Incidental Mutation 'R9246:Speg'
ID 701272
Institutional Source Beutler Lab
Gene Symbol Speg
Ensembl Gene ENSMUSG00000026207
Gene Name SPEG complex locus
Synonyms SPEGbeta, Apeg1, SPEGalpha, D1Bwg1450e, SPEG, BPEG
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9246 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 75375297-75432320 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 75384854 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 171 (S171P)
Ref Sequence ENSEMBL: ENSMUSP00000084361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087122] [ENSMUST00000113590] [ENSMUST00000125306] [ENSMUST00000148515]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000087122
AA Change: S171P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000084361
Gene: ENSMUSG00000026207
AA Change: S171P

DomainStartEndE-ValueType
IG 51 128 1.48e-6 SMART
low complexity region 292 318 N/A INTRINSIC
low complexity region 325 338 N/A INTRINSIC
low complexity region 359 368 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
IGc2 739 806 2.19e-9 SMART
Pfam:SPEG_u2 817 873 2.4e-36 PFAM
IGc2 886 954 4.03e-8 SMART
IG 979 1064 1.05e-6 SMART
IGc2 1081 1148 2.19e-9 SMART
IG 1199 1283 6.87e-2 SMART
FN3 1287 1373 1.38e-4 SMART
IG 1401 1487 2.64e-3 SMART
IGc2 1502 1569 1.12e-6 SMART
STYKc 1606 1859 8.44e-63 SMART
Blast:STYKc 1861 1895 6e-12 BLAST
low complexity region 1918 1939 N/A INTRINSIC
low complexity region 2069 2081 N/A INTRINSIC
low complexity region 2208 2227 N/A INTRINSIC
low complexity region 2230 2249 N/A INTRINSIC
low complexity region 2255 2269 N/A INTRINSIC
low complexity region 2343 2366 N/A INTRINSIC
low complexity region 2410 2422 N/A INTRINSIC
low complexity region 2433 2451 N/A INTRINSIC
low complexity region 2457 2487 N/A INTRINSIC
low complexity region 2524 2544 N/A INTRINSIC
IGc2 2599 2667 2.05e-9 SMART
FN3 2681 2760 2.5e-2 SMART
low complexity region 2775 2789 N/A INTRINSIC
low complexity region 2802 2831 N/A INTRINSIC
low complexity region 2912 2927 N/A INTRINSIC
STYKc 2961 3213 4.42e-66 SMART
low complexity region 3241 3250 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113590
AA Change: S65P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109220
Gene: ENSMUSG00000026207
AA Change: S65P

DomainStartEndE-ValueType
low complexity region 186 212 N/A INTRINSIC
low complexity region 219 232 N/A INTRINSIC
low complexity region 253 262 N/A INTRINSIC
low complexity region 306 317 N/A INTRINSIC
low complexity region 467 478 N/A INTRINSIC
IGc2 633 700 2.19e-9 SMART
low complexity region 752 764 N/A INTRINSIC
IGc2 780 848 4.03e-8 SMART
Predicted Effect silent
Transcript: ENSMUST00000125306
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000137868
Predicted Effect possibly damaging
Transcript: ENSMUST00000148515
AA Change: S75P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116953
Gene: ENSMUSG00000026207
AA Change: S75P

DomainStartEndE-ValueType
low complexity region 113 126 N/A INTRINSIC
low complexity region 137 163 N/A INTRINSIC
low complexity region 170 183 N/A INTRINSIC
low complexity region 204 213 N/A INTRINSIC
