Mutagenetix > Incidental Mutation

Incidental Mutation 'R8140:Eif5b'

632457

Institutional Source

Beutler Lab

Gene Symbol

Eif5b

Ensembl Gene

ENSMUSG00000026083

Gene Name

eukaryotic translation initiation factor 5B

Synonyms

A030003E17Rik, IF2

MMRRC Submission

067568-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8140 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

37998010-38055579 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 38051276 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 1179 (V1179I)

Ref Sequence

ENSEMBL: ENSMUSP00000027252 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027251] [ENSMUST00000027252]

AlphaFold

Q05D44

Predicted Effect

probably benign
Transcript: ENSMUST00000027251

SMART Domains

Protein: ENSMUSP00000027251
Gene: ENSMUSG00000026082

Domain	Start	End	E-Value	Type
BRCT	46	121	3.99e-13	SMART
low complexity region	320	342	N/A	INTRINSIC
Pfam:IMS	420	620	1.9e-43	PFAM
Pfam:IMS_C	700	831	5.8e-20	PFAM
low complexity region	888	901	N/A	INTRINSIC
Pfam:DUF4414	938	1071	9.7e-11	PFAM
Pfam:REV1_C	1127	1248	1.2e-43	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000027252
AA Change: V1179I

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000027252
Gene: ENSMUSG00000026083
AA Change: V1179I

Domain	Start	End	E-Value	Type
low complexity region	19	32	N/A	INTRINSIC
low complexity region	33	51	N/A	INTRINSIC
low complexity region	94	106	N/A	INTRINSIC
low complexity region	110	126	N/A	INTRINSIC
low complexity region	145	161	N/A	INTRINSIC
low complexity region	183	193	N/A	INTRINSIC
coiled coil region	227	272	N/A	INTRINSIC
coiled coil region	301	414	N/A	INTRINSIC
low complexity region	480	498	N/A	INTRINSIC
coiled coil region	523	554	N/A	INTRINSIC
low complexity region	580	594	N/A	INTRINSIC
Pfam:GTP_EFTU	625	840	4.7e-35	PFAM
Pfam:MMR_HSR1	629	753	5.1e-6	PFAM
Pfam:GTP_EFTU_D2	866	944	7.1e-11	PFAM
Pfam:IF-2	959	1066	1.4e-20	PFAM
Blast:S1	1116	1172	2e-6	BLAST

