Mutagenetix > Incidental Mutation

Incidental Mutation 'R7974:Itch'

650759

Institutional Source

Beutler Lab

Gene Symbol

Itch

Ensembl Gene

ENSMUSG00000027598

Gene Name

itchy, E3 ubiquitin protein ligase

Synonyms

8030492O04Rik, C230047C07Rik, 6720481N21Rik, AIP4

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7974 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

155133509-155226855 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 155192159 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 417 (F417S)

Ref Sequence

ENSEMBL: ENSMUSP00000029126 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029126] [ENSMUST00000109685]

AlphaFold

Q8C863

PDB Structure

Itch E3 ubiquitin ligase WW3 domain [SOLUTION NMR]
Mouse Itch 3rd WW domain complex with the Epstein-Barr virus latent membrane protein 2A derived peptide EEPPPPYED [SOLUTION NMR]
Mouse Itch 3rd domain phosphorylated in T30 [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000029126
AA Change: F417S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000029126
Gene: ENSMUSG00000027598
AA Change: F417S

Domain	Start	End	E-Value	Type
C2	19	114	3.56e-12	SMART
low complexity region	195	206	N/A	INTRINSIC
low complexity region	209	226	N/A	INTRINSIC
low complexity region	230	259	N/A	INTRINSIC
WW	288	320	1.07e-12	SMART
WW	321	352	3.86e-10	SMART
WW	400	432	7.36e-16	SMART
WW	440	472	6.82e-11	SMART
HECTc	528	864	7.04e-179	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000109685
AA Change: F417S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000105307
Gene: ENSMUSG00000027598
AA Change: F417S

