I	probably damaging	Het
Cldn19	G	T	4: 119,257,051		probably null	Het
Cntnap2	A	G	6: 46,530,679	S46P	probably damaging	Het
Dchs1	A	G	7: 105,764,525	Y1028H	probably damaging	Het
Exd1	A	T	2: 119,524,674	F253L	probably damaging	Het
Fam161a	A	G	11: 23,015,826	N40D	possibly damaging	Het
Fam81a	A	T	9: 70,125,108	I34N	probably damaging	Het
Fchsd1	A	C	18: 37,965,897		probably null	Het
Fut11	T	A	14: 20,696,166	F359I	possibly damaging	Het
Fut7	T	C	2: 25,425,147	V92A	probably damaging	Het
Grid2	C	G	6: 64,429,754	F699L	possibly damaging	Het
Grin2a	A	G	16: 9,663,603	S445P	possibly damaging	Het
H2al2b	A	C	Y: 2,720,391	F95C	probably damaging	Het
Hecw2	T	C	1: 53,851,618	D1246G	probably damaging	Het
Ifit1	A	G	19: 34,647,632	N56S	probably damaging	Het
Ldb3	C	A	14: 34,555,356	V354L	probably benign	Het
Lrig2	T	C	3: 104,463,876	Y479C	probably benign	Het
Ltn1	A	G	16: 87,381,556	V1595A	probably damaging	Het
Macf1	A	G	4: 123,432,530	V2939A	possibly damaging	Het
Mapre3	T	G	5: 30,861,917	I35S	probably damaging	Het
Med16	A	T	10: 79,898,316	L588Q	probably damaging	Het
Ncapg2	T	C	12: 116,434,578		probably benign	Het
Ncstn	C	A	1: 172,072,149	R322L	possibly damaging	Het
Ndst1	A	T	18: 60,698,504	I594N	probably damaging	Het
Ndst3	A	G	3: 123,548,906	I752T	possibly damaging	Het
Obscn	G	T	11: 59,115,855	S1185R	probably damaging	Het
Olfr1466	T	A	19: 13,342,122	C121*	probably null	Het
Olfr1500	A	T	19: 13,828,315	L27H	probably damaging	Het
Olfr303	A	G	7: 86,394,812	S229P	probably benign	Het
Pcnx2	A	G	8: 125,891,141	I125T	probably benign	Het
Pde4a	T	C	9: 21,201,247	S240P	probably damaging	Het
Pi15	T	C	1: 17,619,852	S126P	probably benign	Het
Pkhd1	T	C	1: 20,117,780	S3435G	probably damaging	Het
Plin1	C	A	7: 79,726,590	V133L	probably benign	Het
Pnpt1	T	A	11: 29,130,776	C7S	unknown	Het
Ppp3ca	A	T	3: 136,797,818	M51L	probably benign	Het
Primpol	G	T	8: 46,586,467		probably benign	Het
Prlr	T	C	15: 10,319,333	V116A	probably damaging	Het
Rnf139	A	G	15: 58,889,417	D35G	probably damaging	Het
Rsbn1l	T	A	5: 20,951,673	K38M	probably damaging	Het
Ryr3	T	A	2: 112,869,082	I888F	probably damaging	Het
Sec16a	C	A	2: 26,428,382	V1566F	probably damaging	Het
Sin3b	A	G	8: 72,753,287	T874A	probably benign	Het
Slc5a5	A	C	8: 70,892,334	Y110D	probably damaging	Het
Smarcd2	C	T	11: 106,267,152	V97I	probably benign	Het
St6galnac2	G	A	11: 116,684,487		probably benign	Het
Tbc1d22b	T	C	17: 29,570,611	L149P	probably damaging	Het
Tekt2	T	C	4: 126,323,649	I208V	probably benign	Het
Tenm3	A	G	8: 48,228,981	I2522T	possibly damaging	Het
Ttc37	T	A	13: 76,138,372	D891E	probably benign	Het
Ttll5	T	A	12: 85,864,568	Y233*	probably null	Het
Vcpip1	C	T	1: 9,724,502	E1215K	probably damaging	Het
Wdr4	T	C	17: 31,509,763		probably benign	Het
Zadh2	A	G	18: 84,094,706	E169G	probably benign	Het
Zfp703	G	A	8: 26,979,373	G355D	probably damaging	Het
Zfp830	T	A	11: 82,764,968	D199E	probably damaging	Het

