Incidental Mutation 'R6004:Speg'
ID478489
Institutional Source Beutler Lab
Gene Symbol Speg
Ensembl Gene ENSMUSG00000026207
Gene NameSPEG complex locus
SynonymsSPEGbeta, Apeg1, SPEGalpha, D1Bwg1450e, SPEG, BPEG
MMRRC Submission 044182-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6004 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location75375297-75432320 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 75415603 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 1382 (K1382*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087122]
Predicted Effect probably null
Transcript: ENSMUST00000087122
AA Change: K1635*
SMART Domains Protein: ENSMUSP00000084361
Gene: ENSMUSG00000026207
AA Change: K1635*

DomainStartEndE-ValueType
IG 51 128 1.48e-6 SMART
low complexity region 292 318 N/A INTRINSIC
low complexity region 325 338 N/A INTRINSIC
low complexity region 359 368 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
IGc2 739 806 2.19e-9 SMART
Pfam:SPEG_u2 817 873 2.4e-36 PFAM
IGc2 886 954 4.03e-8 SMART
IG 979 1064 1.05e-6 SMART
IGc2 1081 1148 2.19e-9 SMART
IG 1199 1283 6.87e-2 SMART
FN3 1287 1373 1.38e-4 SMART
IG 1401 1487 2.64e-3 SMART
IGc2 1502 1569 1.12e-6 SMART
STYKc 1606 1859 8.44e-63 SMART
Blast:STYKc 1861 1895 6e-12 BLAST
low complexity region 1918 1939 N/A INTRINSIC
low complexity region 2069 2081 N/A INTRINSIC
low complexity region 2208 2227 N/A INTRINSIC
low complexity region 2230 2249 N/A INTRINSIC
low complexity region 2255 2269 N/A INTRINSIC
low complexity region 2343 2366 N/A INTRINSIC
low complexity region 2410 2422 N/A INTRINSIC
low complexity region 2433 2451 N/A INTRINSIC
low complexity region 2457 2487 N/A INTRINSIC
low complexity region 2524 2544 N/A INTRINSIC
IGc2 2599 2667 2.05e-9 SMART
FN3 2681 2760 2.5e-2 SMART
low complexity region 2775 2789 N/A INTRINSIC
low complexity region 2802 2831 N/A INTRINSIC
low complexity region 2912 2927 N/A INTRINSIC
STYKc 2961 3213 4.42e-66 SMART
low complexity region 3241 3250 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000137868
AA Change: K1382*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.8%
  • 20x: 89.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: This gene encodes a protein with similarity to members of the myosin light chain kinase family. This protein family is required for myocyte cytoskeletal development. Studies have determined that a lack of this protein affected myocardial development. Multiple alternatively spliced transcript variants that encode different protein isoforms have been defined. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele die during the early postnatal period with enlarged, dilated hearts, and decreased cardiac function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp6 C T 3: 97,175,681 A336V probably benign Het
Adam5 T A 8: 24,781,669 Y574F probably benign Het
Arl6 A T 16: 59,623,894 W80R probably damaging Het
Arntl A T 7: 113,280,727 D22V probably damaging Het
Cars2 A G 8: 11,547,743 I111T probably damaging Het
Chrd T C 16: 20,735,237 L317S possibly damaging Het
Cyp4a12b A G 4: 115,433,467 D262G probably benign Het
Dcaf6 A G 1: 165,388,685 S450P probably benign Het
Dnah3 T C 7: 120,086,297 D164G probably benign Het
Gpx6 A C 13: 21,319,069 T218P probably benign Het
Htr1f T C 16: 64,925,876 N351S probably damaging Het
Idua A G 5: 108,680,644 E241G probably benign Het
Ighv14-2 T A 12: 113,994,635 Q62L probably damaging Het
Ighv1-65 C T 12: 115,532,436 noncoding transcript Het
Inpp4a T C 1: 37,372,370 S372P probably damaging Het
Itgax A T 7: 128,131,452 H114L probably damaging Het
Lama2 A T 10: 27,235,785 F746L probably benign Het
Lrrc37a C T 11: 103,502,536 V688M possibly damaging Het
Ltbp2 A G 12: 84,876,149 V28A probably benign Het
Mill2 A T 7: 18,856,538 D166V probably benign Het
Mroh2a G A 1: 88,248,655 C982Y probably damaging Het
Msh3 T A 13: 92,342,414 probably null Het
Myh15 A T 16: 49,159,699 M1395L probably benign Het
Npepps T C 11: 97,223,124 E642G probably benign Het
Nrg4 T C 9: 55,259,383 T68A possibly damaging Het
Olfr1016 A T 2: 85,799,382 V296E probably damaging Het
