Incidental Mutation 'R8140:Nek11'
ID 632487
Institutional Source Beutler Lab
Gene Symbol Nek11
Ensembl Gene ENSMUSG00000035032
Gene Name NIMA (never in mitosis gene a)-related expressed kinase 11
Synonyms 4932416N14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8140 (G1)
Quality Score 187.009
Status Validated
Chromosome 9
Chromosomal Location 105162156-105395524 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 105392957 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Glutamine at position 22 (P22Q)
Ref Sequence ENSEMBL: ENSMUSP00000038611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035181] [ENSMUST00000038648] [ENSMUST00000123807] [ENSMUST00000140851] [ENSMUST00000156256] [ENSMUST00000176350] [ENSMUST00000176940] [ENSMUST00000177029] [ENSMUST00000177402] [ENSMUST00000189758]
AlphaFold Q8C0Q4
Predicted Effect probably benign
Transcript: ENSMUST00000035181
SMART Domains Protein: ENSMUSP00000035181
Gene: ENSMUSG00000032567

DomainStartEndE-ValueType
Pfam:XPG_I_2 115 307 1e-18 PFAM
low complexity region 476 488 N/A INTRINSIC
low complexity region 621 634 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000038648
AA Change: P22Q

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038611
Gene: ENSMUSG00000035032
AA Change: P22Q

DomainStartEndE-ValueType
S_TKc 30 288 3.87e-80 SMART
coiled coil region 348 384 N/A INTRINSIC
low complexity region 408 423 N/A INTRINSIC
low complexity region 450 466 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123807
Predicted Effect probably benign
Transcript: ENSMUST00000123807
Predicted Effect probably damaging
Transcript: ENSMUST00000140851
AA Change: P22Q

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116864
Gene: ENSMUSG00000035032
AA Change: P22Q

DomainStartEndE-ValueType
S_TKc 30 288 3.87e-80 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000156256
AA Change: P22Q

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116761
Gene: ENSMUSG00000035032
AA Change: P22Q

DomainStartEndE-ValueType
Pfam:Pkinase 30 177 8.9e-36 PFAM
Pfam:Pkinase_Tyr 30 178 8.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176350
Predicted Effect probably benign
Transcript: ENSMUST00000176940
Predicted Effect probably damaging
Transcript: ENSMUST00000177029
AA Change: P22Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135837
Gene: ENSMUSG00000035032
AA Change: P22Q

DomainStartEndE-ValueType
SCOP:d1h8fa_ 11 80 1e-6 SMART
Blast:S_TKc 30 70 1e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000177402
SMART Domains Protein: ENSMUSP00000135318
Gene: ENSMUSG00000032567

DomainStartEndE-ValueType
low complexity region 59 71 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189758
SMART Domains Protein: ENSMUSP00000139854
Gene: ENSMUSG00000032567