Other mutations in Otof

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Otof	APN	5	30375904	missense	probably damaging	1.00
IGL00391:Otof	APN	5	30375623	missense	probably damaging	1.00
IGL00579:Otof	APN	5	30399322	missense	possibly damaging	0.88
IGL00671:Otof	APN	5	30385753	critical splice donor site	probably null
IGL01019:Otof	APN	5	30405216	missense	probably benign	0.01
IGL01025:Otof	APN	5	30384253	missense	possibly damaging	0.82
IGL01086:Otof	APN	5	30376273	critical splice donor site	probably null
IGL01110:Otof	APN	5	30461725	missense	probably damaging	1.00
IGL01160:Otof	APN	5	30381535	missense	probably benign	0.00
IGL01285:Otof	APN	5	30405183	missense	probably damaging	1.00
IGL01329:Otof	APN	5	30441379	missense	probably benign	0.00
IGL01337:Otof	APN	5	30405777	missense	possibly damaging	0.93
IGL01337:Otof	APN	5	30419512	missense	probably benign	0.17
IGL01834:Otof	APN	5	30399220	missense	probably damaging	1.00
IGL01872:Otof	APN	5	30379254	splice site	probably benign
IGL01969:Otof	APN	5	30382483	splice site	probably benign
IGL02075:Otof	APN	5	30370726	missense	probably benign	0.23
IGL02077:Otof	APN	5	30399235	missense	probably damaging	1.00
IGL02136:Otof	APN	5	30373992	missense	possibly damaging	0.90
IGL02227:Otof	APN	5	30370784	missense	probably damaging	1.00
IGL02475:Otof	APN	5	30376682	missense	probably damaging	1.00
IGL02812:Otof	APN	5	30374082	missense	probably benign	0.08
IGL02864:Otof	APN	5	30386341	missense	probably damaging	0.99
IGL03176:Otof	APN	5	30405176	splice site	probably null
R0285:Otof	UTSW	5	30379533	critical splice donor site	probably null
R0421:Otof	UTSW	5	30371568	missense	possibly damaging	0.94
R0570:Otof	UTSW	5	30371881	splice site	probably benign
R0599:Otof	UTSW	5	30370705	missense	probably damaging	1.00
R0675:Otof	UTSW	5	30382361	missense	probably benign	0.01
R0715:Otof	UTSW	5	30394697	missense	probably damaging	0.99
R1019:Otof	UTSW	5	30370743	missense	probably damaging	0.96
R1183:Otof	UTSW	5	30371912	missense	probably damaging	1.00
R1435:Otof	UTSW	5	30378695	missense	probably benign	0.00
R1469:Otof	UTSW	5	30380227	missense	probably benign	0.00
R1469:Otof	UTSW	5	30380227	missense	probably benign	0.00
R1474:Otof	UTSW	5	30379532	critical splice donor site	probably null
R1563:Otof	UTSW	5	30371005	missense	probably benign	0.00
R1732:Otof	UTSW	5	30386471	missense	probably damaging	1.00
R1822:Otof	UTSW	5	30378710	missense	probably benign	0.00
R1845:Otof	UTSW	5	30371723	nonsense	probably null
R1925:Otof	UTSW	5	30394188	missense	probably benign	0.37
R1938:Otof	UTSW	5	30376369	missense	probably benign	0.00
R1968:Otof	UTSW	5	30388654	missense	probably damaging	1.00
R1996:Otof	UTSW	5	30421037	missense	probably benign	0.01
R1999:Otof	UTSW	5	30388772	missense	probably benign	0.19
R2027:Otof	UTSW	5	30421014	missense	probably benign	0.08
R2138:Otof	UTSW	5	30461770	missense	probably benign	0.01
R2173:Otof	UTSW	5	30386374	missense	probably damaging	1.00
R2245:Otof	UTSW	5	30370207	missense	probably damaging	1.00
R3011:Otof	UTSW	5	30382840	missense	probably damaging	1.00
R3105:Otof	UTSW	5	30381801	missense	probably benign	0.03
R3442:Otof	UTSW	5	30371689	missense	probably damaging	1.00
R3710:Otof	UTSW	5	30385266	missense	probably benign
R3715:Otof	UTSW	5	30376871	nonsense	probably null
R3806:Otof	UTSW	5	30386499	critical splice acceptor site	probably null
R3975:Otof	UTSW	5	30370712	missense	probably damaging	1.00
R4067:Otof	UTSW	5	30399291	missense	probably damaging	1.00
R4077:Otof	UTSW	5	30419506	missense	possibly damaging	0.89
R4166:Otof	UTSW	5	30382418	missense	probably damaging	1.00
R4451:Otof	UTSW	5	30385164	missense	possibly damaging	0.77
R4485:Otof	UTSW	5	30375000	missense	possibly damaging	0.77
R4600:Otof	UTSW	5	30371900	missense	probably damaging	1.00
R4646:Otof	UTSW	5	30383570	missense	possibly damaging	0.82
R4648:Otof	UTSW	5	30383570	missense	possibly damaging	0.82
