Incidental Mutation 'R0629:Tmem8b'
ID57743
Institutional Source Beutler Lab
Gene Symbol Tmem8b
Ensembl Gene ENSMUSG00000078716
Gene Nametransmembrane protein 8B
Synonyms
MMRRC Submission 038818-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R0629 (G1)
Quality Score197
Status Validated
Chromosome4
Chromosomal Location43668971-43692668 bp(+) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) T to G at 43669896 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056474] [ENSMUST00000107864] [ENSMUST00000107864] [ENSMUST00000107865] [ENSMUST00000107866] [ENSMUST00000143339] [ENSMUST00000167153]
Predicted Effect probably benign
Transcript: ENSMUST00000056474
SMART Domains Protein: ENSMUSP00000057398
Gene: ENSMUSG00000043633

DomainStartEndE-ValueType
low complexity region 81 105 N/A INTRINSIC
internal_repeat_1 119 164 1.12e-19 PROSPERO
internal_repeat_1 165 210 1.12e-19 PROSPERO
low complexity region 267 285 N/A INTRINSIC
Pfam:DUF4475 312 482 1.7e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107864
SMART Domains Protein: ENSMUSP00000103496
Gene: ENSMUSG00000078716

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
EGF 185 221 1.95e1 SMART
Pfam:DUF3522 229 415 2.1e-70 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107864
SMART Domains Protein: ENSMUSP00000103496
Gene: ENSMUSG00000078716

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
EGF 185 221 1.95e1 SMART
Pfam:DUF3522 229 415 2.1e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107865
SMART Domains Protein: ENSMUSP00000103497
Gene: ENSMUSG00000078716

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
EGF 185 221 1.95e1 SMART
Pfam:DUF3522 229 415 2.1e-70 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107866
AA Change: C131G

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103498
Gene: ENSMUSG00000078716
AA Change: C131G

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
low complexity region 45 71 N/A INTRINSIC
low complexity region 87 102 N/A INTRINSIC
low complexity region 115 137 N/A INTRINSIC
low complexity region 427 443 N/A INTRINSIC
EGF 606 642 1.95e1 SMART
Pfam:DUF3522 652 836 1.4e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134487
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141864
Predicted Effect probably null
Transcript: ENSMUST00000143339
SMART Domains Protein: ENSMUSP00000130133
Gene: ENSMUSG00000078716

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143774
Predicted Effect probably benign
Transcript: ENSMUST00000167153
SMART Domains Protein: ENSMUSP00000129760
Gene: ENSMUSG00000078716

