Incidental Mutation 'R0372:Ap3d1'
ID65617
Institutional Source Beutler Lab
Gene Symbol Ap3d1
Ensembl Gene ENSMUSG00000020198
Gene Nameadaptor-related protein complex 3, delta 1 subunit
SynonymsmBLVR1, Bolvr
MMRRC Submission 038578-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.932) question?
Stock #R0372 (G1)
Quality Score156
Status Validated
Chromosome10
Chromosomal Location80706956-80742264 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80723567 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 258 (K258E)
Ref Sequence ENSEMBL: ENSMUSP00000020420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020420]
Predicted Effect probably damaging
Transcript: ENSMUST00000020420
AA Change: K258E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020420
Gene: ENSMUSG00000020198
AA Change: K258E

DomainStartEndE-ValueType
Pfam:Adaptin_N 32 583 6.6e-153 PFAM
Pfam:Cnd1 130 292 2.1e-8 PFAM
low complexity region 629 642 N/A INTRINSIC
BLVR 660 803 5.3e-80 SMART
low complexity region 835 861 N/A INTRINSIC
low complexity region 871 881 N/A INTRINSIC
coiled coil region 910 933 N/A INTRINSIC
low complexity region 947 964 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219253
Predicted Effect probably benign
Transcript: ENSMUST00000219356
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220183
Meta Mutation Damage Score 0.4877 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 88.6%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the AP3 adaptor-like complex, which is not clathrin-associated, but is associated with the golgi region, as well as more peripheral structures. The AP-3 complex facilitates the budding of vesicles from the golgi membrane, and may be directly involved in trafficking to lysosomes. This subunit is implicated in intracellular biogenesis and trafficking of pigment granules, and possibly platelet dense granules and neurotransmitter vesicles. Defects in this gene are a cause of a new type of Hermansky-Pudlak syndrome. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mutant mice show coat and eye color dilution, platelet defects, lysosomal abnormalities, inner ear degeneration and neurological defects and model Hermansky-Pudlak storage pool deficiency syndrome. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik T A 14: 63,973,482 Q99L probably damaging Het
Abca2 A G 2: 25,437,353 Y641C probably damaging Het
Abhd10 A G 16: 45,736,891 probably null Het
Acan G T 7: 79,100,601 A1707S probably benign Het
Ankrd61 T A 5: 143,891,175 R284S probably benign Het
Arl6ip6 T G 2: 53,202,921 F153V probably damaging Het
Atp2c2 C A 8: 119,757,441 F930L probably benign Het
Avl9 T C 6: 56,726,324 probably null Het
Axin2 T A 11: 108,924,110 probably benign Het
Axin2 A G 11: 108,923,333 S16G probably damaging Het
Bbs7 A T 3: 36,602,832 D282E probably benign Het
Ccny A T 18: 9,345,201 V191D probably damaging Het
Cdk11b A G 4: 155,641,500 probably benign Het
Chd1 T A 17: 17,387,290 C367S probably benign Het
Cnnm4 G A 1: 36,498,010 V472M probably damaging Het
Cpb2 T A 14: 75,242,377 I8N probably benign Het
Dusp11 A G 6: 85,958,730 probably benign Het
Elmo1 T C 13: 20,572,459 probably null Het
Gbf1 C T 19: 46,285,704 P1726S probably benign Het
Hal A G 10: 93,507,553 probably benign Het
Hlcs T C 16: 94,138,907 I671V possibly damaging Het
