Mutagenetix > Incidental Mutation

Incidental Mutation 'R8798:Nlrp2'

671367

Institutional Source

Beutler Lab

Gene Symbol

Nlrp2

Ensembl Gene

ENSMUSG00000035177

Gene Name

NLR family, pyrin domain containing 2

Synonyms

Nbs1, Pan1, PYPAF2, E330007A02Rik, Nalp2

MMRRC Submission

068724-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8798 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

5298547-5351035 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 5327888 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 503 (I503K)

Ref Sequence

ENSEMBL: ENSMUSP00000045077 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045022]

AlphaFold

Q4PLS0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000045022
AA Change: I503K

PolyPhen 2 Score 0.857 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000045077
Gene: ENSMUSG00000035177
AA Change: I503K

Domain	Start	End	E-Value	Type
PYRIN	7	90	2.88e-17	SMART
Pfam:NACHT	180	348	6.9e-30	PFAM
internal_repeat_1	676	722	1.74e-5	PROSPERO
LRR	796	823	1.26e1	SMART
LRR	825	852	1.18e1	SMART
LRR	853	880	5.81e-2	SMART
LRR	882	909	3.39e-3	SMART
LRR	910	937	5.06e-2	SMART
LRR	939	966	5.23e0	SMART
LRR	967	994	3.58e-2	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (74/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the nucleotide-binding and leucine-rich repeat receptor (NLR) family, and is predicted to contain an N-terminal pyrin effector domain (PYD), a centrally-located nucleotide-binding and oligomerization domain (NACHT) and C-terminal leucine-rich repeats (LRR). Members of this gene family are thought to be important regulators of immune responses. This gene product interacts with components of the IkB kinase (IKK) complex, and can regulate both caspase-1 and NF-kB (nuclear factor kappa-light-chain-enhancer of activated B cells) activity. The pyrin domain is necessary and sufficient for suppression of NF-kB activity. An allelic variant (rs147585490) has been found that is incapable of blocking the transcriptional activity of NF-kB. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011L22Rik	G	A	8: 79,210,751	R176*	probably null	Het
2610044O15Rik8	G	A	8: 129,219,298	H349Y	probably damaging	Het
4921539E11Rik	A	C	4: 103,266,377		probably benign	Het
A430078G23Rik	T	A	8: 3,364,645	Y8N	probably benign	Het
Abcc2	A	G	19: 43,808,666	N492S	probably benign	Het
Acox1	T	C	11: 116,174,357	Y624C	probably damaging	Het
Aff4	T	C	11: 53,400,508		probably benign	Het
Ak9	T	A	10: 41,382,851	D781E		Het
Arfgef3	T	C	10: 18,647,051	D409G	probably damaging	Het
Blnk	A	G	19: 40,962,351	Y119H	probably damaging	Het
Brsk2	T	C	7: 141,987,864	L310P	probably damaging	Het
Cit	T	A	5: 115,969,043	L1078Q	probably damaging	Het
Cpn1	A	T	19: 43,986,236	V18D	possibly damaging	Het
Csmd3	A	T	15: 47,731,986	Y1115N		Het
Dnah9	A	C	11: 65,905,231	V3589G	probably damaging	Het
Dpp9	T	C	17: 56,199,037	Y454C	probably damaging	Het
Eif3i	A	G	4: 129,596,924	V67A	probably benign	Het
