Incidental Mutation 'R8073:Tmc1'
ID 620383
Institutional Source Beutler Lab
Gene Symbol Tmc1
Ensembl Gene ENSMUSG00000024749
Gene Name transmembrane channel-like gene family 1
Synonyms 4933416G09Rik, Beethoven, Bth
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock # R8073 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 20783458-20954202 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 20868361 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 166 (N166S)
Ref Sequence ENSEMBL: ENSMUSP00000040859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039500]
AlphaFold Q8R4P5
Predicted Effect probably benign
Transcript: ENSMUST00000039500
AA Change: N166S

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000040859
Gene: ENSMUSG00000024749
AA Change: N166S

DomainStartEndE-ValueType
SCOP:d1eq1a_ 2 95 3e-3 SMART
low complexity region 129 150 N/A INTRINSIC
transmembrane domain 184 206 N/A INTRINSIC
transmembrane domain 265 287 N/A INTRINSIC
low complexity region 295 302 N/A INTRINSIC
transmembrane domain 357 379 N/A INTRINSIC
transmembrane domain 431 453 N/A INTRINSIC
Pfam:TMC 512 627 2.6e-36 PFAM
transmembrane domain 632 654 N/A INTRINSIC
transmembrane domain 693 715 N/A INTRINSIC
low complexity region 738 754 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is considered a member of a gene family predicted to encode transmembrane proteins. The specific function of this gene is unknown; however, it is known to be required for normal function of cochlear hair cells. Mutations in this gene have been associated with progressive postlingual hearing loss and profound prelingual deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice are characterized by progressive degeneration of the cochlear inner hair cells and concomitant deafness. Different alleles causing progressive deafness or profound congenital deafness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago1 C T 4: 126,443,226 V533I probably benign Het
Akap3 A T 6: 126,865,773 T452S probably damaging Het
Angpt1 C T 15: 42,438,303 M436I probably benign Het
B3galt4 T C 17: 33,950,823 K147R probably damaging Het
Birc6 C A 17: 74,603,085 T1491K probably damaging Het
Boll T C 1: 55,355,722 probably benign Het
C6 T C 15: 4,735,193 F124L probably benign Het
Camta1 T C 4: 151,078,824 Y436C probably damaging Het
Celsr1 T C 15: 85,939,155 N1684S probably benign Het
Cflar T C 1: 58,752,822 L428P Het
Clk4 T C 11: 51,277,889 I363T probably benign Het
Cnst A G 1: 179,606,437 T273A probably benign Het
Col5a1 C T 2: 27,962,129 A546V possibly damaging Het
Col6a6 T A 9: 105,781,947 N600Y probably benign Het
Cxadr A G 16: 78,333,413 N156S probably benign Het
Diaph1 C T 18: 37,891,797 G537E unknown Het
Dmxl1 T A 18: 49,878,433 V1219D probably damaging Het
Dnajb12 T A 10: 59,890,179 Y95* probably null Het
Dnajc5g A G 5: 31,111,685 T137A probably benign Het
Dpy19l3 G A 7: 35,729,748 T89M probably damaging Het
Dusp19 C A 2: 80,617,484 T34N probably benign Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Enpp1 A G 10: 24,679,244 V68A possibly damaging Het
Epha7 T A 4: 28,821,022 D62E probably damaging Het
Frmd4b A T 6: 97,306,713 V445E probably benign Het
Gp9 A C 6: 87,779,354 D117A probably benign Het
Haao T C 17: 83,835,220 E152G possibly damaging Het
Ighd A G 12: 113,416,169 S52P probably benign Het
Ikzf3 T C 11: 98,467,429 K361E probably benign Het
Lgi2 T A 5: 52,546,671 E206V probably benign Het
Mfsd11 T A 11: 116,863,923 V220E probably benign Het
Moxd1 G T 10: 24,252,950 G200C probably damaging Het
Mthfd1l C A 10: 3,973,417 Q55K probably benign Het
Nlrp9a T A 7: 26,560,835 L672M probably damaging Het
Npvf A C 6: 50,654,369 F9V probably damaging Het
Nup205 G T 6: 35,202,169 probably null Het
Nup43 T C 10: 7,670,949 V111A probably benign Het
Obscn C T 11: 59,135,690 R229H probably benign Het
Olfml2a C A 2: 38,957,754 R442S probably damaging Het
Olfr12 T A 1: 92,620,084 D59E probably damaging Het
Olfr1225 T A 2: 89,170,940 I91F probably damaging Het
Olfr1445 T A 19: 12,884,616 V245E probably benign Het
Olfr418 A G 1: 173,270,985 D270G probably benign Het
Olfr698 C A 7: 106,752,801 E196* probably null Het
Pcdhga7 T C 18: 37,715,345 F135S probably damaging Het
Pde4a A T 9: 21,210,769 I654F probably damaging Het
Pip5kl1 G A 2: 32,583,428 R359Q possibly damaging Het
Ppp2ca T C 11: 52,119,297 V244A possibly damaging Het
