Mutagenetix > Incidental Mutation

Incidental Mutation 'R9768:Speg'

733355

Institutional Source

Beutler Lab

Gene Symbol

Speg

Ensembl Gene

ENSMUSG00000026207

Gene Name

SPEG complex locus

Synonyms

SPEG, SPEGalpha, SPEGbeta, Apeg1, BPEG, D1Bwg1450e

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9768 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

75351941-75408964 bp(+) (GRCm39)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 75395617 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 1796 (L1796*)

Ref Sequence

ENSEMBL: ENSMUSP00000084361 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087122]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000087122
AA Change: L1796*

SMART Domains

Protein: ENSMUSP00000084361
Gene: ENSMUSG00000026207
AA Change: L1796*

Domain	Start	End	E-Value	Type
IG	51	128	1.48e-6	SMART
low complexity region	292	318	N/A	INTRINSIC
low complexity region	325	338	N/A	INTRINSIC
low complexity region	359	368	N/A	INTRINSIC
low complexity region	412	423	N/A	INTRINSIC
low complexity region	573	584	N/A	INTRINSIC
IGc2	739	806	2.19e-9	SMART
Pfam:SPEG_u2	817	873	2.4e-36	PFAM
IGc2	886	954	4.03e-8	SMART
IG	979	1064	1.05e-6	SMART
IGc2	1081	1148	2.19e-9	SMART
IG	1199	1283	6.87e-2	SMART
FN3	1287	1373	1.38e-4	SMART
IG	1401	1487	2.64e-3	SMART
IGc2	1502	1569	1.12e-6	SMART
STYKc	1606	1859	8.44e-63	SMART
Blast:STYKc	1861	1895	6e-12	BLAST
low complexity region	1918	1939	N/A	INTRINSIC
low complexity region	2069	2081	N/A	INTRINSIC
low complexity region	2208	2227	N/A	INTRINSIC
low complexity region	2230	2249	N/A	INTRINSIC
low complexity region	2255	2269	N/A	INTRINSIC
low complexity region	2343	2366	N/A	INTRINSIC
low complexity region	2410	2422	N/A	INTRINSIC
low complexity region	2433	2451	N/A	INTRINSIC
low complexity region	2457	2487	N/A	INTRINSIC
low complexity region	2524	2544	N/A	INTRINSIC
IGc2	2599	2667	2.05e-9	SMART
FN3	2681	2760	2.5e-2	SMART
low complexity region	2775	2789	N/A	INTRINSIC
low complexity region	2802	2831	N/A	INTRINSIC
low complexity region	2912	2927	N/A	INTRINSIC
STYKc	2961	3213	4.42e-66	SMART
low complexity region	3241	3250	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000137868
AA Change: L1543*

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.3%
20x: 98.2%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a protein with similarity to members of the myosin light chain kinase family. This protein family is required for myocyte cytoskeletal development. Studies have determined that a lack of this protein affected myocardial development. Multiple alternatively spliced transcript variants that encode different protein isoforms have been defined. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele die during the early postnatal period with enlarged, dilated hearts, and decreased cardiac function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930524B15Rik	C	A	11: 31,915,770 (GRCm39)	F37L	probably benign	Het
Akna	T	C	4: 63,292,636 (GRCm39)	E1091G	probably benign	Het
Asxl3	A	G	18: 22,650,101 (GRCm39)	T697A	probably benign	Het
Cdk5r1	A	G	11: 80,368,414 (GRCm39)	Y27C	probably damaging	Het
Cdkl2	T	A	5: 92,165,244 (GRCm39)	I511L	probably benign	Het
Clp1	A	C	2: 84,556,477 (GRCm39)	M1R	probably null	Het
Csrnp1	A	C	9: 119,801,819 (GRCm39)	D413E	probably damaging	Het
Gbp2	T	C	3: 142,341,055 (GRCm39)	S479P	probably benign	Het
Il23r	A	G	6: 67,408,603 (GRCm39)	S413P	probably damaging	Het
Klb	G	T	5: 65,537,373 (GRCm39)	R901L	probably damaging	Het
Krt1	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	15: 101,758,813 (GRCm39)		probably benign	Het
Lta4h	G	A	10: 93,308,818 (GRCm39)	V373I	probably benign	Het
Map3k1	G	T	13: 111,904,630 (GRCm39)	Q385K	probably benign	Het
Mapk8ip2	A	T	15: 89,343,160 (GRCm39)	D634V	probably damaging	Het
Myocd	T	C	11: 65,078,217 (GRCm39)	E526G	probably damaging	Het
Nipal4	C	T	11: 46,041,473 (GRCm39)	V241M	probably damaging	Het
Nup188	T	A	2: 30,227,045 (GRCm39)	V1206E	probably damaging	Het
Pak6	A	G	2: 118,520,396 (GRCm39)	Y129C	probably damaging	Het
Pigp	T	A	16: 94,166,332 (GRCm39)	K125N	probably damaging	Het
Pmm1	G	A	15: 81,840,460 (GRCm39)	T95M	possibly damaging	Het
Prrt3	A	T	6: 113,474,032 (GRCm39)	N335K	probably damaging	Het
Rsrc2	T	C	5: 123,868,561 (GRCm39)	N361S	probably benign	Het
Slc45a1	T	C	4: 150,722,982 (GRCm39)	T301A	probably benign	Het
Spata19	A	C	9: 27,311,744 (GRCm39)	D121A	probably damaging	Het
Stx2	A	G	5: 129,063,422 (GRCm39)	S288P	unknown	Het
Tlk1	C	T	2: 70,600,400 (GRCm39)	S93N	probably damaging	Het
Tmc8	A	G	11: 117,676,029 (GRCm39)	D256G	probably damaging	Het
Vldlr	T	C	19: 27,218,720 (GRCm39)	Y524H	possibly damaging	Het
Vmn1r168	T	C	7: 23,240,509 (GRCm39)	F122S	probably benign	Het
Vmn2r67	T	C	7: 84,802,037 (GRCm39)	N88S	probably benign	Het
Zhx1	A	G	15: 57,918,207 (GRCm39)	V13A	probably damaging	Het