Eif6	T	C	2: 155,822,966	N200S	probably damaging	Het
Fbxo10	T	C	4: 45,051,605	H502R	possibly damaging	Het
Fcer1a	A	G	1: 173,225,480	Y50H	probably benign	Het
Filip1	G	A	9: 79,820,090	H416Y	possibly damaging	Het
Frmpd1	A	T	4: 45,285,424	N1415I	possibly damaging	Het
Gdpgp1	C	T	7: 80,238,977	P252L	probably damaging	Het
Gm340	C	T	19: 41,585,259	R818W	probably damaging	Het
Gsap	T	C	5: 21,271,250		probably null	Het
Hgs	T	C	11: 120,480,112	V598A	probably benign	Het
Irf2	G	T	8: 46,807,314	V94L	probably benign	Het
Kalrn	G	T	16: 33,982,855	H2675Q	possibly damaging	Het
Klhl33	C	A	14: 50,893,108	A50S	possibly damaging	Het
Klk1b11	T	C	7: 43,995,948	I15T	probably benign	Het
Lrrn3	A	G	12: 41,453,175	M381T	possibly damaging	Het
Ltbr	A	G	6: 125,307,295	Y395H	probably benign	Het
Ltf	A	G	9: 111,023,760		probably benign	Het
Ly75	A	G	2: 60,323,926	F1059S	probably benign	Het
Lypd6	T	A	2: 50,188,762	I90N	possibly damaging	Het
Map1a	G	A	2: 121,302,287	V1195M	probably benign	Het
Mb21d1	G	A	9: 78,443,066	R5C	probably benign	Het
Mroh2b	A	T	15: 4,948,709	I1320F	probably damaging	Het
Mug2	A	G	6: 122,081,610	T1324A	probably damaging	Het
Mylk	G	A	16: 34,899,402	V562M	possibly damaging	Het
Myo15b	G	A	11: 115,863,406	G911R		Het
Neo1	A	G	9: 58,913,166	Y825H	probably damaging	Het
Nfat5	T	G	8: 107,347,689	V343G	probably damaging	Het
Olfr180	A	T	16: 58,915,944	D232E	probably benign	Het
Olfr270	C	A	4: 52,970,790	H56Q	possibly damaging	Het
Olfr924	G	A	9: 38,848,917	E268K	probably benign	Het
Olfr975	G	A	9: 39,950,717	T18I	probably benign	Het
Pdcl2	T	C	5: 76,325,100	D7G	probably damaging	Het
Phyh	C	T	2: 4,919,082	R5C	probably damaging	Het
Prr11	A	C	11: 87,106,055	S28A	unknown	Het
Psmd13	T	A	7: 140,897,750	L190*	probably null	Het
Ptx4	A	G	17: 25,124,742	D322G	probably damaging	Het
Rnf40	T	C	7: 127,589,782	L109P	probably damaging	Het
Rrp1	T	C	10: 78,409,190	T102A	probably damaging	Het
Sema4a	T	G	3: 88,436,697	D749A	possibly damaging	Het
Serpina3f	A	T	12: 104,217,443	D188V	probably benign	Het
Smarca5	C	A	8: 80,716,508	A570S	probably damaging	Het
Spocd1	G	C	4: 129,930,204		probably null	Het
Stard9	G	A	2: 120,704,731	G3823D	probably benign	Het
Suco	A	G	1: 161,820,435	L1094S	probably damaging	Het
Tcf7	T	C	11: 52,260,594	D79G	probably damaging	Het
Tdrd12	A	G	7: 35,529,180	M39T	probably damaging	Het
Thnsl1	A	G	2: 21,212,398	N321S	probably benign	Het
Tmem132c	T	A	5: 127,360,153	Y235*	probably null	Het
Tnfaip6	T	C	2: 52,043,812	F60L	probably benign	Het
Tnpo3	T	C	6: 29,572,621	I411V	probably benign	Het
Trio	A	C	15: 27,851,837	V856G	possibly damaging	Het
Trpc2	C	G	7: 102,084,560	R239G	probably benign	Het
Ttn	C	T	2: 76,826,132	V12502I	unknown	Het
Usf3	A	G	16: 44,220,173	D1672G	probably damaging	Het
Usp24	A	G	4: 106,379,239	N1011S	probably benign	Het
Vac14	A	G	8: 110,719,887	E756G	probably benign	Het
Vmn2r41	A	G	7: 8,161,523	L10P	probably damaging	Het
Xrcc5	T	C	1: 72,314,178	M115T	probably damaging	Het
Zfp827	G	A	8: 79,189,834		probably benign	Het
Zmym1	A	T	4: 127,049,871	N241K	possibly damaging	Het

