Incidental Mutation 'R8140:Brox'
ID 643784
Institutional Source Beutler Lab
Gene Symbol Brox
Ensembl Gene ENSMUSG00000046836
Gene Name BRO1 domain and CAAX motif containing
Synonyms 0610010K06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock # R8140 (G1)
Quality Score 43.0073
Status Validated
Chromosome 1
Chromosomal Location 183276352-183297269 bp(-) (GRCm38)
Type of Mutation splice site (461 bp from exon)
DNA Base Change (assembly) A to T at 183293873 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057062] [ENSMUST00000109166] [ENSMUST00000163528] [ENSMUST00000192829] [ENSMUST00000193625] [ENSMUST00000193959] [ENSMUST00000194327] [ENSMUST00000195054]
AlphaFold Q8K2Q7
Predicted Effect probably null
Transcript: ENSMUST00000057062
SMART Domains Protein: ENSMUSP00000061345
Gene: ENSMUSG00000046836

DomainStartEndE-ValueType
BRO1 4 384 1.74e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109166
SMART Domains Protein: ENSMUSP00000104795
Gene: ENSMUSG00000042901

DomainStartEndE-ValueType
Pfam:Aida_N 9 112 1.9e-43 PFAM
low complexity region 122 144 N/A INTRINSIC
Pfam:Aida_C2 155 300 2.4e-68 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000163528
SMART Domains Protein: ENSMUSP00000132333
Gene: ENSMUSG00000046836

DomainStartEndE-ValueType
PDB:3ZXP|C 1 101 5e-63 PDB
Blast:BRO1 4 101 1e-67 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000192829
SMART Domains Protein: ENSMUSP00000141585
Gene: ENSMUSG00000046836

DomainStartEndE-ValueType
PDB:3ZXP|C 1 91 4e-55 PDB
Blast:BRO1 4 91 9e-59 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000193625
SMART Domains Protein: ENSMUSP00000141649
Gene: ENSMUSG00000042901