Other mutations in Speg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00838:Speg	APN	1	75,387,034 (GRCm39)	missense	possibly damaging	0.95
IGL00979:Speg	APN	1	75,387,378 (GRCm39)	missense	probably damaging	0.98
IGL01122:Speg	APN	1	75,386,679 (GRCm39)	missense	probably damaging	1.00
IGL01293:Speg	APN	1	75,364,746 (GRCm39)	missense	probably damaging	1.00
IGL01304:Speg	APN	1	75,404,841 (GRCm39)	missense	probably benign	0.00
IGL01351:Speg	APN	1	75,387,920 (GRCm39)	splice site	probably benign
IGL01473:Speg	APN	1	75,404,929 (GRCm39)	missense	possibly damaging	0.53
IGL01477:Speg	APN	1	75,368,541 (GRCm39)	missense	probably damaging	1.00
IGL01485:Speg	APN	1	75,364,471 (GRCm39)	missense	probably damaging	1.00
IGL01584:Speg	APN	1	75,407,581 (GRCm39)	missense	probably damaging	1.00
IGL01959:Speg	APN	1	75,367,734 (GRCm39)	missense	probably damaging	1.00
IGL02231:Speg	APN	1	75,400,031 (GRCm39)	missense	probably damaging	1.00
IGL02355:Speg	APN	1	75,400,559 (GRCm39)	missense	possibly damaging	0.49
IGL02362:Speg	APN	1	75,400,559 (GRCm39)	missense	possibly damaging	0.49
IGL03013:Speg	APN	1	75,407,923 (GRCm39)	missense	probably damaging	0.97
IGL03168:Speg	APN	1	75,364,831 (GRCm39)	missense	probably damaging	1.00
H8562:Speg	UTSW	1	75,392,241 (GRCm39)	missense	probably benign	0.39
R0112:Speg	UTSW	1	75,361,676 (GRCm39)	missense	possibly damaging	0.92
R0311:Speg	UTSW	1	75,407,581 (GRCm39)	missense	probably damaging	1.00
R0315:Speg	UTSW	1	75,391,780 (GRCm39)	missense	possibly damaging	0.88
R0393:Speg	UTSW	1	75,400,568 (GRCm39)	missense	possibly damaging	0.46
R0403:Speg	UTSW	1	75,407,428 (GRCm39)	splice site	probably benign
R0483:Speg	UTSW	1	75,361,676 (GRCm39)	missense	possibly damaging	0.92
R0648:Speg	UTSW	1	75,404,622 (GRCm39)	missense	probably benign
R0683:Speg	UTSW	1	75,405,762 (GRCm39)	missense	probably damaging	1.00
R0800:Speg	UTSW	1	75,400,133 (GRCm39)	missense	probably damaging	1.00
R0815:Speg	UTSW	1	75,392,036 (GRCm39)	missense	probably damaging	1.00
R0835:Speg	UTSW	1	75,352,318 (GRCm39)	missense	probably benign	0.00
R0866:Speg	UTSW	1	75,393,727 (GRCm39)	missense	probably damaging	0.99
R0880:Speg	UTSW	1	75,381,705 (GRCm39)	missense	probably damaging	1.00
R1082:Speg	UTSW	1	75,391,782 (GRCm39)	missense	possibly damaging	0.94
R1140:Speg	UTSW	1	75,405,739 (GRCm39)	missense	probably damaging	1.00
R1252:Speg	UTSW	1	75,403,739 (GRCm39)	missense	probably damaging	1.00
R1301:Speg	UTSW	1	75,378,145 (GRCm39)	missense	probably damaging	1.00
R1348:Speg	UTSW	1	75,399,516 (GRCm39)	missense	probably damaging	0.99
R1388:Speg	UTSW	1	75,407,104 (GRCm39)	missense	probably damaging	0.99
R1465:Speg	UTSW	1	75,405,128 (GRCm39)	splice site	probably benign
R1505:Speg	UTSW	1	75,352,186 (GRCm39)	missense	probably benign	0.02
