Incidental Mutation 'R7040:Acaa1a'
ID 547005
Institutional Source Beutler Lab
Gene Symbol Acaa1a
Ensembl Gene ENSMUSG00000036138
Gene Name acetyl-Coenzyme A acyltransferase 1A
Synonyms thiolase A, PTL, peroxisomal 3-ketoacyl-CoA thiolase, Acaa1, D9Ertd25e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7040 (G1)
Quality Score 149.008
Status Not validated
Chromosome 9
Chromosomal Location 119339676-119350299 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 119349038 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 312 (V312A)
Ref Sequence ENSEMBL: ENSMUSP00000135439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039784] [ENSMUST00000170400] [ENSMUST00000175743] [ENSMUST00000176397] [ENSMUST00000176546] [ENSMUST00000177463]
AlphaFold Q921H8
Predicted Effect probably damaging
Transcript: ENSMUST00000039784
AA Change: V312A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042351
Gene: ENSMUSG00000036138
AA Change: V312A

DomainStartEndE-ValueType
Pfam:Thiolase_N 38 291 3.6e-88 PFAM
Pfam:Thiolase_C 298 421 3e-53 PFAM
Pfam:ACP_syn_III_C 329 420 1.8e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170400
SMART Domains Protein: ENSMUSP00000131982
Gene: ENSMUSG00000070280

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Sugar_tr 150 555 1.2e-28 PFAM
Pfam:MFS_1 178 514 7.6e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000175743
AA Change: V312A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135439
Gene: ENSMUSG00000036138
AA Change: V312A

DomainStartEndE-ValueType
Pfam:Thiolase_N 35 291 4.2e-90 PFAM
Pfam:Thiolase_C 298 337 8.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176397
SMART Domains Protein: ENSMUSP00000135191
Gene: ENSMUSG00000036138

DomainStartEndE-ValueType
Pfam:Thiolase_N 35 152 4.9e-38 PFAM
Pfam:Thiolase_N 148 246 4.8e-34 PFAM
Pfam:Thiolase_C 214 328 5.9e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176546
SMART Domains Protein: ENSMUSP00000134981
Gene: ENSMUSG00000036138

DomainStartEndE-ValueType
Pfam:Thiolase_N 1 110 4.1e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177463
SMART Domains Protein: ENSMUSP00000135310
Gene: ENSMUSG00000036138

DomainStartEndE-ValueType
Pfam:Thiolase_N 35 199 3.2e-50 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme operative in the beta-oxidation system of the peroxisomes. Deficiency of this enzyme leads to pseudo-Zellweger syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A G 7: 128,236,725 L232P possibly damaging Het
Bmp2 A G 2: 133,561,684 D385G probably damaging Het
C1qtnf9 T C 14: 60,779,792 V257A probably damaging Het
Cd3d G A 9: 44,985,693 V122I probably damaging Het
Cdc37 T C 9: 21,142,223 E199G probably damaging Het
Crb2 T A 2: 37,787,684 D326E probably benign Het
Cyp2c29 A C 19: 39,330,337 K420N possibly damaging Het
Cyp2g1 A C 7: 26,820,759 D472A probably damaging Het
Dab2 A C 15: 6,422,251 H116P probably damaging Het
Dnah7b G C 1: 46,236,809 E2619Q probably benign Het
Dsg4 A T 18: 20,451,852 M208L probably benign Het
Eif4enif1 T G 11: 3,234,040 V521G probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fpr-rs6 A G 17: 20,182,934 M55T probably damaging Het
Grhpr A G 4: 44,985,362 S101G probably damaging Het
Kif15 T A 9: 123,011,614 D33E possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lama4 A G 10: 39,060,162 Q611R possibly damaging Het
Lrrc47 T A 4: 154,020,452 *123R probably null Het
Map4k3 A C 17: 80,680,915 V36G probably damaging Het
Mme T A 3: 63,368,923 I707N probably damaging Het
Muc2 A G 7: 141,751,457 E166G unknown Het
Mucl1 T A 15: 103,753,578 T108S possibly damaging Het
Myo1h A T 5: 114,359,744 D53V possibly damaging Het
Naa15 T A 3: 51,472,784 L811Q possibly damaging Het
Nalcn T C 14: 123,287,855 T1487A probably benign Het
Nme8 A T 13: 19,694,328 L87H probably damaging Het
Nr2e1 A G 10: 42,568,378 V245A probably damaging Het
Nt5c2 A T 19: 46,893,535 F291Y possibly damaging Het
Olfr1337 T C 4: 118,781,986 M200V probably benign Het
Olfr1508 T C 14: 52,463,475 D178G possibly damaging Het
Olfr556 A T 7: 102,670,730 Q270L probably benign Het
Olfr668 A T 7: 104,925,510 C85S probably benign Het
Ooep T C 9: 78,378,401 N43S possibly damaging Het
Ovch2 A T 7: 107,796,565 I82N probably damaging Het
Palb2 A T 7: 122,114,399 M524K possibly damaging Het
Patj T C 4: 98,441,080 S524P probably benign Het
Patl1 T A 19: 11,929,954 Y401N possibly damaging Het
Pcdhb20 A T 18: 37,504,717 T99S probably benign Het
Plcb4 G A 2: 135,932,262 A155T probably benign Het
Rpap3 A G 15: 97,679,112 V585A possibly damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spen T A 4: 141,494,382 T302S unknown Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Ube2o T C 11: 116,541,860 E760G probably benign Het
Uimc1 T A 13: 55,075,454 probably null Het
Usp16 C T 16: 87,480,929 A689V probably damaging Het
Vmn2r60 G A 7: 42,142,242 A530T probably benign Het
Vps8 T A 16: 21,575,022 M1185K probably damaging Het
Vwa8 T C 14: 78,912,205 S136P probably damaging Het
Ythdc2 A G 18: 44,834,462 N175S probably benign Het
Zfp160 A T 17: 21,026,532 H448L probably damaging Het
Zfp90 T A 8: 106,425,009 C451* probably null Het
Zfp945 A G 17: 22,852,290 C212R probably damaging Het
Other mutations in Acaa1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0632:Acaa1a UTSW 9 119347818 unclassified probably benign
R3418:Acaa1a UTSW 9 119349490 critical splice acceptor site probably null
R4617:Acaa1a UTSW 9 119348940 missense probably damaging 1.00
R4908:Acaa1a UTSW 9 119348706 missense probably benign
R4912:Acaa1a UTSW 9 119342761 missense probably damaging 1.00
R6351:Acaa1a UTSW 9 119341564 nonsense probably null
R6586:Acaa1a UTSW 9 119349538 splice site probably null
R7500:Acaa1a UTSW 9 119344498 missense probably benign 0.00
R8993:Acaa1a UTSW 9 119349352 critical splice acceptor site probably null
R9173:Acaa1a UTSW 9 119341124 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TTCCACTCTGAGACCTGGAG -3'
(R):5'- CCCCAAGTTCAGCTCTATTGTG -3'

Sequencing Primer
(F):5'- ACTCTGAGACCTGGAGCTGAC -3'
(R):5'- GTGAGGTGCTAGCCTGACTCAC -3'
Posted On 2019-05-13