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
EGF 185 221 1.95e1 SMART
Pfam:DUF3522 229 415 2.1e-70 PFAM
Meta Mutation Damage Score 0.8677 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 A T 17: 45,507,547 D86V probably damaging Het
Adamts14 G A 10: 61,211,624 Q733* probably null Het
Adcy10 A G 1: 165,543,105 D651G probably damaging Het
Apcdd1 T A 18: 62,933,970 C52S probably damaging Het
Bclaf1 T C 10: 20,333,426 S463P probably damaging Het
Cabcoco1 T C 10: 68,516,278 Y68C probably damaging Het
Cacna1f G A X: 7,620,434 S888N probably damaging Het
Cacna1g A G 11: 94,409,543 C2134R possibly damaging Het
Cdc37 A C 9: 21,140,768 M325R possibly damaging Het
Clca2 T A 3: 145,072,239 M762L probably benign Het
Cntn3 C T 6: 102,203,976 V753M probably damaging Het
Col6a6 A T 9: 105,727,165 probably benign Het
Dscaml1 A G 9: 45,721,418 D1194G probably damaging Het
Egfr G A 11: 16,869,333 G288S probably damaging Het
Fbxl17 G T 17: 63,471,414 N19K probably damaging Het
Fmo3 A G 1: 162,958,227 probably benign Het
Frmd6 T C 12: 70,883,762 Y219H probably damaging Het
Fuca1 T C 4: 135,925,644 V193A possibly damaging Het
Gm1141 G C X: 71,938,773 R296P possibly damaging Het
Gm7461 C T 8: 4,677,769 noncoding transcript Het
Gpc5 T A 14: 115,552,239 N508K possibly damaging Het
Iqch A T 9: 63,425,382 D1019E probably benign Het
Isyna1 A G 8: 70,594,708 Y27C probably damaging Het
Itgb8 T G 12: 119,202,481 H105P probably benign Het
Kbtbd11 C T 8: 15,027,572 P57L probably benign Het
Kcns3 A C 12: 11,092,558 C47G probably damaging Het
Kif21b A T 1: 136,172,157 probably null Het
Lama3 A T 18: 12,419,245 H418L possibly damaging Het
Lrit3 A G 3: 129,788,302 Y679H probably damaging Het
Lrrc19 T A 4: 94,638,252 D356V probably damaging Het
Morc2b A G 17: 33,135,807 M997T probably benign Het
Mroh9 T C 1: 163,060,636 H290R possibly damaging Het
Mtcl1 A T 17: 66,338,142 S1886T possibly damaging Het
Muc20 T C 16: 32,793,421 T529A possibly damaging Het
Myo7a A C 7: 98,085,466 L607R probably damaging Het
Myom2 T A 8: 15,069,783 F180I probably damaging Het
Myt1l G A 12: 29,811,485 E89K unknown Het
Nek2 A G 1: 191,831,317 N431S probably benign Het
Olfr1086 T A 2: 86,676,529 H268L possibly damaging Het
Olfr169 A T 16: 19,565,980 V301E possibly damaging Het
Oprm1 A T 10: 6,832,604 probably null Het
Oxsr1 A G 9: 119,241,784 probably benign Het
Pdgfrb G A 18: 61,078,648 probably null Het
Proser1 C A 3: 53,479,064 P789Q probably benign Het
Ptgs2 A G 1: 150,101,037 Q7R probably benign Het
Rab3d A G 9: 21,914,686 V144A probably benign Het
Ralgapb T A 2: 158,439,547 L167H probably damaging Het
Ranbp3 A G 17: 56,708,200 T301A possibly damaging Het
Rasgrf1 G A 9: 89,984,269 V587M probably damaging Het
Sec16b A G 1: 157,564,863 probably benign Het
Sin3b T C 8: 72,753,536 probably benign Het
Slc10a2 T C 8: 5,098,562 S128G probably benign Het
Tbl1xr1 G A 3: 22,210,401 V507I probably benign Het
Trak1 A T 9: 121,367,167 T22S probably benign Het
Trim30d A G 7: 104,487,655 I114T probably damaging Het
Ttc13 A T 8: 124,674,366 S624T probably damaging Het
Ttn T C 2: 76,828,130 probably benign Het
Vipr1 T A 9: 121,660,171 Y99* probably null Het
Vmn1r210 T C 13: 22,827,874 K81E probably damaging Het
Wwc1 T C 11: 35,853,472 Y841C probably benign Het
Xrcc4 A G 13: 90,000,905 probably benign Het
Zdhhc22 A T 12: 86,988,297 I127N probably damaging Het
Zdhhc7 A G 8: 120,088,046 L8P possibly damaging Het
Zfp664 C A 5: 124,885,595 L18I probably damaging Het
Other mutations in Tmem8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02137:Tmem8b APN 4 43689434 missense probably benign 0.15
IGL02677:Tmem8b APN 4 43686092 missense probably damaging 1.00
IGL03090:Tmem8b APN 4 43689721 missense probably damaging 0.99
IGL03379:Tmem8b APN 4 43685561 missense probably benign 0.42
R0321:Tmem8b UTSW 4 43674444 missense probably damaging 1.00
R0377:Tmem8b UTSW 4 43674005 missense probably damaging 1.00
R0456:Tmem8b UTSW 4 43685618 missense probably benign 0.04
R0646:Tmem8b UTSW 4 43690123 missense probably benign 0.01
R0690:Tmem8b UTSW 4 43674562 missense possibly damaging 0.69
R1484:Tmem8b UTSW 4 43690234 missense probably benign 0.01
R1558:Tmem8b UTSW 4 43681134 missense possibly damaging 0.95
R1733:Tmem8b UTSW 4 43690228 unclassified probably null
R1999:Tmem8b UTSW 4 43681300 missense probably damaging 0.99
R2414:Tmem8b UTSW 4 43673892 splice site probably benign
R3799:Tmem8b UTSW 4 43673892 splice site probably benign
R3820:Tmem8b UTSW 4 43689745 missense probably damaging 0.99
R3821:Tmem8b UTSW 4 43689745 missense probably damaging 0.99
R4581:Tmem8b UTSW 4 43685760 missense probably damaging 1.00
R4852:Tmem8b UTSW 4 43689713 missense probably damaging 0.99
R5214:Tmem8b UTSW 4 43673992 missense probably benign 0.09
R5311:Tmem8b UTSW 4 43673992 missense probably benign 0.09
R5448:Tmem8b UTSW 4 43673992 missense probably benign 0.09
R5449:Tmem8b UTSW 4 43673992 missense probably benign 0.09
R5450:Tmem8b UTSW 4 43673992 missense probably benign 0.09
R6245:Tmem8b UTSW 4 43690246 missense probably benign 0.14
R6615:Tmem8b UTSW 4 43682249 missense probably damaging 1.00
R6693:Tmem8b UTSW 4 43669837 missense probably benign 0.00
R6944:Tmem8b UTSW 4 43674465 missense probably damaging 1.00
R6994:Tmem8b UTSW 4 43690192 missense probably damaging 0.96
R7136:Tmem8b UTSW 4 43669845 missense possibly damaging 0.83
R7704:Tmem8b UTSW 4 43689461 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTGTCACAATTCCCAGCCCAGC -3'
(R):5'- ACTCAAGGAGTCAGGATGGACACC -3'

Sequencing Primer
(F):5'- ccagcccagcatctgac -3'
(R):5'- CTTGAGGACTATTAGCAACCTGC -3'
Posted On2013-07-11