low complexity region 257 268 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein with similarity to members of the myosin light chain kinase family. This protein family is required for myocyte cytoskeletal development. Studies have determined that a lack of this protein affected myocardial development. Multiple alternatively spliced transcript variants that encode different protein isoforms have been defined. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele die during the early postnatal period with enlarged, dilated hearts, and decreased cardiac function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik C T 7: 27,580,536 T314I probably benign Het
4931409K22Rik T G 5: 24,548,971 E430A probably benign Het
Abca7 G A 10: 80,002,701 S603N probably damaging Het
Abcc2 T C 19: 43,798,443 F168L probably benign Het
Abcc8 T C 7: 46,124,865 T764A probably benign Het
Acot4 A C 12: 84,043,323 I265L probably benign Het
Adrb2 C A 18: 62,179,155 A200S probably damaging Het
Atp2c2 G T 8: 119,730,250 R197L probably damaging Het
Bmpr1a T C 14: 34,434,707 T121A probably benign Het
Brwd1 A T 16: 96,002,816 S2051R probably benign Het
Card10 T C 15: 78,788,836 E547G possibly damaging Het
Cbln1 A T 8: 87,470,420 I139N probably damaging Het
Ccdc86 CCTCTGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCTGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCCGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCCGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCCGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGA CCTCTGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCCGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCCGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCCGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGA 19: 10,948,798 probably benign Het
Cdh16 C T 8: 104,617,970 D510N probably benign Het
Cdh2 G A 18: 16,648,597 Q146* probably null Het
Cdhr1 T G 14: 37,079,697 K763T possibly damaging Het
Cfl1 G C 19: 5,493,606 G204R probably damaging Het
Clcn6 A T 4: 148,029,409 V64E probably benign Het
Col4a4 G A 1: 82,453,235 P1649S unknown Het
Ctnna1 T A 18: 35,223,509 N410K probably benign Het
Dhx34 A G 7: 16,203,237 F845S probably damaging Het
Dnah7c T G 1: 46,532,774 N802K possibly damaging Het
Dnmt3a T C 12: 3,899,204 S492P probably damaging Het
Fhit C A 14: 10,421,494 probably null Het
Fzd2 A T 11: 102,605,923 I398F possibly damaging Het
Gm9195 A G 14: 72,472,874 S457P probably benign Het
Gnao1 A G 8: 93,950,339 K211E Het
Gzme T C 14: 56,118,741 D100G probably benign Het
Hook3 T C 8: 26,072,291 T249A probably benign Het
Hoxd4 G A 2: 74,728,403 C190Y possibly damaging Het
Hr T A 14: 70,571,475 V1097E probably damaging Het
Kdm3b A T 18: 34,808,427 K524* probably null Het
Kif18a A G 2: 109,333,474 T723A probably benign Het
Kif1a A G 1: 93,077,779 V91A probably damaging Het
Krtap19-2 AAAGCCTCCAAAGCCTCCATAGCCAGAGCCATATCCGAAGCCTCCA AAAGCCTCCA 16: 88,873,971 probably benign Het
Lama3 G A 18: 12,577,902 V1559M probably damaging Het
Msto1 A T 3: 88,912,104 I160N probably damaging Het
Muc5ac C A 7: 141,810,478 Q2509K probably benign Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nos1 G C 5: 117,879,337 R255P probably benign Het
Nup98 C A 7: 102,138,830 R1011L probably benign Het
Olfr1053 A T 2: 86,314,878 M136K probably damaging Het
Olfr51 T A 11: 51,007,064 F31I probably damaging Het
Olfr600 C T 7: 103,346,701 V76I probably damaging Het
Olfr701 C T 7: 106,818,731 T216I probably benign Het
Olfr862 T C 9: 19,884,390 probably benign Het
Pik3c3 C A 18: 30,333,311 A805D probably damaging Het
Pnn A G 12: 59,070,143 Q167R probably damaging Het
Pogk G T 1: 166,398,811 H590Q probably damaging Het
Prkcd A G 14: 30,605,475 L251P probably damaging Het