Olfr1130 T A 2: 87,607,909 F174I probably damaging Het
Olfr1313 G T 2: 112,072,026 L186I probably damaging Het
Olfr32 T C 2: 90,138,999 N47D probably benign Het
Olfr792 T A 10: 129,540,890 Y118N probably benign Het
Olfr890 A G 9: 38,143,960 K270R probably damaging Het
Otogl T A 10: 107,879,529 I429F probably damaging Het
Pank4 G T 4: 154,977,221 G532C probably damaging Het
Plce1 A G 19: 38,721,871 T1150A probably damaging Het
Ppp2r2b T C 18: 43,059,159 probably null Het
Prkrip1 A G 5: 136,197,782 M68T probably damaging Het
Psme4 T A 11: 30,856,896 probably benign Het
Raet1d T A 10: 22,371,394 I123N probably damaging Het
Rp1 T G 1: 4,197,585 T825P unknown Het
Rttn T C 18: 89,021,692 I839T probably damaging Het
Sgo2b G A 8: 63,926,673 Q1042* probably null Het
Skint11 A G 4: 114,231,728 T240A probably benign Het
Srsf7 A T 17: 80,205,853 D68E probably damaging Het
Stag3 A T 5: 138,289,206 D131V probably damaging Het
Strip2 T A 6: 29,926,571 C152S probably damaging Het
Timm44 G T 8: 4,267,747 D191E probably benign Het
Tlnrd1 A G 7: 83,882,779 V148A probably damaging Het
Trp63 T C 16: 25,763,396 probably null Het
Tusc3 G C 8: 39,071,406 G200R probably damaging Het
Vmn2r10 T G 5: 108,999,078 N448T probably benign Het
Vmn2r50 G A 7: 10,050,059 R163C probably benign Het
Vmn2r53 T C 7: 12,582,401 H497R probably benign Het
Vps39 A G 2: 120,345,650 V83A possibly damaging Het
Ylpm1 A T 12: 85,029,084 N861I possibly damaging Het
Zfp712 A G 13: 67,041,705 C253R probably damaging Het
Zfp930 A G 8: 69,227,904 T84A probably benign Het
Other mutations in Speg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Speg APN 1 75410390 missense possibly damaging 0.95
IGL00979:Speg APN 1 75410734 missense probably damaging 0.98
IGL01122:Speg APN 1 75410035 missense probably damaging 1.00
IGL01293:Speg APN 1 75388102 missense probably damaging 1.00
IGL01304:Speg APN 1 75428197 missense probably benign 0.00
IGL01351:Speg APN 1 75411276 splice site probably benign
IGL01473:Speg APN 1 75428285 missense possibly damaging 0.53
IGL01477:Speg APN 1 75391897 missense probably damaging 1.00
IGL01485:Speg APN 1 75387827 missense probably damaging 1.00
IGL01584:Speg APN 1 75430937 missense probably damaging 1.00
IGL01959:Speg APN 1 75391090 missense probably damaging 1.00
IGL02231:Speg APN 1 75423387 missense probably damaging 1.00
IGL02355:Speg APN 1 75423915 missense possibly damaging 0.49
IGL02362:Speg APN 1 75423915 missense possibly damaging 0.49
IGL03013:Speg APN 1 75431279 missense probably damaging 0.97
IGL03168:Speg APN 1 75388187 missense probably damaging 1.00
H8562:Speg UTSW 1 75415597 missense probably benign 0.39
R0112:Speg UTSW 1 75385032 missense possibly damaging 0.92
R0311:Speg UTSW 1 75430937 missense probably damaging 1.00
R0315:Speg UTSW 1 75415136 missense possibly damaging 0.88
R0393:Speg UTSW 1 75423924 missense possibly damaging 0.46
R0403:Speg UTSW 1 75430784 splice site probably benign
R0483:Speg UTSW 1 75385032 missense possibly damaging 0.92
R0648:Speg UTSW 1 75427978 missense probably benign
R0683:Speg UTSW 1 75429118 missense probably damaging 1.00
R0800:Speg UTSW 1 75423489 missense probably damaging 1.00
R0815:Speg UTSW 1 75415392 missense probably damaging 1.00
R0835:Speg UTSW 1 75375674 missense probably benign 0.00
R0866:Speg UTSW 1 75417083 missense probably damaging 0.99
R0880:Speg UTSW 1 75405061 missense probably damaging 1.00
R1082:Speg UTSW 1 75415138 missense possibly damaging 0.94
R1140:Speg UTSW 1 75429095 missense probably damaging 1.00
R1252:Speg UTSW 1 75427095 missense probably damaging 1.00
R1301:Speg UTSW 1 75401501 missense probably damaging 1.00
R1348:Speg UTSW 1 75422872 missense probably damaging 0.99
R1388:Speg UTSW 1 75430460 missense probably damaging 0.99
R1465:Speg UTSW 1 75428484 splice site probably benign
R1505:Speg UTSW 1 75375542 missense probably benign 0.02
R1506:Speg UTSW 1 75417663 missense probably benign 0.03
R1531:Speg UTSW 1 75401222 missense possibly damaging 0.86
R1543:Speg UTSW 1 75421951 missense probably damaging 1.00