R1506:Speg	UTSW	1	75,394,307 (GRCm39)	missense	probably benign	0.03
R1531:Speg	UTSW	1	75,377,866 (GRCm39)	missense	possibly damaging	0.86
R1543:Speg	UTSW	1	75,398,595 (GRCm39)	missense	probably damaging	1.00
R1567:Speg	UTSW	1	75,404,691 (GRCm39)	missense	probably benign
R1630:Speg	UTSW	1	75,399,621 (GRCm39)	missense	probably damaging	1.00
R1667:Speg	UTSW	1	75,387,193 (GRCm39)	splice site	probably benign
R1673:Speg	UTSW	1	75,387,807 (GRCm39)	missense	possibly damaging	0.60
R1718:Speg	UTSW	1	75,398,388 (GRCm39)	missense	possibly damaging	0.87
R1718:Speg	UTSW	1	75,394,507 (GRCm39)	missense	probably benign	0.00
R1719:Speg	UTSW	1	75,394,507 (GRCm39)	missense	probably benign	0.00
R1759:Speg	UTSW	1	75,377,806 (GRCm39)	missense	possibly damaging	0.95
R1861:Speg	UTSW	1	75,365,649 (GRCm39)	missense	probably damaging	1.00
R1874:Speg	UTSW	1	75,400,550 (GRCm39)	missense	probably benign
R1936:Speg	UTSW	1	75,408,052 (GRCm39)	missense	possibly damaging	0.93
R2192:Speg	UTSW	1	75,394,371 (GRCm39)	missense	probably damaging	1.00
R2204:Speg	UTSW	1	75,407,121 (GRCm39)	missense	probably benign	0.30
R2287:Speg	UTSW	1	75,407,109 (GRCm39)	missense	possibly damaging	0.76
R2696:Speg	UTSW	1	75,383,570 (GRCm39)	missense	probably benign	0.27
R2983:Speg	UTSW	1	75,361,574 (GRCm39)	missense	possibly damaging	0.83
R3110:Speg	UTSW	1	75,399,326 (GRCm39)	nonsense	probably null
R3112:Speg	UTSW	1	75,399,326 (GRCm39)	nonsense	probably null
R3154:Speg	UTSW	1	75,378,186 (GRCm39)	missense	probably damaging	1.00
R3720:Speg	UTSW	1	75,403,426 (GRCm39)	missense	probably damaging	1.00
R3983:Speg	UTSW	1	75,399,191 (GRCm39)	missense	probably benign	0.27
R4133:Speg	UTSW	1	75,404,548 (GRCm39)	missense	probably benign
R4522:Speg	UTSW	1	75,404,974 (GRCm39)	missense	probably damaging	1.00
R4564:Speg	UTSW	1	75,368,478 (GRCm39)	missense	probably damaging	1.00
R4577:Speg	UTSW	1	75,392,039 (GRCm39)	missense	probably damaging	1.00
R4858:Speg	UTSW	1	75,398,379 (GRCm39)	missense	probably damaging	1.00
R4953:Speg	UTSW	1	75,400,508 (GRCm39)	missense	possibly damaging	0.72
R4965:Speg	UTSW	1	75,404,347 (GRCm39)	missense	probably damaging	1.00
R4967:Speg	UTSW	1	75,364,513 (GRCm39)	missense	probably damaging	1.00
R5152:Speg	UTSW	1	75,404,742 (GRCm39)	missense	possibly damaging	0.92
R5156:Speg	UTSW	1	75,404,731 (GRCm39)	missense	probably damaging	0.99
R5371:Speg	UTSW	1	75,408,037 (GRCm39)	missense	possibly damaging	0.50
R5550:Speg	UTSW	1	75,405,744 (GRCm39)	missense	probably damaging	1.00
R5562:Speg	UTSW	1	75,403,700 (GRCm39)	missense	probably damaging	1.00
R5687:Speg	UTSW	1	75,395,773 (GRCm39)	splice site	probably null
R5985:Speg	UTSW	1	75,383,328 (GRCm39)	missense	possibly damaging	0.94
R6004:Speg	UTSW	1	75,392,247 (GRCm39)	nonsense	probably null