Prrc1 T A 18: 57,363,136 V53E probably benign Het
Ripor1 T C 8: 105,618,890 F856S unknown Het
Rnf31 G A 14: 55,596,241 A569T probably benign Het
Robo1 T A 16: 72,972,290 D532E probably benign Het
Sh2d6 T A 6: 72,520,611 K3* probably null Het
Slc22a27 T C 19: 7,896,844 T289A probably benign Het
Stag1 T A 9: 100,888,276 F622I probably benign Het
Stxbp1 T C 2: 32,789,574 D589G possibly damaging Het
Syne1 T C 10: 5,305,706 I2391M probably benign Het
Sytl2 A G 7: 90,358,176 M49V probably benign Het
Tmem185b T C 1: 119,526,638 V43A probably damaging Het
Tmem57 A G 4: 134,837,931 V47A possibly damaging Het
Trappc8 A T 18: 20,860,533 M499K possibly damaging Het
Vmn1r172 T A 7: 23,660,168 S159R possibly damaging Het
Vmn1r62 A G 7: 5,675,629 Y103C probably damaging Het
Vmn1r65 C T 7: 6,008,770 C155Y possibly damaging Het
Vmn2r112 G A 17: 22,605,107 V448I probably benign Het
Zfp592 A T 7: 81,041,781 D1236V probably benign Het
Zfp827 T C 8: 79,076,503 V568A possibly damaging Het
Zscan4-ps3 A T 7: 11,612,393 I147F probably damaging Het
Other mutations in Speg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Speg APN 1 75410390 missense possibly damaging 0.95
IGL00979:Speg APN 1 75410734 missense probably damaging 0.98
IGL01122:Speg APN 1 75410035 missense probably damaging 1.00
IGL01293:Speg APN 1 75388102 missense probably damaging 1.00
IGL01304:Speg APN 1 75428197 missense probably benign 0.00
IGL01351:Speg APN 1 75411276 splice site probably benign
IGL01473:Speg APN 1 75428285 missense possibly damaging 0.53
IGL01477:Speg APN 1 75391897 missense probably damaging 1.00
IGL01485:Speg APN 1 75387827 missense probably damaging 1.00
IGL01584:Speg APN 1 75430937 missense probably damaging 1.00
IGL01959:Speg APN 1 75391090 missense probably damaging 1.00
IGL02231:Speg APN 1 75423387 missense probably damaging 1.00
IGL02355:Speg APN 1 75423915 missense possibly damaging 0.49
IGL02362:Speg APN 1 75423915 missense possibly damaging 0.49
IGL03013:Speg APN 1 75431279 missense probably damaging 0.97
IGL03168:Speg APN 1 75388187 missense probably damaging 1.00
H8562:Speg UTSW 1 75415597 missense probably benign 0.39
R0112:Speg UTSW 1 75385032 missense possibly damaging 0.92
R0311:Speg UTSW 1 75430937 missense probably damaging 1.00
R0315:Speg UTSW 1 75415136 missense possibly damaging 0.88
R0393:Speg UTSW 1 75423924 missense possibly damaging 0.46
R0403:Speg UTSW 1 75430784 splice site probably benign
R0483:Speg UTSW 1 75385032 missense possibly damaging 0.92
R0648:Speg UTSW 1 75427978 missense probably benign
R0683:Speg UTSW 1 75429118 missense probably damaging 1.00
R0800:Speg UTSW 1 75423489 missense probably damaging 1.00
R0815:Speg UTSW 1 75415392 missense probably damaging 1.00
R0835:Speg UTSW 1 75375674 missense probably benign 0.00
R0866:Speg UTSW 1 75417083 missense probably damaging 0.99
R0880:Speg UTSW 1 75405061 missense probably damaging 1.00
R1082:Speg UTSW 1 75415138 missense possibly damaging 0.94
R1140:Speg UTSW 1 75429095 missense probably damaging 1.00
R1252:Speg UTSW 1 75427095 missense probably damaging 1.00
R1301:Speg UTSW 1 75401501 missense probably damaging 1.00
R1348:Speg UTSW 1 75422872 missense probably damaging 0.99
R1388:Speg UTSW 1 75430460 missense probably damaging 0.99
R1465:Speg UTSW 1 75428484 splice site probably benign
R1505:Speg UTSW 1 75375542 missense probably benign 0.02
R1506:Speg UTSW 1 75417663 missense probably benign 0.03