R1567:Speg UTSW 1 75428047 missense probably benign
R1630:Speg UTSW 1 75422977 missense probably damaging 1.00
R1667:Speg UTSW 1 75410549 splice site probably benign
R1673:Speg UTSW 1 75411163 missense possibly damaging 0.60
R1718:Speg UTSW 1 75417863 missense probably benign 0.00
R1718:Speg UTSW 1 75421744 missense possibly damaging 0.87
R1719:Speg UTSW 1 75417863 missense probably benign 0.00
R1759:Speg UTSW 1 75401162 missense possibly damaging 0.95
R1861:Speg UTSW 1 75389005 missense probably damaging 1.00
R1874:Speg UTSW 1 75423906 missense probably benign
R1936:Speg UTSW 1 75431408 missense possibly damaging 0.93
R2192:Speg UTSW 1 75417727 missense probably damaging 1.00
R2204:Speg UTSW 1 75430477 missense probably benign 0.30
R2287:Speg UTSW 1 75430465 missense possibly damaging 0.76
R2696:Speg UTSW 1 75406926 missense probably benign 0.27
R2983:Speg UTSW 1 75384930 missense possibly damaging 0.83
R3110:Speg UTSW 1 75422682 nonsense probably null
R3112:Speg UTSW 1 75422682 nonsense probably null
R3154:Speg UTSW 1 75401542 missense probably damaging 1.00
R3720:Speg UTSW 1 75426782 missense probably damaging 1.00
R3983:Speg UTSW 1 75422547 missense probably benign 0.27
R4133:Speg UTSW 1 75427904 missense probably benign
R4522:Speg UTSW 1 75428330 missense probably damaging 1.00
R4564:Speg UTSW 1 75391834 missense probably damaging 1.00
R4577:Speg UTSW 1 75415395 missense probably damaging 1.00
R4858:Speg UTSW 1 75421735 missense probably damaging 1.00
R4953:Speg UTSW 1 75423864 missense possibly damaging 0.72
R4965:Speg UTSW 1 75427703 missense probably damaging 1.00
R4967:Speg UTSW 1 75387869 missense probably damaging 1.00
R5152:Speg UTSW 1 75428098 missense possibly damaging 0.92
R5156:Speg UTSW 1 75428087 missense probably damaging 0.99
R5371:Speg UTSW 1 75431393 missense possibly damaging 0.50
R5550:Speg UTSW 1 75429100 missense probably damaging 1.00
R5562:Speg UTSW 1 75427056 missense probably damaging 1.00
R5687:Speg UTSW 1 75419129 splice site probably null
R5985:Speg UTSW 1 75406684 missense possibly damaging 0.94
R6038:Speg UTSW 1 75418459 critical splice donor site probably null
R6038:Speg UTSW 1 75418459 critical splice donor site probably null
R6143:Speg UTSW 1 75414387 missense probably damaging 1.00
R6265:Speg UTSW 1 75406679 nonsense probably null
R6347:Speg UTSW 1 75426875 missense probably benign 0.00
R6453:Speg UTSW 1 75417972 missense probably benign 0.06
R6505:Speg UTSW 1 75406684 missense possibly damaging 0.94
R6505:Speg UTSW 1 75429523 missense possibly damaging 0.93
R6531:Speg UTSW 1 75422757 missense probably benign 0.03
R6566:Speg UTSW 1 75388463 missense probably damaging 1.00
R6747:Speg UTSW 1 75410395 critical splice donor site probably null
R6819:Speg UTSW 1 75391812 missense possibly damaging 0.56
R6821:Speg UTSW 1 75417903 missense possibly damaging 0.83
R6919:Speg UTSW 1 75387908 nonsense probably null
R6981:Speg UTSW 1 75430913 missense probably damaging 1.00
R7002:Speg UTSW 1 75423268 missense probably damaging 0.98
R7082:Speg UTSW 1 75411447 missense probably damaging 0.96
R7140:Speg UTSW 1 75406770 critical splice donor site probably null
R7175:Speg UTSW 1 75422490 missense probably benign 0.01
R7178:Speg UTSW 1 75422383 missense possibly damaging 0.46
R7345:Speg UTSW 1 75384835 missense probably damaging 0.97
R7420:Speg UTSW 1 75430905 missense probably damaging 1.00
R7537:Speg UTSW 1 75401464 missense probably damaging 1.00
R7562:Speg UTSW 1 75431279 missense probably damaging 0.97
R7615:Speg UTSW 1 75429242 missense probably damaging 1.00
R7679:Speg UTSW 1 75406315 missense probably damaging 1.00
R7692:Speg UTSW 1 75401190 missense probably benign 0.04
R7696:Speg UTSW 1 75429161 missense probably damaging 1.00
R7719:Speg UTSW 1 75375825 missense probably damaging 1.00
X0025:Speg UTSW 1 75422457 missense probably damaging 1.00
X0026:Speg UTSW 1 75423475 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CCAAGAGATTGGCAGGTGTG -3'
(R):5'- GGGTAAAACATGTTCCAAATTTGCC -3'

Sequencing Primer
(F):5'- GGGCGAGGAAGAGCTGCC -3'
(R):5'- CCAAATTTGCCTTTACAAAGAACAG -3'
Posted On2017-06-26