R6038:Speg	UTSW	1	75,395,103 (GRCm39)	critical splice donor site	probably null
R6038:Speg	UTSW	1	75,395,103 (GRCm39)	critical splice donor site	probably null
R6143:Speg	UTSW	1	75,391,031 (GRCm39)	missense	probably damaging	1.00
R6265:Speg	UTSW	1	75,383,323 (GRCm39)	nonsense	probably null
R6347:Speg	UTSW	1	75,403,519 (GRCm39)	missense	probably benign	0.00
R6453:Speg	UTSW	1	75,394,616 (GRCm39)	missense	probably benign	0.06
R6505:Speg	UTSW	1	75,406,167 (GRCm39)	missense	possibly damaging	0.93
R6505:Speg	UTSW	1	75,383,328 (GRCm39)	missense	possibly damaging	0.94
R6531:Speg	UTSW	1	75,399,401 (GRCm39)	missense	probably benign	0.03
R6566:Speg	UTSW	1	75,365,107 (GRCm39)	missense	probably damaging	1.00
R6747:Speg	UTSW	1	75,387,039 (GRCm39)	critical splice donor site	probably null
R6819:Speg	UTSW	1	75,368,456 (GRCm39)	missense	possibly damaging	0.56
R6821:Speg	UTSW	1	75,394,547 (GRCm39)	missense	possibly damaging	0.83
R6919:Speg	UTSW	1	75,364,552 (GRCm39)	nonsense	probably null
R6981:Speg	UTSW	1	75,407,557 (GRCm39)	missense	probably damaging	1.00
R7002:Speg	UTSW	1	75,399,912 (GRCm39)	missense	probably damaging	0.98
R7082:Speg	UTSW	1	75,388,091 (GRCm39)	missense	probably damaging	0.96
R7140:Speg	UTSW	1	75,383,414 (GRCm39)	critical splice donor site	probably null
R7175:Speg	UTSW	1	75,399,134 (GRCm39)	missense	probably benign	0.01
R7178:Speg	UTSW	1	75,399,027 (GRCm39)	missense	possibly damaging	0.46
R7345:Speg	UTSW	1	75,361,479 (GRCm39)	missense	probably damaging	0.97
R7420:Speg	UTSW	1	75,407,549 (GRCm39)	missense	probably damaging	1.00
R7537:Speg	UTSW	1	75,378,108 (GRCm39)	missense	probably damaging	1.00
R7562:Speg	UTSW	1	75,407,923 (GRCm39)	missense	probably damaging	0.97
R7615:Speg	UTSW	1	75,405,886 (GRCm39)	missense	probably damaging	1.00
R7679:Speg	UTSW	1	75,382,959 (GRCm39)	missense	probably damaging	1.00
R7692:Speg	UTSW	1	75,377,834 (GRCm39)	missense	probably benign	0.04
R7696:Speg	UTSW	1	75,405,805 (GRCm39)	missense	probably damaging	1.00
R7719:Speg	UTSW	1	75,352,469 (GRCm39)	missense	probably damaging	1.00
R7794:Speg	UTSW	1	75,365,514 (GRCm39)	missense	probably benign	0.00
R7824:Speg	UTSW	1	75,360,661 (GRCm39)	splice site	probably null
R7834:Speg	UTSW	1	75,361,571 (GRCm39)	missense	probably damaging	1.00
R7892:Speg	UTSW	1	75,403,810 (GRCm39)	missense	probably damaging	1.00
R8015:Speg	UTSW	1	75,392,065 (GRCm39)	splice site	probably benign
R8068:Speg	UTSW	1	75,398,894 (GRCm39)	missense	probably damaging	1.00
R8085:Speg	UTSW	1	75,391,997 (GRCm39)	missense	probably damaging	1.00
R8130:Speg	UTSW	1	75,392,240 (GRCm39)	missense	probably damaging	1.00
R8132:Speg	UTSW	1	75,399,639 (GRCm39)	missense	probably damaging	1.00
R8239:Speg	UTSW	1	75,395,677 (GRCm39)	missense	probably damaging	1.00
