Incidental Mutation 'R7974:Itch'
ID650759
Institutional Source Beutler Lab
Gene Symbol Itch
Ensembl Gene ENSMUSG00000027598
Gene Nameitchy, E3 ubiquitin protein ligase
Synonyms8030492O04Rik, C230047C07Rik, 6720481N21Rik, AIP4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7974 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location155133509-155226855 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 155192159 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 417 (F417S)
Ref Sequence ENSEMBL: ENSMUSP00000029126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029126] [ENSMUST00000109685]
PDB Structure Itch E3 ubiquitin ligase WW3 domain [SOLUTION NMR]
Mouse Itch 3rd WW domain complex with the Epstein-Barr virus latent membrane protein 2A derived peptide EEPPPPYED [SOLUTION NMR]
Mouse Itch 3rd domain phosphorylated in T30 [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000029126
AA Change: F417S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029126
Gene: ENSMUSG00000027598
AA Change: F417S

DomainStartEndE-ValueType
C2 19 114 3.56e-12 SMART
low complexity region 195 206 N/A INTRINSIC
low complexity region 209 226 N/A INTRINSIC
low complexity region 230 259 N/A INTRINSIC
WW 288 320 1.07e-12 SMART
WW 321 352 3.86e-10 SMART
WW 400 432 7.36e-16 SMART
WW 440 472 6.82e-11 SMART
HECTc 528 864 7.04e-179 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109685
AA Change: F417S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105307
Gene: ENSMUSG00000027598
AA Change: F417S

DomainStartEndE-ValueType
C2 19 114 3.56e-12 SMART
low complexity region 195 206 N/A INTRINSIC
low complexity region 209 226 N/A INTRINSIC
low complexity region 230 259 N/A INTRINSIC
WW 288 320 1.07e-12 SMART
WW 321 352 3.86e-10 SMART
WW 400 432 7.36e-16 SMART
WW 440 472 6.82e-11 SMART
HECTc 528 864 7.04e-179 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein plays a role in multiple cellular processes including erythroid and lymphoid cell differentiation and the regulation of immune responses. Mutations in this gene are a cause of syndromic multisystem autoimmune disease. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for an ENU mutation exhibit increased total IgE levels in the peripheral blood and an enhanced IgE response to the cysteine protease allergen, papain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 C T 19: 57,044,973 probably null Het
Adamts19 A T 18: 59,011,022 Q892L possibly damaging Het
Adamts9 A G 6: 92,909,687 probably null Het
Aftph T C 11: 20,698,233 *686W probably null Het
AI661453 T C 17: 47,466,081 L244P unknown Het
Ankar C A 1: 72,698,979 E15* probably null Het
Ankrd39 A G 1: 36,546,918 probably benign Het
Arsi A G 18: 60,912,406 D56G probably damaging Het
Blmh T C 11: 76,965,903 I245T possibly damaging Het
Ccr6 T C 17: 8,256,224 F87S probably damaging Het
Cdc42ep2 T C 19: 5,918,495 K61E probably damaging Het
Celsr1 C T 15: 86,031,030 G914D probably damaging Het
Cep126 T A 9: 8,120,763 K86N probably benign Het
Cfap70 A T 14: 20,420,750 F532I probably damaging Het
Cpsf3 T A 12: 21,308,005 L506Q probably damaging Het
Dct A C 14: 118,039,655 I273S probably damaging Het
Dsel T C 1: 111,860,499 I769V probably benign Het