Other mutations in Nlrp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Nlrp2	APN	7	5337548	missense	probably benign	0.00
IGL00545:Nlrp2	APN	7	5328252	missense	possibly damaging	0.89
IGL01311:Nlrp2	APN	7	5319239	missense	possibly damaging	0.92
IGL01345:Nlrp2	APN	7	5317492	missense	probably benign	0.16
IGL01583:Nlrp2	APN	7	5337770	missense	probably damaging	1.00
IGL01659:Nlrp2	APN	7	5328035	missense	probably damaging	1.00
IGL02240:Nlrp2	APN	7	5327823	missense	probably damaging	1.00
IGL02353:Nlrp2	APN	7	5337599	missense	probably damaging	1.00
IGL02360:Nlrp2	APN	7	5337599	missense	probably damaging	1.00
IGL02399:Nlrp2	APN	7	5328810	missense	probably damaging	1.00
IGL02441:Nlrp2	APN	7	5335567	critical splice donor site	probably null
IGL02588:Nlrp2	APN	7	5327552	nonsense	probably null
IGL02803:Nlrp2	APN	7	5328318	missense	probably damaging	1.00
IGL02968:Nlrp2	APN	7	5301025	missense	possibly damaging	0.81
IGL03342:Nlrp2	APN	7	5317483	missense	probably damaging	1.00
BB006:Nlrp2	UTSW	7	5327499	missense	probably damaging	1.00
BB016:Nlrp2	UTSW	7	5327499	missense	probably damaging	1.00
R0027:Nlrp2	UTSW	7	5322448	missense	probably damaging	1.00
R0051:Nlrp2	UTSW	7	5322334	unclassified	probably benign
R0079:Nlrp2	UTSW	7	5327730	missense	possibly damaging	0.81
R0130:Nlrp2	UTSW	7	5322418	missense	possibly damaging	0.77
R0157:Nlrp2	UTSW	7	5308770	missense	possibly damaging	0.88
R0201:Nlrp2	UTSW	7	5328329	missense	probably benign	0.00
R0276:Nlrp2	UTSW	7	5328109	missense	probably benign	0.00
R0288:Nlrp2	UTSW	7	5328545	missense	probably benign	0.19
R0332:Nlrp2	UTSW	7	5317630	missense	probably damaging	1.00
R0724:Nlrp2	UTSW	7	5319222	missense	probably damaging	1.00
R1241:Nlrp2	UTSW	7	5328431	missense	probably damaging	1.00
R1355:Nlrp2	UTSW	7	5327491	missense	possibly damaging	0.81
R1392:Nlrp2	UTSW	7	5329015	splice site	probably benign
R1470:Nlrp2	UTSW	7	5300951	missense	probably benign	0.18
R1470:Nlrp2	UTSW	7	5300951	missense	probably benign	0.18
R1563:Nlrp2	UTSW	7	5308725	missense	probably damaging	1.00
R1866:Nlrp2	UTSW	7	5327716	nonsense	probably null
R1942:Nlrp2	UTSW	7	5322448	missense	probably damaging	1.00
R1959:Nlrp2	UTSW	7	5327738	missense	probably damaging	1.00
R1960:Nlrp2	UTSW	7	5327738	missense	probably damaging	1.00
R1961:Nlrp2	UTSW	7	5327738	missense	probably damaging	1.00
R2072:Nlrp2	UTSW	7	5325006	missense	probably damaging	1.00
R2161:Nlrp2	UTSW	7	5325042	missense	probably damaging	1.00
R2190:Nlrp2	UTSW	7	5319238	missense	possibly damaging	0.95
R2243:Nlrp2	UTSW	7	5335598	missense	probably benign	0.03
R2277:Nlrp2	UTSW	7	5328129	missense	probably benign
R2334:Nlrp2	UTSW	7	5337535	missense	probably benign	0.39
R3030:Nlrp2	UTSW	7	5327748	missense	probably damaging	1.00
