Mutagenetix > Incidental Mutations

Incidental Mutation 'R2258:Ap3d1'

243555

Institutional Source

Beutler Lab

Gene Symbol

Ap3d1

Ensembl Gene

ENSMUSG00000020198

Gene Name

adaptor-related protein complex 3, delta 1 subunit

Synonyms

mBLVR1, Bolvr

MMRRC Submission

040258-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.924) question?

Stock #

R2258 (G1)

Quality Score

195

Status

Not validated

Chromosome

Chromosomal Location

80706956-80742264 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 80721132 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 315 (S315P)

Ref Sequence

ENSEMBL: ENSMUSP00000020420 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020420]

Predicted Effect

probably benign
Transcript: ENSMUST00000020420
AA Change: S315P

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000020420
Gene: ENSMUSG00000020198
AA Change: S315P

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	32	583	6.6e-153	PFAM
Pfam:Cnd1	130	292	2.1e-8	PFAM
low complexity region	629	642	N/A	INTRINSIC
BLVR	660	803	5.3e-80	SMART
low complexity region	835	861	N/A	INTRINSIC
low complexity region	871	881	N/A	INTRINSIC
coiled coil region	910	933	N/A	INTRINSIC
low complexity region	947	964	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218125

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219253

Predicted Effect

probably benign
Transcript: ENSMUST00000219356

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220183

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the AP3 adaptor-like complex, which is not clathrin-associated, but is associated with the golgi region, as well as more peripheral structures. The AP-3 complex facilitates the budding of vesicles from the golgi membrane, and may be directly involved in trafficking to lysosomes. This subunit is implicated in intracellular biogenesis and trafficking of pigment granules, and possibly platelet dense granules and neurotransmitter vesicles. Defects in this gene are a cause of a new type of Hermansky-Pudlak syndrome. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mutant mice show coat and eye color dilution, platelet defects, lysosomal abnormalities, inner ear degeneration and neurological defects and model Hermansky-Pudlak storage pool deficiency syndrome. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	T	C	3: 124,413,618	N308S	possibly damaging	Het
Acot5	A	T	12: 84,075,869	H409L	possibly damaging	Het
Ang4	A	G	14: 51,764,498		probably benign	Het
Arhgap15	G	A	2: 44,386,347	G437R	probably damaging	Het
Cacna2d1	T	C	5: 16,357,289	C810R	probably damaging	Het
Capn5	A	G	7: 98,135,875	W131R	probably damaging	Het
Ccnj	A	G	19: 40,845,833	Q292R	probably benign	Het
Cd177	A	G	7: 24,756,236	V287A	possibly damaging	Het
Cdk5r2	T	C	1: 74,855,900	L268P	probably damaging	Het
Clrn2	A	G	5: 45,453,962	D51G	probably benign	Het
Cntd1	T	C	11: 101,284,856	S174P	probably damaging	Het
Col11a2	A	G	17: 34,039,677	H8R	probably benign	Het
Col17a1	C	T	19: 47,681,377		probably null	Het
Cyp2a5	A	G	7: 26,837,103	D169G	possibly damaging	Het
Cyp2c37	A	G	19: 39,995,859	I264V	possibly damaging	Het
Cyp2j12	A	G	4: 96,133,078	I97T	probably damaging	Het
Eif3b	T	C	5: 140,427,503	F354L	possibly damaging	Het
