Incidental Mutation 'R7040:Cdc37'
ID 547002
Institutional Source Beutler Lab
Gene Symbol Cdc37
Ensembl Gene ENSMUSG00000019471
Gene Name cell division cycle 37
Synonyms p50Cdc37
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock # R7040 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 21133222-21149982 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 21142223 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 199 (E199G)
Ref Sequence ENSEMBL: ENSMUSP00000019615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019615] [ENSMUST00000215296]
AlphaFold Q61081
Predicted Effect probably damaging
Transcript: ENSMUST00000019615
AA Change: E199G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019615
Gene: ENSMUSG00000019471
AA Change: E199G

DomainStartEndE-ValueType
CDC37_N 1 128 1.07e-69 SMART
CDC37_M 121 283 4.37e-84 SMART
CDC37_C 287 379 1.25e-43 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000215296
AA Change: E248G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to Cdc 37, a cell division cycle control protein of Sacchromyces cerevisiae. This protein is a molecular chaperone with specific function in cell signal transduction. It has been shown to form complex with Hsp90 and a variety of protein kinases including CDK4, CDK6, SRC, RAF-1, MOK, as well as eIF2 alpha kinases. It is thought to play a critical role in directing Hsp90 to its target kinases. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A G 7: 128,236,725 L232P possibly damaging Het
Acaa1a T C 9: 119,349,038 V312A probably damaging Het
Bmp2 A G 2: 133,561,684 D385G probably damaging Het
C1qtnf9 T C 14: 60,779,792 V257A probably damaging Het
Cd3d G A 9: 44,985,693 V122I probably damaging Het
Crb2 T A 2: 37,787,684 D326E probably benign Het
Cyp2c29 A C 19: 39,330,337 K420N possibly damaging Het
Cyp2g1 A C 7: 26,820,759 D472A probably damaging Het
Dab2 A C 15: 6,422,251 H116P probably damaging Het
Dnah7b G C 1: 46,236,809 E2619Q probably benign Het
Dsg4 A T 18: 20,451,852 M208L probably benign Het
Eif4enif1 T G 11: 3,234,040 V521G probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fpr-rs6 A G 17: 20,182,934 M55T probably damaging Het
Grhpr A G 4: 44,985,362 S101G probably damaging Het
Kif15 T A 9: 123,011,614 D33E possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lama4 A G 10: 39,060,162 Q611R possibly damaging Het
Lrrc47 T A 4: 154,020,452 *123R probably null Het
Map4k3 A C 17: 80,680,915 V36G probably damaging Het
Mme T A 3: 63,368,923 I707N probably damaging Het
Muc2 A G 7: 141,751,457 E166G unknown Het
Mucl1 T A 15: 103,753,578 T108S possibly damaging Het
Myo1h A T 5: 114,359,744 D53V possibly damaging Het
Naa15 T A 3: 51,472,784 L811Q possibly damaging Het
Nalcn T C 14: 123,287,855 T1487A probably benign Het
Nme8 A T 13: 19,694,328 L87H probably damaging Het
Nr2e1 A G 10: 42,568,378 V245A probably damaging Het
Nt5c2 A T 19: 46,893,535 F291Y possibly damaging Het
Olfr1337 T C 4: 118,781,986 M200V probably benign Het
Olfr1508 T C 14: 52,463,475 D178G possibly damaging Het
Olfr556 A T 7: 102,670,730 Q270L probably benign Het
Olfr668 A T 7: 104,925,510 C85S probably benign Het
Ooep T C 9: 78,378,401 N43S possibly damaging Het
Ovch2 A T 7: 107,796,565 I82N probably damaging Het
Palb2 A T 7: 122,114,399 M524K possibly damaging Het
Patj T C 4: 98,441,080 S524P probably benign Het
Patl1 T A 19: 11,929,954 Y401N possibly damaging Het
Pcdhb20 A T 18: 37,504,717 T99S probably benign Het
Plcb4 G A 2: 135,932,262 A155T probably benign Het
Rpap3 A G 15: 97,679,112 V585A possibly damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spen T A 4: 141,494,382 T302S unknown Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Ube2o T C 11: 116,541,860 E760G probably benign Het
Uimc1 T A 13: 55,075,454 probably null Het
Usp16 C T 16: 87,480,929 A689V probably damaging Het
Vmn2r60 G A 7: 42,142,242 A530T probably benign Het
Vps8 T A 16: 21,575,022 M1185K probably damaging Het
Vwa8 T C 14: 78,912,205 S136P probably damaging Het
Ythdc2 A G 18: 44,834,462 N175S probably benign Het
Zfp160 A T 17: 21,026,532 H448L probably damaging Het
Zfp90 T A 8: 106,425,009 C451* probably null Het
Zfp945 A G 17: 22,852,290 C212R probably damaging Het
Other mutations in Cdc37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01943:Cdc37 APN 9 21143113 missense probably benign 0.00
IGL02448:Cdc37 APN 9 21139851 missense possibly damaging 0.55
IGL02547:Cdc37 APN 9 21139966 unclassified probably benign
R0137:Cdc37 UTSW 9 21142130 missense possibly damaging 0.74
R0195:Cdc37 UTSW 9 21142280 missense probably benign 0.01
R0523:Cdc37 UTSW 9 21142996 missense probably damaging 1.00
R0611:Cdc37 UTSW 9 21142241 missense probably damaging 1.00
R0629:Cdc37 UTSW 9 21140768 missense possibly damaging 0.72
R0755:Cdc37 UTSW 9 21139864 missense probably damaging 1.00
R1512:Cdc37 UTSW 9 21142416 splice site probably benign
R2127:Cdc37 UTSW 9 21149847 missense probably damaging 1.00
R2238:Cdc37 UTSW 9 21142533 nonsense probably null
R2239:Cdc37 UTSW 9 21142533 nonsense probably null
R3031:Cdc37 UTSW 9 21143191 missense possibly damaging 0.88
R5068:Cdc37 UTSW 9 21149803 missense probably damaging 0.98
R5169:Cdc37 UTSW 9 21141117 missense probably benign 0.00
R5308:Cdc37 UTSW 9 21140764 missense probably benign 0.00
R5333:Cdc37 UTSW 9 21143161 missense possibly damaging 0.69
R5595:Cdc37 UTSW 9 21143213 missense probably damaging 1.00
R7819:Cdc37 UTSW 9 21140964 missense probably damaging 0.97
R8066:Cdc37 UTSW 9 21143141 missense probably benign 0.01
R8500:Cdc37 UTSW 9 21140801 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGTACACAGGAGCTCATTACC -3'
(R):5'- GTTCCTGCACAAAGGCTAGG -3'

Sequencing Primer
(F):5'- CCTTGATCTTGGTGAAAAACTGCCG -3'
(R):5'- TTCCTGCACAAAGGCTAGGTTAGG -3'
Posted On 2019-05-13