Ifnab A G 4: 88,690,834 S132P probably benign Het
Ing5 T C 1: 93,812,420 I70T probably damaging Het
Ints1 T C 5: 139,772,438 N228S probably damaging Het
Itgb6 T A 2: 60,627,841 I523F probably benign Het
Kat2b T C 17: 53,638,537 F328S possibly damaging Het
Kbtbd3 A T 9: 4,316,950 I34F possibly damaging Het
Klhl11 A T 11: 100,463,522 I491N probably damaging Het
Lmo7 A T 14: 101,918,053 probably benign Het
Lrp1 G T 10: 127,592,136 P523T probably damaging Het
Lrp1b T A 2: 40,730,798 D3556V probably benign Het
Lrp2 T A 2: 69,535,043 H262L probably benign Het
Lrrc27 T A 7: 139,226,187 I256K probably benign Het
Lrrc47 G A 4: 154,019,632 R523K probably benign Het
Lrrc71 A T 3: 87,745,777 S111T probably benign Het
Map3k7cl T C 16: 87,581,212 V72A probably damaging Het
Mphosph10 G T 7: 64,388,855 probably benign Het
Nlrp4a T C 7: 26,449,232 probably benign Het
Nsd2 A T 5: 33,891,551 M1140L probably damaging Het
Nt5dc3 T C 10: 86,825,291 M440T possibly damaging Het
Olfr183 T C 16: 59,000,087 V134A probably benign Het
Oog4 A T 4: 143,437,689 L424Q probably damaging Het
Orc5 A T 5: 22,533,784 Y160N possibly damaging Het
Papola T C 12: 105,818,838 F410L probably benign Het
Pcdh10 A G 3: 45,379,497 E82G probably damaging Het
Pcdh20 T C 14: 88,469,003 Y287C probably damaging Het
Pld1 T A 3: 28,088,638 probably null Het
Plekha8 G A 6: 54,616,758 probably null Het
Ppbp C T 5: 90,769,343 T93M possibly damaging Het
Prpsap2 A G 11: 61,741,000 I177T possibly damaging Het
Rab3gap2 C T 1: 185,262,694 T810M possibly damaging Het
Rassf9 A G 10: 102,546,011 N418S possibly damaging Het
Rnf20 C G 4: 49,650,176 R582G possibly damaging Het
Serpine2 T C 1: 79,821,430 I36V probably damaging Het
Sf3b2 C T 19: 5,274,824 D845N probably damaging Het
Slc24a2 A T 4: 87,227,292 V175E probably damaging Het
Sned1 T C 1: 93,285,951 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spg11 GCC G 2: 122,059,447 probably null Het
Tecrl C T 5: 83,294,659 C189Y probably damaging Het
Tert A G 13: 73,648,991 D1116G probably damaging Het
Thnsl2 T C 6: 71,139,790 Y126C probably damaging Het
Tll2 T C 19: 41,183,313 probably null Het
Ubqln4 C T 3: 88,555,969 S147L probably benign Het
Ugt2b5 A T 5: 87,140,258 C17S probably benign Het
Vps41 A T 13: 18,842,247 Q505L probably benign Het
Zfp386 T C 12: 116,054,816 M35T possibly damaging Het
Zfp777 T C 6: 48,044,476 M71V possibly damaging Het
Zfp938 A T 10: 82,227,828 L34Q probably damaging Het
Zfp974 A T 7: 27,920,695 probably null Het
Other mutations in Ap3d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Ap3d1 APN 10 80741979 missense probably benign 0.00
IGL00827:Ap3d1 APN 10 80713559 missense possibly damaging 0.92
IGL01668:Ap3d1 APN 10 80719159 missense possibly damaging 0.95
IGL01934:Ap3d1 APN 10 80709258 nonsense probably null
IGL03404:Ap3d1 APN 10 80730037 missense probably damaging 1.00
christian UTSW 10 80730042 missense probably damaging 1.00
R0119:Ap3d1 UTSW 10 80723615 splice site probably benign
R0197:Ap3d1 UTSW 10 80730042 missense probably damaging 1.00
R0356:Ap3d1 UTSW 10 80727978 missense probably damaging 1.00
R0491:Ap3d1 UTSW 10 80719241 missense probably damaging 1.00
R0636:Ap3d1 UTSW 10 80719382 nonsense probably null
R0792:Ap3d1 UTSW 10 80708479 missense probably benign