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 98.6%
20x: 93.9%

Validation Efficiency

97% (64/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Accurate initiation of translation in eukaryotes is complex and requires many factors, some of which are composed of multiple subunits. The process is simpler in prokaryotes which have only three initiation factors (IF1, IF2, IF3). Two of these factors are conserved in eukaryotes: the homolog of IF1 is eIF1A and the homolog of IF2 is eIF5B. This gene encodes eIF5B. Factors eIF1A and eIF5B interact on the ribosome along with other initiation factors and GTP to position the initiation methionine tRNA on the start codon of the mRNA so that translation initiates accurately. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	T	A	5: 63,898,611	V230E	possibly damaging	Het
Amotl1	G	A	9: 14,572,715		probably null	Het
Atp7b	C	A	8: 22,028,560	E87D	probably damaging	Het
Bcat2	C	T	7: 45,588,351	P347L	probably damaging	Het
Brox	A	T	1: 183,293,873		probably null	Het
Cd37	A	G	7: 45,238,535	I58T	probably damaging	Het
Cep295	A	T	9: 15,341,533	M333K	probably benign	Het
Chtop	A	G	3: 90,505,393		probably null	Het
Cpa2	A	T	6: 30,544,905	K54N	probably benign	Het
Cpa6	A	G	1: 10,325,294	S383P	probably damaging	Het
Dnah7a	A	T	1: 53,501,589	I2542N	probably benign	Het
Erbin	T	C	13: 103,920,294		probably null	Het
Fastkd5	A	T	2: 130,615,250	D473E	possibly damaging	Het
Fchsd1	T	C	18: 37,964,342	E372G	probably damaging	Het
Fgl1	T	C	8: 41,200,609		probably null	Het
Fzd8	T	G	18: 9,213,797	V293G	probably damaging	Het
Gm4787	T	A	12: 81,378,151	H411L	probably benign	Het
Gm49380	G	T	9: 44,111,972	D326E	probably benign	Het
Hcrtr1	G	A	4: 130,135,290	R240C	probably damaging	Het
Hdac5	A	T	11: 102,197,355	Y948N	probably damaging	Het
Hepacam	A	G	9: 37,383,871	S301G	probably benign	Het
Htra4	A	T	8: 25,030,558	D362E	possibly damaging	Het
Ighv1-9	G	A	12: 114,583,741	P60L	probably damaging	Het
Kcnq3	A	G	15: 65,995,541	I751T	probably damaging	Het
Magi3	T	C	3: 104,034,086	Y851C	probably damaging	Het
Mefv	A	G	16: 3,713,635	S470P	probably benign	Het
Mfsd2a	C	T	4: 122,949,298	V397I	probably benign	Het
Mroh1	C	A	15: 76,433,873	H867N	probably benign	Het
Mthfd1l	C	T	10: 4,007,745	R261*	probably null	Het
Myo3a	A	G	2: 22,407,346	I725M	probably damaging	Het
Neb	T	C	2: 52,209,540	D4766G	possibly damaging	Het
Nek11	G	T	9: 105,392,957	P22Q	probably damaging	Het
Olfr1179	T	C	2: 88,402,113	T274A	possibly damaging	Het
Olfr1497	A	T	19: 13,795,239	V124E	possibly damaging	Het
Olfr178	T	C	16: 58,889,585	T212A	probably benign	Het
Peg10	C	G	6: 4,756,113	Q230E	unknown	Het
Pipox	T	C	11: 77,883,909	D116G	probably benign	Het
Pkd1l2	C	T	8: 117,047,497	R993H	probably benign	Het
Pkdrej	A	C	15: 85,818,410	N1108K	probably damaging	Het
Polr2a	C	T	11: 69,746,376	R291Q	probably benign	Het
Pomt1	T	A	2: 32,244,297	Y277N	probably damaging	Het
Rasal2	A	G	1: 157,299,235	S78P	probably damaging	Het
Rgl1	A	T	1: 152,557,501	L171Q	probably damaging	Het
Sfta2	A	G	17: 35,601,774	E14G	unknown	Het
Sh3rf3	T	A	10: 59,049,355	S353R	possibly damaging	Het
Slc37a1	A	T	17: 31,322,259	I242F	probably damaging	Het
Srfbp1	T	A	18: 52,488,690	D274E	probably damaging	Het
Syne2	T	A	12: 75,912,353	S685R	possibly damaging	Het
Tenm4	A	C	7: 96,895,176	D2170A	probably damaging	Het
Tnr	A	G	1: 159,863,695	T472A	probably damaging	Het
Tspan9	T	C	6: 127,965,278	H203R	probably damaging	Het
Ttn	T	C	2: 76,771,651	T18556A	possibly damaging	Het
Usp25	T	A	16: 77,071,681	Y323*	probably null	Het
Usp31	G	T	7: 121,649,026	R1065S	possibly damaging	Het
Vmn2r103	A	T	17: 19,811,796	T611S	probably damaging	Het
Wdfy4	A	G	14: 33,142,360	V552A		Het
Zap70	G	T	1: 36,771,181	R124L	possibly damaging	Het
Zfand6	A	T	7: 84,632,749	S91T	possibly damaging	Het

