Incidental Mutation 'R7040:Olfr668'
ID 546996
Institutional Source Beutler Lab
Gene Symbol Olfr668
Ensembl Gene ENSMUSG00000057770
Gene Name olfactory receptor 668
Synonyms GA_x6K02T2PBJ9-7554614-7553658, MOR34-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock # R7040 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 104922291-104928057 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 104925510 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 85 (C85S)
Ref Sequence ENSEMBL: ENSMUSP00000150824 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164391] [ENSMUST00000215359] [ENSMUST00000217177]
AlphaFold Q8VGW3
Predicted Effect probably benign
Transcript: ENSMUST00000164391
AA Change: C85S

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000130975
Gene: ENSMUSG00000057770
AA Change: C85S

DomainStartEndE-ValueType
Pfam:7tm_4 33 313 7.2e-103 PFAM
Pfam:7TM_GPCR_Srsx 37 210 4.7e-10 PFAM
Pfam:7tm_1 43 295 4.6e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215359
AA Change: C85S

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000217177
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A G 7: 128,236,725 L232P possibly damaging Het
Acaa1a T C 9: 119,349,038 V312A probably damaging Het
Bmp2 A G 2: 133,561,684 D385G probably damaging Het
C1qtnf9 T C 14: 60,779,792 V257A probably damaging Het
Cd3d G A 9: 44,985,693 V122I probably damaging Het
Cdc37 T C 9: 21,142,223 E199G probably damaging Het
Crb2 T A 2: 37,787,684 D326E probably benign Het
Cyp2c29 A C 19: 39,330,337 K420N possibly damaging Het
Cyp2g1 A C 7: 26,820,759 D472A probably damaging Het
Dab2 A C 15: 6,422,251 H116P probably damaging Het
Dnah7b G C 1: 46,236,809 E2619Q probably benign Het
Dsg4 A T 18: 20,451,852 M208L probably benign Het
Eif4enif1 T G 11: 3,234,040 V521G probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fpr-rs6 A G 17: 20,182,934 M55T probably damaging Het
Grhpr A G 4: 44,985,362 S101G probably damaging Het
Kif15 T A 9: 123,011,614 D33E possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lama4 A G 10: 39,060,162 Q611R possibly damaging Het
Lrrc47 T A 4: 154,020,452 *123R probably null Het
Map4k3 A C 17: 80,680,915 V36G probably damaging Het
Mme T A 3: 63,368,923 I707N probably damaging Het
Muc2 A G 7: 141,751,457 E166G unknown Het
Mucl1 T A 15: 103,753,578 T108S possibly damaging Het
Myo1h A T 5: 114,359,744 D53V possibly damaging Het
Naa15 T A 3: 51,472,784 L811Q possibly damaging Het
Nalcn T C 14: 123,287,855 T1487A probably benign Het
Nme8 A T 13: 19,694,328 L87H probably damaging Het
Nr2e1 A G 10: 42,568,378 V245A probably damaging Het
Nt5c2 A T 19: 46,893,535 F291Y possibly damaging Het
Olfr1337 T C 4: 118,781,986 M200V probably benign Het
Olfr1508 T C 14: 52,463,475 D178G possibly damaging Het
Olfr556 A T 7: 102,670,730 Q270L probably benign Het
Ooep T C 9: 78,378,401 N43S possibly damaging Het
Ovch2 A T 7: 107,796,565 I82N probably damaging Het
Palb2 A T 7: 122,114,399 M524K possibly damaging Het
Patj T C 4: 98,441,080 S524P probably benign Het
Patl1 T A 19: 11,929,954 Y401N possibly damaging Het
Pcdhb20 A T 18: 37,504,717 T99S probably benign Het
Plcb4 G A 2: 135,932,262 A155T probably benign Het
Rpap3 A G 15: 97,679,112 V585A possibly damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spen T A 4: 141,494,382 T302S unknown Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Ube2o T C 11: 116,541,860 E760G probably benign Het
Uimc1 T A 13: 55,075,454 probably null Het
Usp16 C T 16: 87,480,929 A689V probably damaging Het
Vmn2r60 G A 7: 42,142,242 A530T probably benign Het
Vps8 T A 16: 21,575,022 M1185K probably damaging Het
Vwa8 T C 14: 78,912,205 S136P probably damaging Het
Ythdc2 A G 18: 44,834,462 N175S probably benign Het
Zfp160 A T 17: 21,026,532 H448L probably damaging Het
Zfp90 T A 8: 106,425,009 C451* probably null Het
Zfp945 A G 17: 22,852,290 C212R probably damaging Het
Other mutations in Olfr668
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01664:Olfr668 APN 7 104925104 missense probably damaging 1.00
IGL02250:Olfr668 APN 7 104925015 missense probably damaging 1.00
IGL02743:Olfr668 APN 7 104924868 missense probably damaging 0.98
IGL03105:Olfr668 APN 7 104925764 unclassified probably benign
IGL03252:Olfr668 APN 7 104925387 missense probably benign 0.16
IGL03387:Olfr668 APN 7 104925373 missense probably benign 0.01
R1534:Olfr668 UTSW 7 104925414 missense possibly damaging 0.95
R2509:Olfr668 UTSW 7 104925687 missense probably benign 0.40
R2510:Olfr668 UTSW 7 104925687 missense probably benign 0.40
R4739:Olfr668 UTSW 7 104924810 missense possibly damaging 0.91
R4995:Olfr668 UTSW 7 104925735 missense probably benign 0.01
R5071:Olfr668 UTSW 7 104925493 missense probably benign
R5074:Olfr668 UTSW 7 104925493 missense probably benign
R5208:Olfr668 UTSW 7 104925726 missense probably benign
R5293:Olfr668 UTSW 7 104925279 missense probably benign 0.00
R6061:Olfr668 UTSW 7 104925392 missense probably benign 0.28
R6063:Olfr668 UTSW 7 104925392 missense probably benign 0.28
R6064:Olfr668 UTSW 7 104925392 missense probably benign 0.28
R6172:Olfr668 UTSW 7 104925296 missense probably benign 0.40
R6492:Olfr668 UTSW 7 104925645 missense possibly damaging 0.60
R6933:Olfr668 UTSW 7 104925123 missense probably benign 0.21
R7587:Olfr668 UTSW 7 104925056 missense probably benign 0.28
R7841:Olfr668 UTSW 7 104924859 missense possibly damaging 0.59
R7869:Olfr668 UTSW 7 104925104 missense probably damaging 1.00
R7902:Olfr668 UTSW 7 104925350 missense probably damaging 1.00
R8296:Olfr668 UTSW 7 104925621 missense probably benign 0.00
R8670:Olfr668 UTSW 7 104925212 missense probably damaging 0.98
R8680:Olfr668 UTSW 7 104925413 missense probably damaging 1.00
R8695:Olfr668 UTSW 7 104924939 missense probably benign 0.30
R9158:Olfr668 UTSW 7 104924879 missense probably damaging 1.00
R9261:Olfr668 UTSW 7 104925098 missense probably benign 0.04
Z1177:Olfr668 UTSW 7 104924993 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCCTCAAGAATGTTGCAAGAC -3'
(R):5'- TGGGCTGGAAGATGCACATG -3'

Sequencing Primer
(F):5'- TGTTGCAAGACAAGCCTTGGC -3'
(R):5'- GAAGATGCACATGTCTGGATCTCTC -3'
Posted On 2019-05-13