Domain	Start	End	E-Value	Type
C2	19	114	3.56e-12	SMART
low complexity region	195	206	N/A	INTRINSIC
low complexity region	209	226	N/A	INTRINSIC
low complexity region	230	259	N/A	INTRINSIC
WW	288	320	1.07e-12	SMART
WW	321	352	3.86e-10	SMART
WW	400	432	7.36e-16	SMART
WW	440	472	6.82e-11	SMART
HECTc	528	864	7.04e-179	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein plays a role in multiple cellular processes including erythroid and lymphoid cell differentiation and the regulation of immune responses. Mutations in this gene are a cause of syndromic multisystem autoimmune disease. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for an ENU mutation exhibit increased total IgE levels in the peripheral blood and an enhanced IgE response to the cysteine protease allergen, papain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim1	C	T	19: 57,044,973		probably null	Het
Adamts19	A	T	18: 59,011,022	Q892L	possibly damaging	Het
Adamts9	A	G	6: 92,909,687		probably null	Het
Aftph	T	C	11: 20,698,233	*686W	probably null	Het
AI661453	T	C	17: 47,466,081	L244P	unknown	Het
Ankar	C	A	1: 72,698,979	E15*	probably null	Het
Ankrd39	A	G	1: 36,546,918		probably benign	Het
Arsi	A	G	18: 60,912,406	D56G	probably damaging	Het
Blmh	T	C	11: 76,965,903	I245T	possibly damaging	Het
Ccr6	T	C	17: 8,256,224	F87S	probably damaging	Het
Cdc42ep2	T	C	19: 5,918,495	K61E	probably damaging	Het
Celsr1	C	T	15: 86,031,030	G914D	probably damaging	Het
Cep126	T	A	9: 8,120,763	K86N	probably benign	Het
Cfap70	A	T	14: 20,420,750	F532I	probably damaging	Het
Cpsf3	T	A	12: 21,308,005	L506Q	probably damaging	Het
Dct	A	C	14: 118,039,655	I273S	probably damaging	Het
Dsel	T	C	1: 111,860,499	I769V	probably benign	Het
Dus2	G	A	8: 106,036,020	E138K	probably benign	Het
Emsy	A	G	7: 98,630,218	S305P	possibly damaging	Het
Erp27	A	T	6: 136,908,065	V245D	probably damaging	Het
Fez1	C	A	9: 36,843,948	T81K	probably damaging	Het
Gli3	A	C	13: 15,726,256	Q1409H	probably benign	Het
Gm10696	T	C	3: 94,175,541	K321R	probably benign	Het
Hdac9	T	C	12: 34,303,220	S664G	possibly damaging	Het
Hibadh	A	G	6: 52,557,895	S167P	probably benign	Het
Hsdl1	A	G	8: 119,566,333	V121A	probably benign	Het
Ighv1-18	A	C	12: 114,683,049	I6S	possibly damaging	Het
Iqcm	T	A	8: 75,554,892	M1K	probably null	Het
Itpr1	C	T	6: 108,523,405	T2653I	possibly damaging	Het
Kank1	T	G	19: 25,424,220	Y1064D	probably damaging	Het
Kmt2c	T	C	5: 25,300,563	Q3249R	probably damaging	Het
Lefty1	T	C	1: 180,937,820	C318R	probably damaging	Het
Lmbr1l	C	T	15: 98,911,619	V147I	probably benign	Het
Meig1	C	A	2: 3,411,874	E37*	probably null	Het
Mpp3	A	G	11: 102,008,354		probably null	Het
Muc3	T	C	5: 137,146,816	N2S		Het
Mup7	T	C	4: 60,067,518	E199G	possibly damaging	Het
Nol4	G	C	18: 22,719,025	Y275*	probably null	Het
Nrxn1	G	A	17: 90,700,779	P429S	probably damaging	Het
Olfr761	T	C	17: 37,952,781	Y81C	probably damaging	Het
Pfkl	A	T	10: 77,994,162	F367L	probably damaging	Het
Pik3cg	T	C	12: 32,204,032	E652G	probably benign	Het
Prkag3	A	G	1: 74,744,821	I301T	probably benign	Het
Rcn1	G	A	2: 105,393,710	P163L	probably benign	Het
Slc1a7	G	A	4: 108,012,276	V513M	probably benign	Het
Slc37a2	A	T	9: 37,239,125		probably null	Het
Slc9b1	C	T	3: 135,394,030	T437I	possibly damaging	Het
Smap1	T	G	1: 23,849,441	T248P	probably benign	Het
Smpd3	A	C	8: 106,255,622	C617G	probably benign	Het
Spata20	T	C	11: 94,484,140	N212S	possibly damaging	Het
Sphkap	A	C	1: 83,278,962	C355W	probably damaging	Het
Spsb1	T	A	4: 149,907,109	M1L	probably damaging	Het
Srebf2	C	T	15: 82,178,765	R468C	probably damaging	Het
Stxbp5	A	C	10: 9,770,695		probably null	Het
Taar5	G	C	10: 23,971,222	D173H	possibly damaging	Het
Tfrc	A	G	16: 32,621,283	D438G	probably null	Het
Tinag	A	T	9: 76,999,849	I368K	probably benign	Het
Tm9sf1	A	G	14: 55,636,449	W531R	probably damaging	Het
Tnc	G	T	4: 64,000,724	P1154Q	possibly damaging	Het
Toporsl	A	G	4: 52,611,645	R513G	probably damaging	Het
Ttc30a1	T	C	2: 75,980,344	H465R	probably damaging	Het
Vat1	A	G	11: 101,466,130	S2P	probably benign	Het
Vmn2r107	C	G	17: 20,357,008	P423A	probably benign	Het
Vmn2r2	T	A	3: 64,117,387	E591V	probably damaging	Het
Vmn2r62	G	A	7: 42,764,607	T804I	probably damaging	Het
Vmn2r62	T	A	7: 42,787,857	Y401F	probably damaging	Het
Vmn2r89	A	T	14: 51,456,002	I270F	probably damaging	Het
Zfp418	T	C	7: 7,182,168	F377L	possibly damaging	Het
Zkscan5	T	C	5: 145,207,692	S182P	unknown	Het