R3404:Nlrp2	UTSW	7	5319287	missense	probably benign	0.01
R3941:Nlrp2	UTSW	7	5327552	nonsense	probably null
R4021:Nlrp2	UTSW	7	5325012	missense	probably benign	0.40
R4518:Nlrp2	UTSW	7	5325056	missense	possibly damaging	0.85
R4666:Nlrp2	UTSW	7	5319189	missense	probably benign	0.18
R4767:Nlrp2	UTSW	7	5328024	missense	probably damaging	1.00
R4827:Nlrp2	UTSW	7	5328951	missense	possibly damaging	0.60
R4873:Nlrp2	UTSW	7	5298859	missense	probably benign	0.09
R4875:Nlrp2	UTSW	7	5298859	missense	probably benign	0.09
R5020:Nlrp2	UTSW	7	5328077	missense	probably damaging	1.00
R5293:Nlrp2	UTSW	7	5327615	missense	probably damaging	1.00
R5310:Nlrp2	UTSW	7	5325008	missense	probably benign	0.00
R5336:Nlrp2	UTSW	7	5328119	missense	probably benign
R5390:Nlrp2	UTSW	7	5300909	missense	probably benign	0.00
R5864:Nlrp2	UTSW	7	5322381	missense	probably damaging	1.00
R5913:Nlrp2	UTSW	7	5324903	splice site	probably null
R6173:Nlrp2	UTSW	7	5337809	missense	probably damaging	0.96
R6274:Nlrp2	UTSW	7	5317555	missense	probably damaging	1.00
R6303:Nlrp2	UTSW	7	5337761	missense	probably damaging	1.00
R6343:Nlrp2	UTSW	7	5300926	missense	possibly damaging	0.82
R6704:Nlrp2	UTSW	7	5325041	nonsense	probably null
R6814:Nlrp2	UTSW	7	5308710	missense	probably benign	0.01
R6872:Nlrp2	UTSW	7	5308710	missense	probably benign	0.01
R7023:Nlrp2	UTSW	7	5328229	nonsense	probably null
R7028:Nlrp2	UTSW	7	5328572	missense	possibly damaging	0.93
R7109:Nlrp2	UTSW	7	5328617	missense	probably damaging	1.00
R7203:Nlrp2	UTSW	7	5317534	missense	probably damaging	1.00
R7322:Nlrp2	UTSW	7	5308645	missense	possibly damaging	0.94
R7339:Nlrp2	UTSW	7	5327628	missense	possibly damaging	0.95
R7573:Nlrp2	UTSW	7	5317469	critical splice donor site	probably null
R7657:Nlrp2	UTSW	7	5319168	missense	probably benign	0.01
R7929:Nlrp2	UTSW	7	5327499	missense	probably damaging	1.00
R7964:Nlrp2	UTSW	7	5328528	missense	probably damaging	1.00
R8097:Nlrp2	UTSW	7	5327651	missense	probably damaging	1.00
R8276:Nlrp2	UTSW	7	5317495	missense	probably benign	0.40
R8785:Nlrp2	UTSW	7	5327549	missense	probably damaging	0.99
R8982:Nlrp2	UTSW	7	5324979	missense	probably damaging	1.00
R9030:Nlrp2	UTSW	7	5322458	missense	probably null	0.00
R9038:Nlrp2	UTSW	7	5327479	missense	probably benign	0.14
R9149:Nlrp2	UTSW	7	5327573	missense	probably benign	0.01
R9229:Nlrp2	UTSW	7	5301053	missense	possibly damaging	0.81
R9584:Nlrp2	UTSW	7	5319216	missense	probably damaging	1.00
X0027:Nlrp2	UTSW	7	5327642	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- CTGACTCACACTCCAGGAATTTTC -3'
(R):5'- TGGCTGCCAATAGTCTCTTG -3'

Sequencing Primer
(F):5'- GACCTCAGTTGATATTTGGCAGCC -3'
(R):5'- CTGCCAATAGTCTCTTGGAACAGG -3'

Posted On

2021-04-30