R4669:Otof	UTSW	5	30420974	critical splice donor site	probably null
R4773:Otof	UTSW	5	30394682	missense	probably benign	0.05
R4839:Otof	UTSW	5	30419404	missense	probably damaging	0.99
R4907:Otof	UTSW	5	30378661	critical splice donor site	probably null
R4961:Otof	UTSW	5	30383493	intron	probably benign
R4991:Otof	UTSW	5	30394181	missense	probably damaging	1.00
R5015:Otof	UTSW	5	30382894	missense	probably damaging	1.00
R5036:Otof	UTSW	5	30384439	missense	possibly damaging	0.54
R5038:Otof	UTSW	5	30384439	missense	possibly damaging	0.54
R5253:Otof	UTSW	5	30370139	missense	probably damaging	1.00
R5336:Otof	UTSW	5	30376720	missense	probably benign	0.01
R5365:Otof	UTSW	5	30381800	missense	probably damaging	0.99
R5901:Otof	UTSW	5	30374979	missense	probably damaging	1.00
R6211:Otof	UTSW	5	30371900	missense	probably damaging	0.99
R6318:Otof	UTSW	5	30414544	missense	probably damaging	1.00
R6331:Otof	UTSW	5	30371935	missense	possibly damaging	0.94
R6671:Otof	UTSW	5	30419533	missense	probably benign
R6701:Otof	UTSW	5	30370797	nonsense	probably null
R6792:Otof	UTSW	5	30375634	missense	probably damaging	1.00
R6853:Otof	UTSW	5	30388239	missense	probably damaging	1.00
R6940:Otof	UTSW	5	30371643	missense	probably damaging	0.96
R7037:Otof	UTSW	5	30381538	missense	probably benign	0.32
R7060:Otof	UTSW	5	30388356	missense	possibly damaging	0.84
R7089:Otof	UTSW	5	30371568	missense	possibly damaging	0.94
R7165:Otof	UTSW	5	30375620	missense	probably damaging	0.99
R7178:Otof	UTSW	5	30383534	missense	possibly damaging	0.50
R7298:Otof	UTSW	5	30388270	missense	probably damaging	1.00
R7393:Otof	UTSW	5	30370270	missense	probably benign	0.45
R7397:Otof	UTSW	5	30375707	missense	probably damaging	1.00
R7400:Otof	UTSW	5	30385188	missense	probably benign	0.04
R7428:Otof	UTSW	5	30389825	missense	probably damaging	1.00
R7456:Otof	UTSW	5	30394661	missense	probably damaging	1.00
R7505:Otof	UTSW	5	30371020	missense	probably benign	0.00
R7714:Otof	UTSW	5	30370253	missense	probably damaging	0.99
R8002:Otof	UTSW	5	30380610	missense	probably benign	0.10
R8032:Otof	UTSW	5	30461798	start codon destroyed	probably benign	0.07
R8153:Otof	UTSW	5	30388735	missense	probably damaging	1.00
R8158:Otof	UTSW	5	30380194	missense	probably benign	0.37
R8159:Otof	UTSW	5	30380194	missense	probably benign	0.37
R8441:Otof	UTSW	5	30380856	missense	probably damaging	0.99
R8738:Otof	UTSW	5	30388624	nonsense	probably null
R8813:Otof	UTSW	5	30382898	missense	probably benign	0.02
R8835:Otof	UTSW	5	30370920	missense	probably benign	0.44
R8852:Otof	UTSW	5	30371700	missense	possibly damaging	0.94
R8869:Otof	UTSW	5	30420981	missense	probably benign	0.08
R9029:Otof	UTSW	5	30370075	critical splice donor site	probably null
R9031:Otof	UTSW	5	30380188	missense	probably benign
R9061:Otof	UTSW	5	30388657	missense	possibly damaging	0.50
R9100:Otof	UTSW	5	30382352	missense	possibly damaging	0.80
R9121:Otof	UTSW	5	30379118	missense	probably benign	0.04
R9188:Otof	UTSW	5	30376751	missense	probably damaging	1.00
R9218:Otof	UTSW	5	30385125	missense	probably benign
R9280:Otof	UTSW	5	30371550	missense	probably damaging	0.98
R9395:Otof	UTSW	5	30375632	missense	probably damaging	1.00
R9400:Otof	UTSW	5	30383519	critical splice donor site	probably null
R9407:Otof	UTSW	5	30380921	missense	probably damaging	1.00
R9616:Otof	UTSW	5	30382364	missense	possibly damaging	0.95
R9665:Otof	UTSW	5	30427551	missense	probably benign	0.22
R9748:Otof	UTSW	5	30383654	missense	probably damaging	1.00
R9783:Otof	UTSW	5	30379232	missense	probably benign
Z1176:Otof	UTSW	5	30371586	missense	probably damaging	0.98
Z1177:Otof	UTSW	5	30376297	missense	probably damaging	1.00
Z1177:Otof	UTSW	5	30383658	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCCTGAATGATTCCTATCCACTGCG -3'
(R):5'- ACCTGCTCTTCTGAATGTGAATGCC -3'

Sequencing Primer
(F):5'- ATACTGCTGTGAGTCCACCAATG -3'
(R):5'- GTGAATGCCTTATAGGCAAGAGC -3'

Posted On

2014-04-13