DomainStartEndE-ValueType
Pfam:Aida_N 8 113 2.3e-49 PFAM
low complexity region 122 144 N/A INTRINSIC
Pfam:Aida_C2 145 219 6.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193959
Predicted Effect probably benign
Transcript: ENSMUST00000194327
Predicted Effect probably benign
Transcript: ENSMUST00000195054
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 93.9%
Validation Efficiency 97% (64/66)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,611 V230E possibly damaging Het
Amotl1 G A 9: 14,572,715 probably null Het
Atp7b C A 8: 22,028,560 E87D probably damaging Het
Bcat2 C T 7: 45,588,351 P347L probably damaging Het
Cd37 A G 7: 45,238,535 I58T probably damaging Het
Cep295 A T 9: 15,341,533 M333K probably benign Het
Chtop A G 3: 90,505,393 probably null Het
Cpa2 A T 6: 30,544,905 K54N probably benign Het
Cpa6 A G 1: 10,325,294 S383P probably damaging Het
Dnah7a A T 1: 53,501,589 I2542N probably benign Het
Eif5b G A 1: 38,051,276 V1179I probably benign Het
Erbin T C 13: 103,920,294 probably null Het
Fastkd5 A T 2: 130,615,250 D473E possibly damaging Het
Fchsd1 T C 18: 37,964,342 E372G probably damaging Het
Fgl1 T C 8: 41,200,609 probably null Het
Fzd8 T G 18: 9,213,797 V293G probably damaging Het
Gm4787 T A 12: 81,378,151 H411L probably benign Het
Gm49380 G T 9: 44,111,972 D326E probably benign Het
Hcrtr1 G A 4: 130,135,290 R240C probably damaging Het
Hdac5 A T 11: 102,197,355 Y948N probably damaging Het
Hepacam A G 9: 37,383,871 S301G probably benign Het
Htra4 A T 8: 25,030,558 D362E possibly damaging Het
Ighv1-9 G A 12: 114,583,741 P60L probably damaging Het
Kcnq3 A G 15: 65,995,541 I751T probably damaging Het
Magi3 T C 3: 104,034,086 Y851C probably damaging Het
Mefv A G 16: 3,713,635 S470P probably benign Het
Mfsd2a C T 4: 122,949,298 V397I probably benign Het
Mroh1 C A 15: 76,433,873 H867N probably benign Het
Mthfd1l C T 10: 4,007,745 R261* probably null Het
Myo3a A G 2: 22,407,346 I725M probably damaging Het
Neb T C 2: 52,209,540 D4766G possibly damaging Het
Nek11 G T 9: 105,392,957 P22Q probably damaging Het
Olfr1179 T C 2: 88,402,113 T274A possibly damaging Het
Olfr1497 A T 19: 13,795,239 V124E possibly damaging Het
Olfr178 T C 16: 58,889,585 T212A probably benign Het
Peg10 C G 6: 4,756,113 Q230E unknown Het
Pipox T C 11: 77,883,909 D116G probably benign Het
Pkd1l2 C T 8: 117,047,497 R993H probably benign Het
Pkdrej A C 15: 85,818,410 N1108K probably damaging Het
Polr2a C T 11: 69,746,376 R291Q probably benign Het
Pomt1 T A 2: 32,244,297 Y277N probably damaging Het
Rasal2 A G 1: 157,299,235 S78P probably damaging Het
Rgl1 A T 1: 152,557,501 L171Q probably damaging Het
Sfta2 A G 17: 35,601,774 E14G unknown Het
Sh3rf3 T A 10: 59,049,355 S353R possibly damaging Het
Slc37a1 A T 17: 31,322,259 I242F probably damaging Het
Srfbp1 T A 18: 52,488,690 D274E probably damaging Het
Syne2 T A 12: 75,912,353 S685R possibly damaging Het
Tenm4 A C 7: 96,895,176 D2170A probably damaging Het
Tnr A G 1: 159,863,695 T472A probably damaging Het
Tspan9 T C 6: 127,965,278 H203R probably damaging Het
Ttn T C 2: 76,771,651 T18556A possibly damaging Het
Usp25 T A 16: 77,071,681 Y323* probably null Het
Usp31 G T 7: 121,649,026 R1065S possibly damaging Het
Vmn2r103 A T 17: 19,811,796 T611S probably damaging Het
Wdfy4 A G 14: 33,142,360 V552A Het
Zap70 G T 1: 36,771,181 R124L possibly damaging Het
Zfand6 A T 7: 84,632,749 S91T possibly damaging Het
Other mutations in Brox
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0854:Brox UTSW 1 183287758 missense possibly damaging 0.50
R1086:Brox UTSW 1 183282488 missense probably damaging 1.00
R4488:Brox UTSW 1 183280950 missense probably benign 0.01
R4524:Brox UTSW 1 183292481 missense possibly damaging 0.95
R5112:Brox UTSW 1 183291977 missense probably benign
R5559:Brox UTSW 1 183291988 missense possibly damaging 0.83
R5951:Brox UTSW 1 183282508 missense probably damaging 1.00
R7027:Brox UTSW 1 183284186 missense possibly damaging 0.92
R7029:Brox UTSW 1 183284186 missense possibly damaging 0.92
R7229:Brox UTSW 1 183291959 nonsense probably null
R7629:Brox UTSW 1 183292504 missense probably damaging 0.97
R7935:Brox UTSW 1 183280920 missense probably damaging 0.98
R8164:Brox UTSW 1 183280927 missense possibly damaging 0.95
R9430:Brox UTSW 1 183287789 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGTAAAAGCCAGGTGGTG -3'
(R):5'- AGTCAAACTCTATTTCAACCGATCC -3'

Sequencing Primer
(F):5'- TGGCTAAACTTGCTGACCAG -3'
(R):5'- CAAGTCTTGTTAATGGGCCAGAC -3'
Posted On 2020-08-14