Other mutations in Eif5b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00334:Eif5b	APN	1	38041719	missense	probably damaging	1.00
IGL01377:Eif5b	APN	1	38036098	missense	probably benign
IGL01395:Eif5b	APN	1	38037258	missense	probably damaging	0.96
IGL01572:Eif5b	APN	1	38022254	nonsense	probably null
IGL01615:Eif5b	APN	1	38045706	missense	probably damaging	1.00
IGL02141:Eif5b	APN	1	38032322	missense	probably benign	0.09
IGL02260:Eif5b	APN	1	38045456	missense	possibly damaging	0.81
IGL02308:Eif5b	APN	1	38041747	missense	probably damaging	1.00
IGL03180:Eif5b	APN	1	38036269	missense	probably damaging	1.00
IGL03327:Eif5b	APN	1	38041691	splice site	probably benign
R0018:Eif5b	UTSW	1	38018889	missense	unknown
R0036:Eif5b	UTSW	1	38019111	missense	probably benign	0.23
R0137:Eif5b	UTSW	1	38019243	missense	probably benign	0.23
R0349:Eif5b	UTSW	1	38032366	missense	probably benign	0.18
R0606:Eif5b	UTSW	1	38048893	missense	probably damaging	1.00
R1056:Eif5b	UTSW	1	38022167	missense	unknown
R1225:Eif5b	UTSW	1	38037628	missense	probably damaging	1.00
R2043:Eif5b	UTSW	1	38041819	missense	probably damaging	1.00
R2163:Eif5b	UTSW	1	38048794	missense	probably benign	0.32
R2225:Eif5b	UTSW	1	38019223	missense	unknown
R2432:Eif5b	UTSW	1	38019342	missense	unknown
R2922:Eif5b	UTSW	1	38018019	splice site	probably benign
R4357:Eif5b	UTSW	1	38050258	missense	probably damaging	1.00
R4631:Eif5b	UTSW	1	38041747	missense	probably damaging	1.00
R4665:Eif5b	UTSW	1	38045712	missense	probably damaging	1.00
R4702:Eif5b	UTSW	1	38018877	missense	unknown
R4941:Eif5b	UTSW	1	38051199	missense	probably damaging	1.00
R4995:Eif5b	UTSW	1	38051711	makesense	probably null
R5020:Eif5b	UTSW	1	38019069	nonsense	probably null
R5175:Eif5b	UTSW	1	38045387	missense	probably damaging	1.00
R5375:Eif5b	UTSW	1	38045754	missense	possibly damaging	0.66
R5566:Eif5b	UTSW	1	38045684	missense	possibly damaging	0.90
R5566:Eif5b	UTSW	1	38051247	missense	probably damaging	1.00
R5853:Eif5b	UTSW	1	38037307	missense	probably damaging	1.00
R5978:Eif5b	UTSW	1	37998280	splice site	probably null
R6315:Eif5b	UTSW	1	38018033	missense	unknown
R6376:Eif5b	UTSW	1	38045679	missense	probably damaging	0.98
R6388:Eif5b	UTSW	1	38019000	missense	unknown
R6444:Eif5b	UTSW	1	38036211	missense	probably damaging	1.00
R6455:Eif5b	UTSW	1	38019027	missense	probably benign	0.23
R6810:Eif5b	UTSW	1	38046660	missense	probably benign	0.45
R6877:Eif5b	UTSW	1	38050239	missense	probably damaging	1.00
R7130:Eif5b	UTSW	1	38041776	missense	probably damaging	1.00
R7180:Eif5b	UTSW	1	38049074	missense	probably damaging	0.98
R7439:Eif5b	UTSW	1	38051637	missense	probably benign	0.28
R7488:Eif5b	UTSW	1	38050306	missense	possibly damaging	0.69
R8166:Eif5b	UTSW	1	38048820	missense	probably benign	0.11
R8191:Eif5b	UTSW	1	38036202	missense	probably damaging	0.98
R8304:Eif5b	UTSW	1	38045693	missense	probably benign	0.11
R8549:Eif5b	UTSW	1	38037207	missense	possibly damaging	0.96
R8558:Eif5b	UTSW	1	38044714	missense	probably damaging	0.99
R8893:Eif5b	UTSW	1	38051219	missense	possibly damaging	0.48
R9452:Eif5b	UTSW	1	38045780	missense	probably damaging	1.00
R9487:Eif5b	UTSW	1	38019370	nonsense	probably null
R9487:Eif5b	UTSW	1	38045479	missense	probably damaging	0.99
R9542:Eif5b	UTSW	1	38018050	nonsense	probably null
R9721:Eif5b	UTSW	1	38037659	critical splice donor site	probably null
R9745:Eif5b	UTSW	1	38045648	missense	probably damaging	1.00
R9748:Eif5b	UTSW	1	38051160	missense	possibly damaging	0.89
RF018:Eif5b	UTSW	1	38021592	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TGTCATGATAACCTATGTGAGTCTC -3'
(R):5'- ACATCTGTGGCTCTGGAGTC -3'

Sequencing Primer
(F):5'- ACCTATGTGAGTCTCTGACATTG -3'
(R):5'- CTGGAGTCCCTGAGATTGTC -3'

Posted On

2020-06-30