Other mutations in Itch

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00481:Itch	APN	2	155213023	missense	probably damaging	1.00
IGL00796:Itch	APN	2	155209082	missense	probably damaging	0.97
IGL01090:Itch	APN	2	155206336	missense	probably damaging	0.99
IGL01568:Itch	APN	2	155212462	splice site	probably benign
IGL01844:Itch	APN	2	155172547	missense	possibly damaging	0.56
IGL01844:Itch	APN	2	155172486	missense	possibly damaging	0.94
IGL01873:Itch	APN	2	155168750	missense	possibly damaging	0.68
IGL02129:Itch	APN	2	155217988	splice site	probably benign
IGL02386:Itch	APN	2	155202261	nonsense	probably null
IGL02545:Itch	APN	2	155172586	splice site	probably null
IGL02621:Itch	APN	2	155172584	splice site	probably null
IGL02708:Itch	APN	2	155174044	missense	probably benign	0.00
IGL02869:Itch	APN	2	155173933	critical splice acceptor site	probably null
Abrade	UTSW	2	155209078	missense	possibly damaging	0.93
dorsolateral	UTSW	2	155210558	nonsense	probably null
gadfly	UTSW	2	155182298	nonsense	probably null
hankerin	UTSW	2	155210582	critical splice donor site	probably null
irresistable	UTSW	2	155203297	missense	probably benign	0.34
prurient	UTSW	2	155210502	missense	probably damaging	1.00
scratch	UTSW	2	155172561	missense	probably damaging	0.99
R0116:Itch	UTSW	2	155217983	splice site	probably benign
R0207:Itch	UTSW	2	155202257	missense	probably benign
R0226:Itch	UTSW	2	155199394	missense	probably benign	0.01
R0545:Itch	UTSW	2	155182298	nonsense	probably null
R0689:Itch	UTSW	2	155182178	missense	possibly damaging	0.82
R1365:Itch	UTSW	2	155213031	missense	probably benign	0.00
R1406:Itch	UTSW	2	155206354	missense	possibly damaging	0.95
R1406:Itch	UTSW	2	155206354	missense	possibly damaging	0.95
R1436:Itch	UTSW	2	155192145	missense	probably damaging	0.96
R1639:Itch	UTSW	2	155179025	splice site	probably null
R1769:Itch	UTSW	2	155172561	missense	probably damaging	0.99
R1855:Itch	UTSW	2	155172454	splice site	probably benign
R1865:Itch	UTSW	2	155168746	missense	probably damaging	0.96
R2008:Itch	UTSW	2	155210459	missense	possibly damaging	0.91
R2054:Itch	UTSW	2	155210576	missense	probably damaging	1.00
R2196:Itch	UTSW	2	155202221	missense	probably benign
R2199:Itch	UTSW	2	155202221	missense	probably benign
R2252:Itch	UTSW	2	155212339	missense	probably benign	0.01
R2253:Itch	UTSW	2	155212339	missense	probably benign	0.01
R2348:Itch	UTSW	2	155209078	missense	possibly damaging	0.93
R2850:Itch	UTSW	2	155202221	missense	probably benign
R3021:Itch	UTSW	2	155209126	missense	possibly damaging	0.74
R4676:Itch	UTSW	2	155199435	missense	probably benign	0.05
R4716:Itch	UTSW	2	155210582	critical splice donor site	probably null
R4888:Itch	UTSW	2	155217977	splice site	probably null
R4970:Itch	UTSW	2	155185593	missense	possibly damaging	0.50
R6029:Itch	UTSW	2	155179089	critical splice donor site	probably null
R6122:Itch	UTSW	2	155174065	missense	probably benign	0.05
R6435:Itch	UTSW	2	155209129	missense	probably benign	0.01
R6449:Itch	UTSW	2	155163395	splice site	probably benign
R7069:Itch	UTSW	2	155209994	missense	probably damaging	1.00
R7083:Itch	UTSW	2	155210444	missense	probably damaging	1.00
R7409:Itch	UTSW	2	155199382	missense	probably damaging	0.99
R7689:Itch	UTSW	2	155210002	missense	probably damaging	0.99
R7689:Itch	UTSW	2	155213067	missense	probably benign	0.00
R8046:Itch	UTSW	2	155210502	missense	probably damaging	1.00
R8248:Itch	UTSW	2	155206383	critical splice donor site	probably null
R8355:Itch	UTSW	2	155210582	critical splice donor site	probably null
R8428:Itch	UTSW	2	155168707	missense	probably benign	0.38
R8691:Itch	UTSW	2	155210558	nonsense	probably null
R8779:Itch	UTSW	2	155172520	missense	probably benign	0.28
R9010:Itch	UTSW	2	155179071	missense	probably benign
R9130:Itch	UTSW	2	155210125	splice site	probably benign
R9278:Itch	UTSW	2	155203297	missense	probably benign	0.34
Z1177:Itch	UTSW	2	155209059	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGAGGCGTTTGCTCAAAAG -3'
(R):5'- TGAAACTCAAGCTCTTCATTACACG -3'

Sequencing Primer
(F):5'- CAAAAGCTAGAATACACTTTCATGTG -3'
(R):5'- GAGTCAAAAGGTACATAACCTC -3'

Posted On

2020-09-15