R8287:Speg	UTSW	1	75,398,880 (GRCm39)	missense	probably benign	0.26
R8299:Speg	UTSW	1	75,364,480 (GRCm39)	missense	possibly damaging	0.95
R8441:Speg	UTSW	1	75,387,976 (GRCm39)	missense	possibly damaging	0.60
R8468:Speg	UTSW	1	75,407,953 (GRCm39)	missense	probably damaging	1.00
R8555:Speg	UTSW	1	75,378,908 (GRCm39)	splice site	probably null
R8781:Speg	UTSW	1	75,383,665 (GRCm39)	missense	probably damaging	1.00
R8784:Speg	UTSW	1	75,381,793 (GRCm39)	critical splice donor site	probably benign
R8848:Speg	UTSW	1	75,404,082 (GRCm39)	critical splice donor site	probably null
R8881:Speg	UTSW	1	75,377,795 (GRCm39)	missense	possibly damaging	0.67
R8898:Speg	UTSW	1	75,365,517 (GRCm39)	missense	probably damaging	1.00
R8935:Speg	UTSW	1	75,399,250 (GRCm39)	missense	probably benign	0.30
R9019:Speg	UTSW	1	75,405,882 (GRCm39)	missense	probably damaging	1.00
R9027:Speg	UTSW	1	75,365,076 (GRCm39)	missense	possibly damaging	0.67
R9066:Speg	UTSW	1	75,361,654 (GRCm39)	missense	probably damaging	0.99
R9092:Speg	UTSW	1	75,399,378 (GRCm39)	missense	probably benign	0.01
R9117:Speg	UTSW	1	75,364,444 (GRCm39)	missense	probably damaging	1.00
R9202:Speg	UTSW	1	75,367,637 (GRCm39)	missense	probably damaging	1.00
R9246:Speg	UTSW	1	75,361,498 (GRCm39)	missense	probably damaging	1.00
R9248:Speg	UTSW	1	75,398,420 (GRCm39)	missense	probably damaging	1.00
R9451:Speg	UTSW	1	75,394,377 (GRCm39)	missense	probably damaging	1.00
R9452:Speg	UTSW	1	75,399,152 (GRCm39)	missense	probably benign
R9475:Speg	UTSW	1	75,364,735 (GRCm39)	missense	probably damaging	1.00
R9476:Speg	UTSW	1	75,377,768 (GRCm39)	missense	probably damaging	0.99
R9510:Speg	UTSW	1	75,377,768 (GRCm39)	missense	probably damaging	0.99
R9519:Speg	UTSW	1	75,392,380 (GRCm39)	missense	probably damaging	1.00
R9528:Speg	UTSW	1	75,364,447 (GRCm39)	missense	possibly damaging	0.78
R9542:Speg	UTSW	1	75,399,426 (GRCm39)	missense	probably benign	0.08
R9553:Speg	UTSW	1	75,394,645 (GRCm39)	missense	probably benign	0.00
R9767:Speg	UTSW	1	75,403,825 (GRCm39)	missense	possibly damaging	0.78
R9800:Speg	UTSW	1	75,399,358 (GRCm39)	missense	probably benign	0.03
X0025:Speg	UTSW	1	75,399,101 (GRCm39)	missense	probably damaging	1.00
X0026:Speg	UTSW	1	75,400,119 (GRCm39)	missense	possibly damaging	0.88
Z1176:Speg	UTSW	1	75,383,238 (GRCm39)	missense	probably damaging	1.00
Z1177:Speg	UTSW	1	75,404,327 (GRCm39)	missense	probably damaging	1.00
Z1177:Speg	UTSW	1	75,407,099 (GRCm39)	missense	probably damaging	0.99
Z1177:Speg	UTSW	1	75,405,025 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTCCAAAGCACAGGCAGTC -3'
(R):5'- AAGGGCTCTTGTACTCACAGTC -3'

Sequencing Primer
(F):5'- AGCACAGGCAGTCAGCTC -3'
(R):5'- GTACTCACAGTCGATCCTGCAC -3'

Posted On

2022-11-14