DomainStartEndE-ValueType
low complexity region 59 71 N/A INTRINSIC
Meta Mutation Damage Score 0.2983 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 93.9%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the never in mitosis gene A family of kinases. The encoded protein localizes to the nucleoli, and may function with NEK2A in the S-phase checkpoint. The encoded protein appears to play roles in DNA replication and response to genotoxic stress. Alternatively spliced transcript variants have been described.[provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,611 V230E possibly damaging Het
Amotl1 G A 9: 14,572,715 probably null Het
Atp7b C A 8: 22,028,560 E87D probably damaging Het
Bcat2 C T 7: 45,588,351 P347L probably damaging Het
Brox A T 1: 183,293,873 probably null Het
Cd37 A G 7: 45,238,535 I58T probably damaging Het
Cep295 A T 9: 15,341,533 M333K probably benign Het
Chtop A G 3: 90,505,393 probably null Het
Cpa2 A T 6: 30,544,905 K54N probably benign Het
Cpa6 A G 1: 10,325,294 S383P probably damaging Het
Dnah7a A T 1: 53,501,589 I2542N probably benign Het
Eif5b G A 1: 38,051,276 V1179I probably benign Het
Erbin T C 13: 103,920,294 probably null Het
Fastkd5 A T 2: 130,615,250 D473E possibly damaging Het
Fchsd1 T C 18: 37,964,342 E372G probably damaging Het
Fgl1 T C 8: 41,200,609 probably null Het
Fzd8 T G 18: 9,213,797 V293G probably damaging Het
Gm4787 T A 12: 81,378,151 H411L probably benign Het
Gm49380 G T 9: 44,111,972 D326E probably benign Het
Hcrtr1 G A 4: 130,135,290 R240C probably damaging Het
Hdac5 A T 11: 102,197,355 Y948N probably damaging Het
Hepacam A G 9: 37,383,871 S301G probably benign Het
Htra4 A T 8: 25,030,558 D362E possibly damaging Het
Ighv1-9 G A 12: 114,583,741 P60L probably damaging Het
Kcnq3 A G 15: 65,995,541 I751T probably damaging Het
Magi3 T C 3: 104,034,086 Y851C probably damaging Het
Mefv A G 16: 3,713,635 S470P probably benign Het
Mfsd2a C T 4: 122,949,298 V397I probably benign Het
Mroh1 C A 15: 76,433,873 H867N probably benign Het
Mthfd1l C T 10: 4,007,745 R261* probably null Het
Myo3a A G 2: 22,407,346 I725M probably damaging Het
Neb T C 2: 52,209,540 D4766G possibly damaging Het
Olfr1179 T C 2: 88,402,113 T274A possibly damaging Het
Olfr1497 A T 19: 13,795,239 V124E possibly damaging Het
Olfr178 T C 16: 58,889,585 T212A probably benign Het
Peg10 C G 6: 4,756,113 Q230E unknown Het
Pipox T C 11: 77,883,909 D116G probably benign Het
Pkd1l2 C T 8: 117,047,497 R993H probably benign Het
Pkdrej A C 15: 85,818,410 N1108K probably damaging Het
Polr2a C T 11: 69,746,376 R291Q probably benign Het
Pomt1 T A 2: 32,244,297 Y277N probably damaging Het
Rasal2 A G 1: 157,299,235 S78P probably damaging Het
Rgl1 A T 1: 152,557,501 L171Q probably damaging Het
Sfta2 A G 17: 35,601,774 E14G unknown Het
Sh3rf3 T A 10: 59,049,355 S353R possibly damaging Het
Slc37a1 A T 17: 31,322,259 I242F probably damaging Het
Srfbp1 T A 18: 52,488,690 D274E probably damaging Het
Syne2 T A 12: 75,912,353 S685R possibly damaging Het
Tenm4 A C 7: 96,895,176 D2170A probably damaging Het
Tnr A G 1: 159,863,695 T472A probably damaging Het
Tspan9 T C 6: 127,965,278 H203R probably damaging Het
Ttn T C 2: 76,771,651 T18556A possibly damaging Het
Usp25 T A 16: 77,071,681 Y323* probably null Het
Usp31 G T 7: 121,649,026 R1065S possibly damaging Het
Vmn2r103 A T 17: 19,811,796 T611S probably damaging Het
Wdfy4 A G 14: 33,142,360 V552A Het
Zap70 G T 1: 36,771,181 R124L possibly damaging Het
Zfand6 A T 7: 84,632,749 S91T possibly damaging Het
Other mutations in Nek11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Nek11 APN 9 105392913 missense probably damaging 1.00
IGL01369:Nek11 APN 9 105300060 critical splice donor site probably null
IGL01958:Nek11 APN 9 105300303 missense probably benign 0.06
IGL03099:Nek11 APN 9 105287653 missense probably benign 0.02
IGL03256:Nek11 APN 9 105244414 missense probably damaging 1.00
IGL03400:Nek11 APN 9 105204866 missense probably benign 0.01
R0051:Nek11 UTSW 9 105218539 splice site probably benign
R0051:Nek11 UTSW 9 105218539 splice site probably benign
R0194:Nek11 UTSW 9 105392952 missense probably benign 0.05
R0942:Nek11 UTSW 9 105295371 splice site probably null
R1226:Nek11 UTSW 9 105392892 missense probably damaging 1.00
R1503:Nek11 UTSW 9 105163204 missense probably damaging 1.00
R1709:Nek11 UTSW 9 105348061 missense probably damaging 1.00
R1958:Nek11 UTSW 9 105293717 missense probably benign 0.00
R2128:Nek11 UTSW 9 105300361 missense probably benign 0.01
R3754:Nek11 UTSW 9 105314718 missense probably damaging 1.00
R4027:Nek11 UTSW 9 105244390 nonsense probably null
R4594:Nek11 UTSW 9 105392847 critical splice donor site probably null
R4650:Nek11 UTSW 9 105348080 missense possibly damaging 0.79
R4724:Nek11 UTSW 9 105392970 missense possibly damaging 0.89
R4846:Nek11 UTSW 9 105163163 missense probably damaging 1.00
R4903:Nek11 UTSW 9 105314722 missense possibly damaging 0.63
R4908:Nek11 UTSW 9 105298289 missense probably benign 0.00
R4912:Nek11 UTSW 9 105287658 missense probably benign 0.01
R4930:Nek11 UTSW 9 105300066 missense probably damaging 1.00
R5827:Nek11 UTSW 9 105314745 missense probably damaging 1.00
R5860:Nek11 UTSW 9 105392961 missense probably benign 0.01
R6030:Nek11 UTSW 9 105204888 critical splice acceptor site probably null
R6030:Nek11 UTSW 9 105204888 critical splice acceptor site probably null
R6154:Nek11 UTSW 9 105323169 makesense probably null
R6915:Nek11 UTSW 9 105393057 unclassified probably benign
R7197:Nek11 UTSW 9 105244415 missense probably damaging 1.00
R8059:Nek11 UTSW 9 105162974 makesense probably null
R8357:Nek11 UTSW 9 105347992 missense probably damaging 1.00
R8457:Nek11 UTSW 9 105347992 missense probably damaging 1.00
R8536:Nek11 UTSW 9 105298339 missense probably benign 0.04
R8752:Nek11 UTSW 9 105348008 missense probably benign 0.00
R8885:Nek11 UTSW 9 105295372 critical splice donor site probably null
R9098:Nek11 UTSW 9 105293657 missense probably benign 0.32
Z1176:Nek11 UTSW 9 105293669 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TGGAGGTGGGGCATCTATACAG -3'
(R):5'- TCTGGCATCAATCAACACTTCC -3'

Sequencing Primer
(F):5'- CAGAGTACAGATCAGATGTGACTCC -3'
(R):5'- AATCAACACTTCCCGTTTGAC -3'
Posted On 2020-06-30