Dus2 G A 8: 106,036,020 E138K probably benign Het
Emsy A G 7: 98,630,218 S305P possibly damaging Het
Erp27 A T 6: 136,908,065 V245D probably damaging Het
Fez1 C A 9: 36,843,948 T81K probably damaging Het
Gli3 A C 13: 15,726,256 Q1409H probably benign Het
Gm10696 T C 3: 94,175,541 K321R probably benign Het
Hdac9 T C 12: 34,303,220 S664G possibly damaging Het
Hibadh A G 6: 52,557,895 S167P probably benign Het
Hsdl1 A G 8: 119,566,333 V121A probably benign Het
Ighv1-18 A C 12: 114,683,049 I6S possibly damaging Het
Iqcm T A 8: 75,554,892 M1K probably null Het
Itpr1 C T 6: 108,523,405 T2653I possibly damaging Het
Kank1 T G 19: 25,424,220 Y1064D probably damaging Het
Kmt2c T C 5: 25,300,563 Q3249R probably damaging Het
Lefty1 T C 1: 180,937,820 C318R probably damaging Het
Lmbr1l C T 15: 98,911,619 V147I probably benign Het
Meig1 C A 2: 3,411,874 E37* probably null Het
Mpp3 A G 11: 102,008,354 probably null Het
Muc3 T C 5: 137,146,816 N2S Het
Mup7 T C 4: 60,067,518 E199G possibly damaging Het
Nol4 G C 18: 22,719,025 Y275* probably null Het
Nrxn1 G A 17: 90,700,779 P429S probably damaging Het
Olfr761 T C 17: 37,952,781 Y81C probably damaging Het
Pfkl A T 10: 77,994,162 F367L probably damaging Het
Pik3cg T C 12: 32,204,032 E652G probably benign Het
Prkag3 A G 1: 74,744,821 I301T probably benign Het
Rcn1 G A 2: 105,393,710 P163L probably benign Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc37a2 A T 9: 37,239,125 probably null Het
Slc9b1 C T 3: 135,394,030 T437I possibly damaging Het
Smap1 T G 1: 23,849,441 T248P probably benign Het
Smpd3 A C 8: 106,255,622 C617G probably benign Het
Spata20 T C 11: 94,484,140 N212S possibly damaging Het
Sphkap A C 1: 83,278,962 C355W probably damaging Het
Spsb1 T A 4: 149,907,109 M1L probably damaging Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Stxbp5 A C 10: 9,770,695 probably null Het
Taar5 G C 10: 23,971,222 D173H possibly damaging Het
Tfrc A G 16: 32,621,283 D438G probably null Het
Tinag A T 9: 76,999,849 I368K probably benign Het
Tm9sf1 A G 14: 55,636,449 W531R probably damaging Het
Tnc G T 4: 64,000,724 P1154Q possibly damaging Het
Toporsl A G 4: 52,611,645 R513G probably damaging Het
Ttc30a1 T C 2: 75,980,344 H465R probably damaging Het
Vat1 A G 11: 101,466,130 S2P probably benign Het
Vmn2r107 C G 17: 20,357,008 P423A probably benign Het
Vmn2r2 T A 3: 64,117,387 E591V probably damaging Het
Vmn2r62 G A 7: 42,764,607 T804I probably damaging Het
Vmn2r62 T A 7: 42,787,857 Y401F probably damaging Het
Vmn2r89 A T 14: 51,456,002 I270F probably damaging Het
Zfp418 T C 7: 7,182,168 F377L possibly damaging Het
Zkscan5 T C 5: 145,207,692 S182P unknown Het
Other mutations in Itch
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Itch APN 2 155213023 missense probably damaging 1.00
IGL00796:Itch APN 2 155209082 missense probably damaging 0.97
IGL01090:Itch APN 2 155206336 missense probably damaging 0.99
IGL01568:Itch APN 2 155212462 splice site probably benign
IGL01844:Itch APN 2 155172547 missense possibly damaging 0.56
IGL01844:Itch APN 2 155172486 missense possibly damaging 0.94
IGL01873:Itch APN 2 155168750 missense possibly damaging 0.68
IGL02129:Itch APN 2 155217988 splice site probably benign
IGL02386:Itch APN 2 155202261 nonsense probably null
