Incidental Mutation 'R0372:Ap3d1'
ID 65617
Institutional Source Beutler Lab
Gene Symbol Ap3d1
Ensembl Gene ENSMUSG00000020198
Gene Name adaptor-related protein complex 3, delta 1 subunit
Synonyms mBLVR1, Bolvr
MMRRC Submission 038578-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.931) question?
Stock # R0372 (G1)
Quality Score 156
Status Validated
Chromosome 10
Chromosomal Location 80542790-80578098 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 80559401 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 258 (K258E)
Ref Sequence ENSEMBL: ENSMUSP00000020420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020420]
AlphaFold O54774
Predicted Effect probably damaging
Transcript: ENSMUST00000020420
AA Change: K258E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020420
Gene: ENSMUSG00000020198
AA Change: K258E

DomainStartEndE-ValueType
Pfam:Adaptin_N 32 583 6.6e-153 PFAM
Pfam:Cnd1 130 292 2.1e-8 PFAM
low complexity region 629 642 N/A INTRINSIC
BLVR 660 803 5.3e-80 SMART
low complexity region 835 861 N/A INTRINSIC
low complexity region 871 881 N/A INTRINSIC
coiled coil region 910 933 N/A INTRINSIC
low complexity region 947 964 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219253
Predicted Effect probably benign
Transcript: ENSMUST00000219356
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220183
Meta Mutation Damage Score 0.4877 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 88.6%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the AP3 adaptor-like complex, which is not clathrin-associated, but is associated with the golgi region, as well as more peripheral structures. The AP-3 complex facilitates the budding of vesicles from the golgi membrane, and may be directly involved in trafficking to lysosomes. This subunit is implicated in intracellular biogenesis and trafficking of pigment granules, and possibly platelet dense granules and neurotransmitter vesicles. Defects in this gene are a cause of a new type of Hermansky-Pudlak syndrome. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mutant mice show coat and eye color dilution, platelet defects, lysosomal abnormalities, inner ear degeneration and neurological defects and model Hermansky-Pudlak storage pool deficiency syndrome. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik T A 14: 64,210,931 (GRCm39) Q99L probably damaging Het
Abca2 A G 2: 25,327,365 (GRCm39) Y641C probably damaging Het
Abhd10 A G 16: 45,557,254 (GRCm39) probably null Het
Acan G T 7: 78,750,349 (GRCm39) A1707S probably benign Het
Ankrd61 T A 5: 143,827,993 (GRCm39) R284S probably benign Het
Arl6ip6 T G 2: 53,092,933 (GRCm39) F153V probably damaging Het
Atp2c2 C A 8: 120,484,180 (GRCm39) F930L probably benign Het
Avl9 T C 6: 56,703,309 (GRCm39) probably null Het
Axin2 A G 11: 108,814,159 (GRCm39) S16G probably damaging Het
Axin2 T A 11: 108,814,936 (GRCm39) probably benign Het
Bbs7 A T 3: 36,656,981 (GRCm39) D282E probably benign Het
Ccny A T 18: 9,345,201 (GRCm39) V191D probably damaging Het