Qrich1 T A 9: 108,534,428 L384H possibly damaging Het
Rab4a T C 8: 123,827,396 V62A possibly damaging Het
Ranbp10 A G 8: 105,786,629 L217P probably damaging Het
Rhebl1 C T 15: 98,878,524 A131T probably benign Het
Rnf150 A T 8: 82,863,917 probably benign Het
Slc32a1 G A 2: 158,614,765 A447T probably damaging Het
Spag5 T A 11: 78,301,977 M45K probably benign Het
Spata13 A G 14: 60,691,256 N88D probably damaging Het
Spred2 C A 11: 20,008,422 T128N probably benign Het
Tenm2 T C 11: 36,139,644 E776G possibly damaging Het
Tet1 C G 10: 62,813,353 E156Q probably damaging Het
Trim43a C A 9: 88,582,437 Q134K possibly damaging Het
Tsks A T 7: 44,957,881 M543L probably benign Het
Ttc30a2 A G 2: 75,976,653 V505A probably damaging Het
Ttn T C 2: 76,743,837 K25571E probably damaging Het
Vamp5 C A 6: 72,380,453 probably benign Het
Vmn2r79 A T 7: 87,002,254 Q287L probably benign Het
Zfp326 T A 5: 105,914,816 V517E unknown Het
Zfp467 A T 6: 48,438,025 H564Q probably damaging Het
Zfp51 G A 17: 21,464,032 C303Y probably damaging Het
Other mutations in Tmc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01639:Tmc1 APN 19 20816192 missense probably damaging 1.00
IGL02104:Tmc1 APN 19 20832454 missense probably benign 0.00
IGL02245:Tmc1 APN 19 20799192 missense probably damaging 1.00
IGL02544:Tmc1 APN 19 20906963 missense probably benign 0.04
IGL02699:Tmc1 APN 19 20832350 critical splice donor site probably null
IGL02974:Tmc1 APN 19 20900844 missense probably benign
IGL03194:Tmc1 APN 19 20804653 missense probably damaging 1.00
dinner_bell UTSW 19 20795516 missense probably damaging 0.99
R0255:Tmc1 UTSW 19 20789587 missense possibly damaging 0.93
R0381:Tmc1 UTSW 19 20799045 missense probably damaging 1.00
R0655:Tmc1 UTSW 19 20799176 missense probably damaging 1.00
R1404:Tmc1 UTSW 19 20816184 missense possibly damaging 0.79
R1404:Tmc1 UTSW 19 20816184 missense possibly damaging 0.79
R1496:Tmc1 UTSW 19 20868355 missense probably damaging 1.00
R1542:Tmc1 UTSW 19 20816122 missense probably damaging 1.00
R1773:Tmc1 UTSW 19 20826501 splice site probably null
R1777:Tmc1 UTSW 19 20816109 critical splice donor site probably null
R2067:Tmc1 UTSW 19 20824309 missense possibly damaging 0.90
R2152:Tmc1 UTSW 19 20856675 missense probably benign 0.01
R2180:Tmc1 UTSW 19 20824084 missense probably damaging 0.96
R2204:Tmc1 UTSW 19 20940905 missense probably benign 0.01
R2205:Tmc1 UTSW 19 20940905 missense probably benign 0.01
R2285:Tmc1 UTSW 19 20789799 missense probably damaging 0.96
R4505:Tmc1 UTSW 19 20868374 missense probably benign 0.00
R4752:Tmc1 UTSW 19 20826649 missense probably benign 0.35
R4975:Tmc1 UTSW 19 20906955 missense probably damaging 0.96
R5040:Tmc1 UTSW 19 20824030 missense possibly damaging 0.68
R5206:Tmc1 UTSW 19 20826660 missense probably damaging 1.00
R5400:Tmc1 UTSW 19 20804602 missense probably damaging 1.00
R5429:Tmc1 UTSW 19 20789622 missense possibly damaging 0.72
R6200:Tmc1 UTSW 19 20789590 missense possibly damaging 0.53
R6784:Tmc1 UTSW 19 20827651 critical splice donor site probably null
R6796:Tmc1 UTSW 19 20799036 missense probably damaging 1.00
R6808:Tmc1 UTSW 19 20795516 missense probably damaging 0.99
R6812:Tmc1 UTSW 19 20900861 missense probably damaging 1.00
R6834:Tmc1 UTSW 19 20795610 nonsense probably null
R6978:Tmc1 UTSW 19 20804635 missense probably damaging 1.00
R6986:Tmc1 UTSW 19 20824283 missense probably benign 0.02
R7027:Tmc1 UTSW 19 20940903 critical splice donor site probably null
R7378:Tmc1 UTSW 19 20868389 missense probably damaging 0.98
R7520:Tmc1 UTSW 19 20799178 missense probably damaging 0.99
R7573:Tmc1 UTSW 19 20907008 missense probably damaging 0.98
R7825:Tmc1 UTSW 19 20804645 missense possibly damaging 0.55
R8024:Tmc1 UTSW 19 20900817 missense probably damaging 1.00
R8786:Tmc1 UTSW 19 20826589 missense probably damaging 1.00
R8791:Tmc1 UTSW 19 20789845 missense probably benign 0.00
R8969:Tmc1 UTSW 19 20816229 missense probably damaging 1.00
R8973:Tmc1 UTSW 19 20900851 missense probably benign
R9429:Tmc1 UTSW 19 20816184 missense possibly damaging 0.79
Z1176:Tmc1 UTSW 19 20826506 missense probably null 1.00
Z1177:Tmc1 UTSW 19 20795608 missense possibly damaging 0.47
Z1177:Tmc1 UTSW 19 20823982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACAACGATGGAGTCAAGC -3'
(R):5'- AGTGAACCCTGCTGTTATGCC -3'

Sequencing Primer
(F):5'- CAACGATGGAGTCAAGCTTTGC -3'
(R):5'- GCAGTATTTCATGCCAGAGAGCTC -3'
Posted On 2020-01-23