IGL02545:Itch APN 2 155172586 splice site probably null
IGL02621:Itch APN 2 155172584 splice site probably null
IGL02708:Itch APN 2 155174044 missense probably benign 0.00
IGL02869:Itch APN 2 155173933 critical splice acceptor site probably null
Abrade UTSW 2 155209078 missense possibly damaging 0.93
dorsolateral UTSW 2 155210558 nonsense probably null
gadfly UTSW 2 155182298 nonsense probably null
hankerin UTSW 2 155210582 critical splice donor site probably null
prurient UTSW 2 155210502 missense probably damaging 1.00
scratch UTSW 2 155172561 missense probably damaging 0.99
R0116:Itch UTSW 2 155217983 splice site probably benign
R0207:Itch UTSW 2 155202257 missense probably benign
R0226:Itch UTSW 2 155199394 missense probably benign 0.01
R0545:Itch UTSW 2 155182298 nonsense probably null
R0689:Itch UTSW 2 155182178 missense possibly damaging 0.82
R1365:Itch UTSW 2 155213031 missense probably benign 0.00
R1406:Itch UTSW 2 155206354 missense possibly damaging 0.95
R1406:Itch UTSW 2 155206354 missense possibly damaging 0.95
R1436:Itch UTSW 2 155192145 missense probably damaging 0.96
R1639:Itch UTSW 2 155179025 splice site probably null
R1769:Itch UTSW 2 155172561 missense probably damaging 0.99
R1855:Itch UTSW 2 155172454 splice site probably benign
R1865:Itch UTSW 2 155168746 missense probably damaging 0.96
R2008:Itch UTSW 2 155210459 missense possibly damaging 0.91
R2054:Itch UTSW 2 155210576 missense probably damaging 1.00
R2196:Itch UTSW 2 155202221 missense probably benign
R2199:Itch UTSW 2 155202221 missense probably benign
R2252:Itch UTSW 2 155212339 missense probably benign 0.01
R2253:Itch UTSW 2 155212339 missense probably benign 0.01
R2348:Itch UTSW 2 155209078 missense possibly damaging 0.93
R2850:Itch UTSW 2 155202221 missense probably benign
R3021:Itch UTSW 2 155209126 missense possibly damaging 0.74
R4676:Itch UTSW 2 155199435 missense probably benign 0.05
R4716:Itch UTSW 2 155210582 critical splice donor site probably null
R4888:Itch UTSW 2 155217977 splice site probably null
R4970:Itch UTSW 2 155185593 missense possibly damaging 0.50
R6029:Itch UTSW 2 155179089 critical splice donor site probably null
R6122:Itch UTSW 2 155174065 missense probably benign 0.05
R6435:Itch UTSW 2 155209129 missense probably benign 0.01
R6449:Itch UTSW 2 155163395 splice site probably benign
R7069:Itch UTSW 2 155209994 missense probably damaging 1.00
R7083:Itch UTSW 2 155210444 missense probably damaging 1.00
R7409:Itch UTSW 2 155199382 missense probably damaging 0.99
R7689:Itch UTSW 2 155210002 missense probably damaging 0.99
R7689:Itch UTSW 2 155213067 missense probably benign 0.00
R8046:Itch UTSW 2 155210502 missense probably damaging 1.00
R8248:Itch UTSW 2 155206383 critical splice donor site probably null
R8355:Itch UTSW 2 155210582 critical splice donor site probably null
R8428:Itch UTSW 2 155168707 missense probably benign 0.38
R8691:Itch UTSW 2 155210558 nonsense probably null
R8779:Itch UTSW 2 155172520 missense probably benign 0.28
Z1177:Itch UTSW 2 155209059 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGAGGCGTTTGCTCAAAAG -3'
(R):5'- TGAAACTCAAGCTCTTCATTACACG -3'

Sequencing Primer
(F):5'- CAAAAGCTAGAATACACTTTCATGTG -3'
(R):5'- GAGTCAAAAGGTACATAACCTC -3'
Posted On2020-09-15