R1531:Speg UTSW 1 75401222 missense possibly damaging 0.86
R1543:Speg UTSW 1 75421951 missense probably damaging 1.00
R1567:Speg UTSW 1 75428047 missense probably benign
R1630:Speg UTSW 1 75422977 missense probably damaging 1.00
R1667:Speg UTSW 1 75410549 splice site probably benign
R1673:Speg UTSW 1 75411163 missense possibly damaging 0.60
R1718:Speg UTSW 1 75417863 missense probably benign 0.00
R1718:Speg UTSW 1 75421744 missense possibly damaging 0.87
R1719:Speg UTSW 1 75417863 missense probably benign 0.00
R1759:Speg UTSW 1 75401162 missense possibly damaging 0.95
R1861:Speg UTSW 1 75389005 missense probably damaging 1.00
R1874:Speg UTSW 1 75423906 missense probably benign
R1936:Speg UTSW 1 75431408 missense possibly damaging 0.93
R2192:Speg UTSW 1 75417727 missense probably damaging 1.00
R2204:Speg UTSW 1 75430477 missense probably benign 0.30
R2287:Speg UTSW 1 75430465 missense possibly damaging 0.76
R2696:Speg UTSW 1 75406926 missense probably benign 0.27
R2983:Speg UTSW 1 75384930 missense possibly damaging 0.83
R3110:Speg UTSW 1 75422682 nonsense probably null
R3112:Speg UTSW 1 75422682 nonsense probably null
R3154:Speg UTSW 1 75401542 missense probably damaging 1.00
R3720:Speg UTSW 1 75426782 missense probably damaging 1.00
R3983:Speg UTSW 1 75422547 missense probably benign 0.27
R4133:Speg UTSW 1 75427904 missense probably benign
R4522:Speg UTSW 1 75428330 missense probably damaging 1.00
R4564:Speg UTSW 1 75391834 missense probably damaging 1.00
R4577:Speg UTSW 1 75415395 missense probably damaging 1.00
R4858:Speg UTSW 1 75421735 missense probably damaging 1.00
R4953:Speg UTSW 1 75423864 missense possibly damaging 0.72
R4965:Speg UTSW 1 75427703 missense probably damaging 1.00
R4967:Speg UTSW 1 75387869 missense probably damaging 1.00
R5152:Speg UTSW 1 75428098 missense possibly damaging 0.92
R5156:Speg UTSW 1 75428087 missense probably damaging 0.99
R5371:Speg UTSW 1 75431393 missense possibly damaging 0.50
R5550:Speg UTSW 1 75429100 missense probably damaging 1.00
R5562:Speg UTSW 1 75427056 missense probably damaging 1.00
R5687:Speg UTSW 1 75419129 splice site probably null
R5985:Speg UTSW 1 75406684 missense possibly damaging 0.94
R6004:Speg UTSW 1 75415603 nonsense probably null
R6038:Speg UTSW 1 75418459 critical splice donor site probably null
R6038:Speg UTSW 1 75418459 critical splice donor site probably null
R6143:Speg UTSW 1 75414387 missense probably damaging 1.00
R6265:Speg UTSW 1 75406679 nonsense probably null
R6347:Speg UTSW 1 75426875 missense probably benign 0.00
R6453:Speg UTSW 1 75417972 missense probably benign 0.06
R6505:Speg UTSW 1 75406684 missense possibly damaging 0.94
R6505:Speg UTSW 1 75429523 missense possibly damaging 0.93
R6531:Speg UTSW 1 75422757 missense probably benign 0.03
R6566:Speg UTSW 1 75388463 missense probably damaging 1.00
R6747:Speg UTSW 1 75410395 critical splice donor site probably null
R6819:Speg UTSW 1 75391812 missense possibly damaging 0.56
R6821:Speg UTSW 1 75417903 missense possibly damaging 0.83
R6919:Speg UTSW 1 75387908 nonsense probably null
R6981:Speg UTSW 1 75430913 missense probably damaging 1.00
R7002:Speg UTSW 1 75423268 missense probably damaging 0.98
R7082:Speg UTSW 1 75411447 missense probably damaging 0.96
R7140:Speg UTSW 1 75406770 critical splice donor site probably null
R7175:Speg UTSW 1 75422490 missense probably benign 0.01
R7178:Speg UTSW 1 75422383 missense possibly damaging 0.46