R0942:Ap3d1 UTSW 10 80732955 splice site probably benign
R1015:Ap3d1 UTSW 10 80716489 missense probably damaging 1.00
R1023:Ap3d1 UTSW 10 80714258 missense probably damaging 1.00
R1170:Ap3d1 UTSW 10 80732840 splice site probably benign
R1540:Ap3d1 UTSW 10 80715941 missense probably benign 0.00
R1639:Ap3d1 UTSW 10 80730010 missense probably damaging 0.98
R1664:Ap3d1 UTSW 10 80717737 nonsense probably null
R1669:Ap3d1 UTSW 10 80710836 unclassified probably benign
R1839:Ap3d1 UTSW 10 80727108 missense probably damaging 1.00
R1940:Ap3d1 UTSW 10 80709773 missense probably benign 0.03
R2081:Ap3d1 UTSW 10 80732936 missense probably damaging 1.00
R2258:Ap3d1 UTSW 10 80721132 missense probably benign 0.03
R2281:Ap3d1 UTSW 10 80713998 missense probably damaging 0.96
R2398:Ap3d1 UTSW 10 80719172 nonsense probably null
R2849:Ap3d1 UTSW 10 80741908 missense possibly damaging 0.65
R3856:Ap3d1 UTSW 10 80712185 missense probably benign
R4350:Ap3d1 UTSW 10 80719285 missense probably benign 0.15
R4590:Ap3d1 UTSW 10 80719812 nonsense probably null
R4782:Ap3d1 UTSW 10 80721586 splice site probably null
R4785:Ap3d1 UTSW 10 80712778 frame shift probably null
R4834:Ap3d1 UTSW 10 80719726 missense probably damaging 1.00
R4864:Ap3d1 UTSW 10 80712778 frame shift probably null
R5051:Ap3d1 UTSW 10 80719199 missense probably damaging 1.00
R5109:Ap3d1 UTSW 10 80709450 missense probably benign 0.11
R5219:Ap3d1 UTSW 10 80709817 missense probably benign 0.03
R5220:Ap3d1 UTSW 10 80727167 missense probably damaging 1.00
R5307:Ap3d1 UTSW 10 80723549 missense probably benign 0.29
R5586:Ap3d1 UTSW 10 80719130 missense possibly damaging 0.92
R5796:Ap3d1 UTSW 10 80714037 missense possibly damaging 0.70
R5905:Ap3d1 UTSW 10 80722927 missense possibly damaging 0.50
R6025:Ap3d1 UTSW 10 80710464 missense probably benign 0.01
R6028:Ap3d1 UTSW 10 80722927 missense possibly damaging 0.50
R6364:Ap3d1 UTSW 10 80710494 intron probably null
R6469:Ap3d1 UTSW 10 80712158 missense probably benign
R6603:Ap3d1 UTSW 10 80714047 missense probably benign 0.04
R6872:Ap3d1 UTSW 10 80714322 nonsense probably null
R6887:Ap3d1 UTSW 10 80723698 missense probably damaging 1.00
R7249:Ap3d1 UTSW 10 80741933 missense probably damaging 1.00
R7316:Ap3d1 UTSW 10 80717859 missense probably damaging 1.00
R7325:Ap3d1 UTSW 10 80723803 missense probably damaging 1.00
R7395:Ap3d1 UTSW 10 80730882 missense probably benign 0.11
R7405:Ap3d1 UTSW 10 80741900 missense probably benign 0.16
R7425:Ap3d1 UTSW 10 80721592 missense probably damaging 1.00
R7558:Ap3d1 UTSW 10 80722921 missense possibly damaging 0.92
R7583:Ap3d1 UTSW 10 80709458 missense probably benign 0.13
R7703:Ap3d1 UTSW 10 80717844 missense probably damaging 1.00
R7964:Ap3d1 UTSW 10 80730057 missense probably damaging 1.00
R8021:Ap3d1 UTSW 10 80714301 missense probably benign 0.30
R8200:Ap3d1 UTSW 10 80722932 nonsense probably null
R8314:Ap3d1 UTSW 10 80723539 missense possibly damaging 0.91
X0019:Ap3d1 UTSW 10 80719102 missense probably damaging 1.00
X0026:Ap3d1 UTSW 10 80721147 missense possibly damaging 0.46
Z1088:Ap3d1 UTSW 10 80719237 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AGCCCCAGGATGGTAAAGGACTAC -3'
(R):5'- TGCCCTTGTTGATGGAGACACCAC -3'

Sequencing Primer
(F):5'- gcacacttaaaatcccagctc -3'
(R):5'- TTGATGGAGACACCACCTTGG -3'
Posted On2013-08-08