Cdk11b A G 4: 155,725,957 (GRCm39) probably benign Het
Chd1 T A 17: 17,607,552 (GRCm39) C367S probably benign Het
Cnnm4 G A 1: 36,537,091 (GRCm39) V472M probably damaging Het
Cpb2 T A 14: 75,479,817 (GRCm39) I8N probably benign Het
Dusp11 A G 6: 85,935,712 (GRCm39) probably benign Het
Elmo1 T C 13: 20,756,629 (GRCm39) probably null Het
Gbf1 C T 19: 46,274,143 (GRCm39) P1726S probably benign Het
Hal A G 10: 93,343,415 (GRCm39) probably benign Het
Hlcs T C 16: 93,939,766 (GRCm39) I671V possibly damaging Het
Ifnab A G 4: 88,609,071 (GRCm39) S132P probably benign Het
Ing5 T C 1: 93,740,142 (GRCm39) I70T probably damaging Het
Ints1 T C 5: 139,758,193 (GRCm39) N228S probably damaging Het
Itgb6 T A 2: 60,458,185 (GRCm39) I523F probably benign Het
Kat2b T C 17: 53,945,565 (GRCm39) F328S possibly damaging Het
Kbtbd3 A T 9: 4,316,950 (GRCm39) I34F possibly damaging Het
Klhl11 A T 11: 100,354,348 (GRCm39) I491N probably damaging Het
Lmo7 A T 14: 102,155,489 (GRCm39) probably benign Het
Lrp1 G T 10: 127,428,005 (GRCm39) P523T probably damaging Het
Lrp1b T A 2: 40,620,810 (GRCm39) D3556V probably benign Het
Lrp2 T A 2: 69,365,387 (GRCm39) H262L probably benign Het
Lrrc27 T A 7: 138,806,103 (GRCm39) I256K probably benign Het
Lrrc47 G A 4: 154,104,089 (GRCm39) R523K probably benign Het
Lrrc71 A T 3: 87,653,084 (GRCm39) S111T probably benign Het
Map3k7cl T C 16: 87,378,100 (GRCm39) V72A probably damaging Het
Mphosph10 G T 7: 64,038,603 (GRCm39) probably benign Het
Nlrp4a T C 7: 26,148,657 (GRCm39) probably benign Het
Nsd2 A T 5: 34,048,895 (GRCm39) M1140L probably damaging Het
Nt5dc3 T C 10: 86,661,155 (GRCm39) M440T possibly damaging Het
Oog4 A T 4: 143,164,259 (GRCm39) L424Q probably damaging Het
Or5h17 T C 16: 58,820,450 (GRCm39) V134A probably benign Het
Orc5 A T 5: 22,738,782 (GRCm39) Y160N possibly damaging Het
Papola T C 12: 105,785,097 (GRCm39) F410L probably benign Het
Pcdh10 A G 3: 45,333,932 (GRCm39) E82G probably damaging Het
Pcdh20 T C 14: 88,706,439 (GRCm39) Y287C probably damaging Het
Pld1 T A 3: 28,142,787 (GRCm39) probably null Het
Plekha8 G A 6: 54,593,743 (GRCm39) probably null Het
Ppbp C T 5: 90,917,202 (GRCm39) T93M possibly damaging Het
Prpsap2 A G 11: 61,631,826 (GRCm39) I177T possibly damaging Het
Rab3gap2 C T 1: 184,994,891 (GRCm39) T810M possibly damaging Het
Rassf9 A G 10: 102,381,872 (GRCm39) N418S possibly damaging Het
Rnf20 C G 4: 49,650,176 (GRCm39) R582G possibly damaging Het
Serpine2 T C 1: 79,799,147 (GRCm39) I36V probably damaging Het
Sf3b2 C T 19: 5,324,852 (GRCm39) D845N probably damaging Het
Slc24a2 A T 4: 87,145,529 (GRCm39) V175E probably damaging Het
Sned1 T C 1: 93,213,673 (GRCm39) probably benign Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Spg11 GCC G 2: 121,889,928 (GRCm39) probably null Het
Tecrl C T 5: 83,442,506 (GRCm39) C189Y probably damaging Het
Tert A G 13: 73,797,110 (GRCm39) D1116G probably damaging Het
Thnsl2 T C 6: 71,116,774 (GRCm39) Y126C probably damaging Het
Tll2 T C 19: 41,171,752 (GRCm39) probably null Het