Entpd2	C	T	2: 25,398,087	P108S	probably damaging	Het
F5	T	A	1: 164,192,181	S742T	probably damaging	Het
Fam187a	A	G	11: 102,885,298		probably benign	Het
Fam43b	G	C	4: 138,395,098	R304G	probably benign	Het
Fam69b	T	C	2: 26,635,150	L157P	probably damaging	Het
Flnc	G	A	6: 29,438,666	W186*	probably null	Het
Fndc3b	G	T	3: 27,440,160	Q939K	possibly damaging	Het
Gja4	C	A	4: 127,312,830	D47Y	probably damaging	Het
Gm11565	T	G	11: 99,915,018	C79G	possibly damaging	Het
Gm17689	C	A	9: 36,581,865	V54L	probably benign	Het
Gm5065	A	G	7: 5,359,402	M11V	probably benign	Het
Gm8994	A	T	6: 136,328,561	M7L	probably benign	Het
Gpbar1	T	C	1: 74,279,005	F136L	probably benign	Het
Gsn	G	A	2: 35,290,337	G130E	probably damaging	Het
Hecw1	A	T	13: 14,316,138	D756E	probably benign	Het
Hrasls5	C	T	19: 7,612,746	R46C	probably damaging	Het
Hrc	C	A	7: 45,336,681	R419S	possibly damaging	Het
Inpp4a	T	A	1: 37,377,696	S433T	probably damaging	Het
Ism2	C	A	12: 87,280,074	V320L	possibly damaging	Het
Krt8	G	T	15: 101,998,822	D275E	probably benign	Het
Lyg2	A	C	1: 37,908,996	N132K	probably benign	Het
Lyst	G	A	13: 13,637,658	R885Q	probably benign	Het
Marveld2	A	G	13: 100,612,470	S34P	probably benign	Het
Mcc	C	A	18: 44,475,136	G355W	probably damaging	Het
Mettl7a1	A	T	15: 100,313,168	I174F	probably benign	Het
Mllt6	T	C	11: 97,664,976	V44A	probably damaging	Het
Mrgpra3	A	T	7: 47,590,094	M28K	probably benign	Het
Ms4a15	A	G	19: 10,984,795	C47R	probably benign	Het
Muc5ac	A	G	7: 141,791,008	N72S	probably benign	Het
Myo18b	C	T	5: 112,874,663		probably benign	Het
Nat8f4	A	T	6: 85,901,225	H105Q	possibly damaging	Het
Ncapd3	A	G	9: 27,056,072	D568G	probably benign	Het
Nptx1	T	G	11: 119,543,316	I315L	probably benign	Het
Nrap	T	C	19: 56,321,962	R1534G	possibly damaging	Het
Nwd2	C	A	5: 63,805,156	N694K	probably benign	Het
Oas1c	G	A	5: 120,803,017	A35V	probably null	Het
Olfr1350	A	T	7: 6,570,023	I11F	probably damaging	Het
Olfr1532-ps1	A	G	7: 106,914,906	K236R	probably damaging	Het
Olfr482	C	T	7: 108,095,195	R125H	possibly damaging	Het
Olfr933	T	C	9: 38,976,000	V108A	probably benign	Het
Pde2a	A	T	7: 101,484,567	D85V	probably damaging	Het
Prex1	C	T	2: 166,587,157	V839I	probably benign	Het
Psmd3	T	A	11: 98,690,964	M305K	probably benign	Het
Rbm20	T	C	19: 53,851,741	S1054P	probably benign	Het
Rhox13	G	C	X: 38,121,344	E19Q	unknown	Het
Ryr2	A	G	13: 11,738,216	F1740L	possibly damaging	Het
Sox1	C	A	8: 12,396,927	N189K	possibly damaging	Het
Spta1	C	A	1: 174,174,341	S12R	possibly damaging	Het
Stard13	A	G	5: 151,039,731	L971P	probably damaging	Het
Tigd4	T	A	3: 84,594,293	N172K	probably benign	Het
Ttyh1	T	C	7: 4,128,184	V218A	probably damaging	Het
Twistnb	A	G	12: 33,433,588	H113R	probably damaging	Het
Unc45b	T	A	11: 82,917,799	M237K	probably benign	Het
Vldlr	A	G	19: 27,238,386	D220G	probably damaging	Het
Vps13c	A	G	9: 67,953,860	N2891S	probably benign	Het
Wdr25	T	A	12: 108,898,174	S82T	possibly damaging	Het
Wdr66	C	G	5: 123,283,348		probably null	Het
Wnk4	C	A	11: 101,275,035	P796Q	probably damaging	Het
Xpo5	C	T	17: 46,240,896	Q1050*	probably null	Het
Zc3h15	G	A	2: 83,657,016	V60I	probably benign	Het
Zfp629	G	A	7: 127,611,791	T282M	probably damaging	Het
Zscan22	T	G	7: 12,903,960	V93G	probably damaging	Het

