Mutagenetix > Incidental Mutation

Incidental Mutation 'R0629:Fmo3'

57732

Institutional Source

Beutler Lab

Gene Symbol

Fmo3

Ensembl Gene

ENSMUSG00000026691

Gene Name

flavin containing monooxygenase 3

Synonyms

MMRRC Submission

038818-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0629 (G1)

Quality Score

169

Status

Validated

Chromosome

Chromosomal Location

162953800-162984528 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 162958227 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000028010 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028010]

AlphaFold

P97501

Predicted Effect

probably benign
Transcript: ENSMUST00000028010

SMART Domains

Protein: ENSMUSP00000028010
Gene: ENSMUSG00000026691

Domain	Start	End	E-Value	Type
Pfam:FMO-like	2	534	7.7e-286	PFAM
Pfam:Pyr_redox_2	3	245	4.4e-15	PFAM
Pfam:Pyr_redox_3	6	220	1.1e-11	PFAM
Pfam:NAD_binding_8	7	71	3.1e-7	PFAM
Pfam:K_oxygenase	79	224	6.7e-9	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.6%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Flavin-containing monooxygenases (FMO) are an important class of drug-metabolizing enzymes that catalyze the NADPH-dependent oxygenation of various nitrogen-,sulfur-, and phosphorous-containing xenobiotics such as therapeutic drugs, dietary compounds, pesticides, and other foreign compounds. The human FMO gene family is composed of 5 genes and multiple pseudogenes. FMO members have distinct developmental- and tissue-specific expression patterns. The expression of this FMO3 gene, the major FMO expressed in adult liver, can vary up to 20-fold between individuals. This inter-individual variation in FMO3 expression levels is likely to have significant effects on the rate at which xenobiotics are metabolised and, therefore, is of considerable interest to the pharmaceutical industry. This transmembrane protein localizes to the endoplasmic reticulum of many tissues. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. Mutations in this gene cause the disorder trimethylaminuria (TMAu) which is characterized by the accumulation and excretion of unmetabolized trimethylamine and a distinctive body odor. In healthy individuals, trimethylamine is primarily converted to the non odorous trimethylamine N-oxide.[provided by RefSeq, Jan 2016]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars2	A	T	17: 45,507,547	D86V	probably damaging	Het
Adamts14	G	A	10: 61,211,624	Q733*	probably null	Het
Adcy10	A	G	1: 165,543,105	D651G	probably damaging	Het
Apcdd1	T	A	18: 62,933,970	C52S	probably damaging	Het
Bclaf1	T	C	10: 20,333,426	S463P	probably damaging	Het
Cabcoco1	T	C	10: 68,516,278	Y68C	probably damaging	Het
Cacna1f	G	A	X: 7,620,434	S888N	probably damaging	Het
Cacna1g	A	G	11: 94,409,543	C2134R	possibly damaging	Het
Cdc37	A	C	9: 21,140,768	M325R	possibly damaging	Het
Clca2	T	A	3: 145,072,239	M762L	probably benign	Het
Cntn3	C	T	6: 102,203,976	V753M	probably damaging	Het
Col6a6	A	T	9: 105,727,165		probably benign	Het
Dscaml1	A	G	9: 45,721,418	D1194G	probably damaging	Het
Egfr	G	A	11: 16,869,333	G288S	probably damaging	Het
Fbxl17	G	T	17: 63,471,414	N19K	probably damaging	Het
Frmd6	T	C	12: 70,883,762	Y219H	probably damaging	Het
Fuca1	T	C	4: 135,925,644	V193A	possibly damaging	Het
Gm1141	G	C	X: 71,938,773	R296P	possibly damaging	Het
Gm7461	C	T	8: 4,677,769		noncoding transcript	Het
Gpc5	T	A	14: 115,552,239	N508K	possibly damaging	Het
Iqch	A	T	9: 63,425,382	D1019E	probably benign	Het
Isyna1	A	G	8: 70,594,708	Y27C	probably damaging	Het
Itgb8	T	G	12: 119,202,481	H105P	probably benign	Het
Kbtbd11	C	T	8: 15,027,572	P57L	probably benign	Het
Kcns3	A	C	12: 11,092,558	C47G	probably damaging	Het
Kif21b	A	T	1: 136,172,157		probably null	Het
Lama3	A	T	18: 12,419,245	H418L	possibly damaging	Het
Lrit3	A	G	3: 129,788,302	Y679H	probably damaging	Het
Lrrc19	T	A	4: 94,638,252	D356V	probably damaging	Het
Morc2b	A	G	17: 33,135,807	M997T	probably benign	Het
Mroh9	T	C	1: 163,060,636	H290R	possibly damaging	Het
Mtcl1	A	T	17: 66,338,142	S1886T	possibly damaging	Het
Muc20	T	C	16: 32,793,421	T529A	possibly damaging	Het
Myo7a	A	C	7: 98,085,466	L607R	probably damaging	Het
Myom2	T	A	8: 15,069,783	F180I	probably damaging	Het
Myt1l	G	A	12: 29,811,485	E89K	unknown	Het
Nek2	A	G	1: 191,831,317	N431S	probably benign	Het
Olfr1086	T	A	2: 86,676,529	H268L	possibly damaging	Het
Olfr169	A	T	16: 19,565,980	V301E	possibly damaging	Het
Oprm1	A	T	10: 6,832,604		probably null	Het
Oxsr1	A	G	9: 119,241,784		probably benign	Het
Pdgfrb	G	A	18: 61,078,648		probably null	Het
Proser1	C	A	3: 53,479,064	P789Q	probably benign	Het
Ptgs2	A	G	1: 150,101,037	Q7R	probably benign	Het
Rab3d	A	G	9: 21,914,686	V144A	probably benign	Het
Ralgapb	T	A	2: 158,439,547	L167H	probably damaging	Het
Ranbp3	A	G	17: 56,708,200	T301A	possibly damaging	Het
Rasgrf1	G	A	9: 89,984,269	V587M	probably damaging	Het
Sec16b	A	G	1: 157,564,863		probably benign	Het
Sin3b	T	C	8: 72,753,536		probably benign	Het
Slc10a2	T	C	8: 5,098,562	S128G	probably benign	Het
Tbl1xr1	G	A	3: 22,210,401	V507I	probably benign	Het
Tmem8b	T	G	4: 43,669,896		probably null	Het
Trak1	A	T	9: 121,367,167	T22S	probably benign	Het
Trim30d	A	G	7: 104,487,655	I114T	probably damaging	Het
Ttc13	A	T	8: 124,674,366	S624T	probably damaging	Het
Ttn	T	C	2: 76,828,130		probably benign	Het
Vipr1	T	A	9: 121,660,171	Y99*	probably null	Het
Vmn1r210	T	C	13: 22,827,874	K81E	probably damaging	Het
Wwc1	T	C	11: 35,853,472	Y841C	probably benign	Het
Xrcc4	A	G	13: 90,000,905		probably benign	Het
Zdhhc22	A	T	12: 86,988,297	I127N	probably damaging	Het
Zdhhc7	A	G	8: 120,088,046	L8P	possibly damaging	Het
Zfp664	C	A	5: 124,885,595	L18I	probably damaging	Het