Ubqln4 C T 3: 88,463,276 (GRCm39) S147L probably benign Het
Ugt2b5 A T 5: 87,288,117 (GRCm39) C17S probably benign Het
Vps41 A T 13: 19,026,417 (GRCm39) Q505L probably benign Het
Zfp386 T C 12: 116,018,436 (GRCm39) M35T possibly damaging Het
Zfp777 T C 6: 48,021,410 (GRCm39) M71V possibly damaging Het
Zfp938 A T 10: 82,063,662 (GRCm39) L34Q probably damaging Het
Zfp974 A T 7: 27,620,120 (GRCm39) probably null Het
Other mutations in Ap3d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Ap3d1 APN 10 80,577,813 (GRCm39) missense probably benign 0.00
IGL00827:Ap3d1 APN 10 80,549,393 (GRCm39) missense possibly damaging 0.92
IGL01668:Ap3d1 APN 10 80,554,993 (GRCm39) missense possibly damaging 0.95
IGL01934:Ap3d1 APN 10 80,545,092 (GRCm39) nonsense probably null
IGL03404:Ap3d1 APN 10 80,565,871 (GRCm39) missense probably damaging 1.00
christian UTSW 10 80,565,876 (GRCm39) missense probably damaging 1.00
Particle UTSW 10 80,546,328 (GRCm39) splice site probably null
vesicle UTSW 10 80,559,661 (GRCm39) missense probably damaging 1.00
R0119:Ap3d1 UTSW 10 80,559,449 (GRCm39) splice site probably benign
R0197:Ap3d1 UTSW 10 80,565,876 (GRCm39) missense probably damaging 1.00
R0356:Ap3d1 UTSW 10 80,563,812 (GRCm39) missense probably damaging 1.00
R0491:Ap3d1 UTSW 10 80,555,075 (GRCm39) missense probably damaging 1.00
R0636:Ap3d1 UTSW 10 80,555,216 (GRCm39) nonsense probably null
R0792:Ap3d1 UTSW 10 80,544,313 (GRCm39) missense probably benign
R0942:Ap3d1 UTSW 10 80,568,789 (GRCm39) splice site probably benign
R1015:Ap3d1 UTSW 10 80,552,323 (GRCm39) missense probably damaging 1.00
R1023:Ap3d1 UTSW 10 80,550,092 (GRCm39) missense probably damaging 1.00
R1170:Ap3d1 UTSW 10 80,568,674 (GRCm39) splice site probably benign
R1540:Ap3d1 UTSW 10 80,551,775 (GRCm39) missense probably benign 0.00
R1639:Ap3d1 UTSW 10 80,565,844 (GRCm39) missense probably damaging 0.98
R1664:Ap3d1 UTSW 10 80,553,571 (GRCm39) nonsense probably null
R1669:Ap3d1 UTSW 10 80,546,670 (GRCm39) unclassified probably benign
R1839:Ap3d1 UTSW 10 80,562,942 (GRCm39) missense probably damaging 1.00
R1940:Ap3d1 UTSW 10 80,545,607 (GRCm39) missense probably benign 0.03
R2081:Ap3d1 UTSW 10 80,568,770 (GRCm39) missense probably damaging 1.00
R2258:Ap3d1 UTSW 10 80,556,966 (GRCm39) missense probably benign 0.03
R2281:Ap3d1 UTSW 10 80,549,832 (GRCm39) missense probably damaging 0.96
R2398:Ap3d1 UTSW 10 80,555,006 (GRCm39) nonsense probably null
R2849:Ap3d1 UTSW 10 80,577,742 (GRCm39) missense possibly damaging 0.65
R3856:Ap3d1 UTSW 10 80,548,019 (GRCm39) missense probably benign
R4350:Ap3d1 UTSW 10 80,555,119 (GRCm39) missense probably benign 0.15
R4590:Ap3d1 UTSW 10 80,555,646 (GRCm39) nonsense probably null
R4782:Ap3d1 UTSW 10 80,557,420 (GRCm39) splice site probably null
R4785:Ap3d1 UTSW 10 80,548,612 (GRCm39) frame shift probably null
R4834:Ap3d1 UTSW 10 80,555,560 (GRCm39) missense probably damaging 1.00
R4864:Ap3d1 UTSW 10 80,548,612 (GRCm39) frame shift probably null
R5051:Ap3d1 UTSW 10 80,555,033 (GRCm39) missense probably damaging 1.00