R7345:Speg UTSW 1 75384835 missense probably damaging 0.97
R7420:Speg UTSW 1 75430905 missense probably damaging 1.00
R7537:Speg UTSW 1 75401464 missense probably damaging 1.00
R7562:Speg UTSW 1 75431279 missense probably damaging 0.97
R7615:Speg UTSW 1 75429242 missense probably damaging 1.00
R7679:Speg UTSW 1 75406315 missense probably damaging 1.00
R7692:Speg UTSW 1 75401190 missense probably benign 0.04
R7696:Speg UTSW 1 75429161 missense probably damaging 1.00
R7719:Speg UTSW 1 75375825 missense probably damaging 1.00
R7794:Speg UTSW 1 75388870 missense probably benign 0.00
R7824:Speg UTSW 1 75384017 splice site probably null
R7834:Speg UTSW 1 75384927 missense probably damaging 1.00
R7892:Speg UTSW 1 75427166 missense probably damaging 1.00
R8015:Speg UTSW 1 75415421 splice site probably benign
R8068:Speg UTSW 1 75422250 missense probably damaging 1.00
R8085:Speg UTSW 1 75415353 missense probably damaging 1.00
R8130:Speg UTSW 1 75415596 missense probably damaging 1.00
R8132:Speg UTSW 1 75422995 missense probably damaging 1.00
R8239:Speg UTSW 1 75419033 missense probably damaging 1.00
R8287:Speg UTSW 1 75422236 missense probably benign 0.26
R8299:Speg UTSW 1 75387836 missense possibly damaging 0.95
R8441:Speg UTSW 1 75411332 missense possibly damaging 0.60
R8468:Speg UTSW 1 75431309 missense probably damaging 1.00
R8555:Speg UTSW 1 75402264 splice site probably null
R8781:Speg UTSW 1 75407021 missense probably damaging 1.00
R8784:Speg UTSW 1 75405149 critical splice donor site probably benign
R8848:Speg UTSW 1 75427438 critical splice donor site probably null
R8881:Speg UTSW 1 75401151 missense possibly damaging 0.67
R8898:Speg UTSW 1 75388873 missense probably damaging 1.00
R8935:Speg UTSW 1 75422606 missense probably benign 0.30
R9019:Speg UTSW 1 75429238 missense probably damaging 1.00
R9027:Speg UTSW 1 75388432 missense possibly damaging 0.67
R9066:Speg UTSW 1 75385010 missense probably damaging 0.99
R9092:Speg UTSW 1 75422734 missense probably benign 0.01
R9117:Speg UTSW 1 75387800 missense probably damaging 1.00
R9202:Speg UTSW 1 75390993 missense probably damaging 1.00
R9248:Speg UTSW 1 75421776 missense probably damaging 1.00
R9451:Speg UTSW 1 75417733 missense probably damaging 1.00
R9452:Speg UTSW 1 75422508 missense probably benign
R9475:Speg UTSW 1 75388091 missense probably damaging 1.00
R9476:Speg UTSW 1 75401124 missense probably damaging 0.99
R9510:Speg UTSW 1 75401124 missense probably damaging 0.99
R9519:Speg UTSW 1 75415736 missense probably damaging 1.00
R9528:Speg UTSW 1 75387803 missense possibly damaging 0.78
R9542:Speg UTSW 1 75422782 missense probably benign 0.08
R9553:Speg UTSW 1 75418001 missense probably benign 0.00
R9767:Speg UTSW 1 75427181 missense possibly damaging 0.78
R9768:Speg UTSW 1 75418973 nonsense probably null
R9800:Speg UTSW 1 75422714 missense probably benign 0.03
X0025:Speg UTSW 1 75422457 missense probably damaging 1.00
X0026:Speg UTSW 1 75423475 missense possibly damaging 0.88
Z1176:Speg UTSW 1 75406594 missense probably damaging 1.00
Z1177:Speg UTSW 1 75427683 missense probably damaging 1.00
Z1177:Speg UTSW 1 75428381 missense probably damaging 1.00
Z1177:Speg UTSW 1 75430455 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTTATCCAGACTCGGAGACTGC -3'
(R):5'- ACCAGATTAGCTCGCGATG -3'

Sequencing Primer
(F):5'- ACTGCCGAGGATGACATCAGC -3'
(R):5'- CACCAGCGGCTCCACCC -3'
Posted On 2022-03-25