Other mutations in Ap3d1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Ap3d1	APN	10	80741979	missense	probably benign	0.00
IGL00827:Ap3d1	APN	10	80713559	missense	possibly damaging	0.92
IGL01668:Ap3d1	APN	10	80719159	missense	possibly damaging	0.95
IGL01934:Ap3d1	APN	10	80709258	nonsense	probably null
IGL03404:Ap3d1	APN	10	80730037	missense	probably damaging	1.00
christian	UTSW	10	80730042	missense	probably damaging	1.00
R0119:Ap3d1	UTSW	10	80723615	splice site	probably benign
R0197:Ap3d1	UTSW	10	80730042	missense	probably damaging	1.00
R0356:Ap3d1	UTSW	10	80727978	missense	probably damaging	1.00
R0372:Ap3d1	UTSW	10	80723567	missense	probably damaging	1.00
R0491:Ap3d1	UTSW	10	80719241	missense	probably damaging	1.00
R0636:Ap3d1	UTSW	10	80719382	nonsense	probably null
R0792:Ap3d1	UTSW	10	80708479	missense	probably benign
R0942:Ap3d1	UTSW	10	80732955	splice site	probably benign
R1015:Ap3d1	UTSW	10	80716489	missense	probably damaging	1.00
R1023:Ap3d1	UTSW	10	80714258	missense	probably damaging	1.00
R1170:Ap3d1	UTSW	10	80732840	splice site	probably benign
R1540:Ap3d1	UTSW	10	80715941	missense	probably benign	0.00
R1639:Ap3d1	UTSW	10	80730010	missense	probably damaging	0.98
R1664:Ap3d1	UTSW	10	80717737	nonsense	probably null
R1669:Ap3d1	UTSW	10	80710836	unclassified	probably benign
R1839:Ap3d1	UTSW	10	80727108	missense	probably damaging	1.00
R1940:Ap3d1	UTSW	10	80709773	missense	probably benign	0.03
R2081:Ap3d1	UTSW	10	80732936	missense	probably damaging	1.00
R2281:Ap3d1	UTSW	10	80713998	missense	probably damaging	0.96
R2398:Ap3d1	UTSW	10	80719172	nonsense	probably null
R2849:Ap3d1	UTSW	10	80741908	missense	possibly damaging	0.65
R3856:Ap3d1	UTSW	10	80712185	missense	probably benign
R4350:Ap3d1	UTSW	10	80719285	missense	probably benign	0.15
R4590:Ap3d1	UTSW	10	80719812	nonsense	probably null
R4782:Ap3d1	UTSW	10	80721586	splice site	probably null
R4785:Ap3d1	UTSW	10	80712778	frame shift	probably null
R4834:Ap3d1	UTSW	10	80719726	missense	probably damaging	1.00
R4864:Ap3d1	UTSW	10	80712778	frame shift	probably null
R5051:Ap3d1	UTSW	10	80719199	missense	probably damaging	1.00
R5109:Ap3d1	UTSW	10	80709450	missense	probably benign	0.11
R5219:Ap3d1	UTSW	10	80709817	missense	probably benign	0.03
R5220:Ap3d1	UTSW	10	80727167	missense	probably damaging	1.00
R5307:Ap3d1	UTSW	10	80723549	missense	probably benign	0.29
R5586:Ap3d1	UTSW	10	80719130	missense	possibly damaging	0.92
R5796:Ap3d1	UTSW	10	80714037	missense	possibly damaging	0.70
R5905:Ap3d1	UTSW	10	80722927	missense	possibly damaging	0.50
R6025:Ap3d1	UTSW	10	80710464	missense	probably benign	0.01
R6028:Ap3d1	UTSW	10	80722927	missense	possibly damaging	0.50
R6364:Ap3d1	UTSW	10	80710494	splice site	probably null
R6469:Ap3d1	UTSW	10	80712158	missense	probably benign
R6603:Ap3d1	UTSW	10	80714047	missense	probably benign	0.04
R6872:Ap3d1	UTSW	10	80714322	nonsense	probably null
R6887:Ap3d1	UTSW	10	80723698	missense	probably damaging	1.00
R7249:Ap3d1	UTSW	10	80741933	missense	probably damaging	1.00
R7316:Ap3d1	UTSW	10	80717859	missense	probably damaging	1.00
R7325:Ap3d1	UTSW	10	80723803	missense	probably damaging	1.00
R7395:Ap3d1	UTSW	10	80730882	missense	probably benign	0.11
R7405:Ap3d1	UTSW	10	80741900	missense	probably benign	0.16
R7425:Ap3d1	UTSW	10	80721592	missense	probably damaging	1.00
R7558:Ap3d1	UTSW	10	80722921	missense	possibly damaging	0.92
R7583:Ap3d1	UTSW	10	80709458	missense	probably benign	0.13
R7703:Ap3d1	UTSW	10	80717844	missense	probably damaging	1.00
R7964:Ap3d1	UTSW	10	80730057	missense	probably damaging	1.00
R8021:Ap3d1	UTSW	10	80714301	missense	probably benign	0.30
R8200:Ap3d1	UTSW	10	80722932	nonsense	probably null
R8314:Ap3d1	UTSW	10	80723539	missense	possibly damaging	0.91
R8356:Ap3d1	UTSW	10	80732903	missense	probably damaging	1.00
X0019:Ap3d1	UTSW	10	80719102	missense	probably damaging	1.00
X0026:Ap3d1	UTSW	10	80721147	missense	possibly damaging	0.46
Z1088:Ap3d1	UTSW	10	80719237	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- AGTAGGTTGCTTCATGCTTCCC -3'
(R):5'- TTAGTCATGCTGAGCAGGGTC -3'

Sequencing Primer
(F):5'- AAGGCTAGCCAGACTGCG -3'
(R):5'- CAGGGTCCCCAGAGCAAAG -3'

Posted On

2014-10-16