R5109:Ap3d1 UTSW 10 80,545,284 (GRCm39) missense probably benign 0.11
R5219:Ap3d1 UTSW 10 80,545,651 (GRCm39) missense probably benign 0.03
R5220:Ap3d1 UTSW 10 80,563,001 (GRCm39) missense probably damaging 1.00
R5307:Ap3d1 UTSW 10 80,559,383 (GRCm39) missense probably benign 0.29
R5586:Ap3d1 UTSW 10 80,554,964 (GRCm39) missense possibly damaging 0.92
R5796:Ap3d1 UTSW 10 80,549,871 (GRCm39) missense possibly damaging 0.70
R5905:Ap3d1 UTSW 10 80,558,761 (GRCm39) missense possibly damaging 0.50
R6025:Ap3d1 UTSW 10 80,546,298 (GRCm39) missense probably benign 0.01
R6028:Ap3d1 UTSW 10 80,558,761 (GRCm39) missense possibly damaging 0.50
R6364:Ap3d1 UTSW 10 80,546,328 (GRCm39) splice site probably null
R6469:Ap3d1 UTSW 10 80,547,992 (GRCm39) missense probably benign
R6603:Ap3d1 UTSW 10 80,549,881 (GRCm39) missense probably benign 0.04
R6872:Ap3d1 UTSW 10 80,550,156 (GRCm39) nonsense probably null
R6887:Ap3d1 UTSW 10 80,559,532 (GRCm39) missense probably damaging 1.00
R7249:Ap3d1 UTSW 10 80,577,767 (GRCm39) missense probably damaging 1.00
R7316:Ap3d1 UTSW 10 80,553,693 (GRCm39) missense probably damaging 1.00
R7325:Ap3d1 UTSW 10 80,559,637 (GRCm39) missense probably damaging 1.00
R7395:Ap3d1 UTSW 10 80,566,716 (GRCm39) missense probably benign 0.11
R7405:Ap3d1 UTSW 10 80,577,734 (GRCm39) missense probably benign 0.16
R7425:Ap3d1 UTSW 10 80,557,426 (GRCm39) missense probably damaging 1.00
R7558:Ap3d1 UTSW 10 80,558,755 (GRCm39) missense possibly damaging 0.92
R7583:Ap3d1 UTSW 10 80,545,292 (GRCm39) missense probably benign 0.13
R7703:Ap3d1 UTSW 10 80,553,678 (GRCm39) missense probably damaging 1.00
R7964:Ap3d1 UTSW 10 80,565,891 (GRCm39) missense probably damaging 1.00
R8021:Ap3d1 UTSW 10 80,550,135 (GRCm39) missense probably benign 0.30
R8200:Ap3d1 UTSW 10 80,558,766 (GRCm39) nonsense probably null
R8314:Ap3d1 UTSW 10 80,559,373 (GRCm39) missense possibly damaging 0.91
R8356:Ap3d1 UTSW 10 80,568,737 (GRCm39) missense probably damaging 1.00
R8896:Ap3d1 UTSW 10 80,552,425 (GRCm39) missense probably benign 0.01
R8936:Ap3d1 UTSW 10 80,547,952 (GRCm39) missense probably benign 0.02
R9183:Ap3d1 UTSW 10 80,545,627 (GRCm39) missense probably null 0.06
R9209:Ap3d1 UTSW 10 80,554,918 (GRCm39) missense probably benign 0.04
R9259:Ap3d1 UTSW 10 80,559,661 (GRCm39) missense probably damaging 1.00
R9476:Ap3d1 UTSW 10 80,545,655 (GRCm39) missense probably benign 0.00
R9645:Ap3d1 UTSW 10 80,545,062 (GRCm39) missense probably benign
R9664:Ap3d1 UTSW 10 80,548,639 (GRCm39) missense possibly damaging 0.71
R9781:Ap3d1 UTSW 10 80,545,609 (GRCm39) missense possibly damaging 0.51
X0019:Ap3d1 UTSW 10 80,554,936 (GRCm39) missense probably damaging 1.00
X0026:Ap3d1 UTSW 10 80,556,981 (GRCm39) missense possibly damaging 0.46
Z1088:Ap3d1 UTSW 10 80,555,071 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AGCCCCAGGATGGTAAAGGACTAC -3'
(R):5'- TGCCCTTGTTGATGGAGACACCAC -3'

Sequencing Primer
(F):5'- gcacacttaaaatcccagctc -3'
(R):5'- TTGATGGAGACACCACCTTGG -3'
Posted On 2013-08-08