Other mutations in Fmo3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00975:Fmo3	APN	1	162964030	missense	probably benign	0.15
IGL01124:Fmo3	APN	1	162958261	missense	probably damaging	1.00
IGL01645:Fmo3	APN	1	162964006	missense	possibly damaging	0.53
IGL01710:Fmo3	APN	1	162983043	missense	probably damaging	1.00
IGL01943:Fmo3	APN	1	162967006	missense	probably benign	0.01
IGL02489:Fmo3	APN	1	162954287	missense	possibly damaging	0.75
IGL02503:Fmo3	APN	1	162968864	missense	probably benign	0.03
IGL02743:Fmo3	APN	1	162958483	missense	probably damaging	1.00
IGL02974:Fmo3	APN	1	162983050	missense	probably damaging	1.00
IGL03023:Fmo3	APN	1	162958465	missense	probably benign	0.00
R0554:Fmo3	UTSW	1	162954332	missense	probably benign	0.03
R1209:Fmo3	UTSW	1	162964028	missense	probably benign	0.00
R1213:Fmo3	UTSW	1	162967823	missense	probably damaging	1.00
R1612:Fmo3	UTSW	1	162967885	missense	probably damaging	1.00
R1636:Fmo3	UTSW	1	162954425	missense	probably benign
R1710:Fmo3	UTSW	1	162967787	missense	possibly damaging	0.59
R1764:Fmo3	UTSW	1	162958573	missense	possibly damaging	0.79
R1775:Fmo3	UTSW	1	162968725	missense	possibly damaging	0.54
R1906:Fmo3	UTSW	1	162966906	missense	probably damaging	1.00
R2363:Fmo3	UTSW	1	162954315	missense	probably damaging	0.98
R2418:Fmo3	UTSW	1	162966958	missense	probably benign
R2519:Fmo3	UTSW	1	162958305	missense	probably damaging	1.00
R3940:Fmo3	UTSW	1	162963986	missense	probably benign	0.01
R3977:Fmo3	UTSW	1	162958578	missense	probably damaging	0.99
R4779:Fmo3	UTSW	1	162968838	missense	probably damaging	1.00
R4846:Fmo3	UTSW	1	162954311	missense	possibly damaging	0.94
R4892:Fmo3	UTSW	1	162968731	missense	probably benign	0.00
R5102:Fmo3	UTSW	1	162963977	missense	probably benign	0.01
R5516:Fmo3	UTSW	1	162954426	nonsense	probably null
R6035:Fmo3	UTSW	1	162964036	missense	probably damaging	0.97
R6035:Fmo3	UTSW	1	162964036	missense	probably damaging	0.97
R7050:Fmo3	UTSW	1	162963904	missense	probably damaging	0.98
R7088:Fmo3	UTSW	1	162968865	missense	probably benign	0.04
R7205:Fmo3	UTSW	1	162954288	missense	possibly damaging	0.90
R7371:Fmo3	UTSW	1	162954227	missense	possibly damaging	0.57
R7685:Fmo3	UTSW	1	162958332	missense	possibly damaging	0.73
R8458:Fmo3	UTSW	1	162966940	missense	possibly damaging	0.89
R8821:Fmo3	UTSW	1	162968838	missense	probably damaging	1.00
R9371:Fmo3	UTSW	1	162968712	missense	probably benign	0.18
R9564:Fmo3	UTSW	1	162958452	missense	probably damaging	1.00
R9764:Fmo3	UTSW	1	162966955	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AAGCGACCATCTTCCCAGAAAGTG -3'
(R):5'- GGACCATGTTTGAGGCCATTGACTG -3'

Sequencing Primer
(F):5'- GGACTCAGGTAATAGTCAGTTTCCAG -3'
(R):5'- AGGCCATTGACTGTGTCATC -3'

Posted On

2013-07-11