Mutagenetix > Incidental Mutation

Incidental Mutation 'R9258:Myo3a'

701987

Institutional Source

Beutler Lab

Gene Symbol

Myo3a

Ensembl Gene

ENSMUSG00000025716

Gene Name

myosin IIIA

Synonyms

9030416P08Rik

MMRRC Submission

Accession Numbers

Genbank: NM_148413; MGI: 2183924

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9258 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

22227503-22618252 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 22577533 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 1204 (E1204D)

Ref Sequence

ENSEMBL: ENSMUSP00000046329 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044749] [ENSMUST00000138863]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000044749
AA Change: E1204D

PolyPhen 2 Score 0.604 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000046329
Gene: ENSMUSG00000025716
AA Change: E1204D

Domain	Start	End	E-Value	Type
S_TKc	29	295	1.62e-91	SMART
MYSc	340	1061	2.07e-252	SMART
IQ	1061	1083	2.88e1	SMART
IQ	1088	1110	9.48e-3	SMART
low complexity region	1153	1169	N/A	INTRINSIC
low complexity region	1359	1369	N/A	INTRINSIC
low complexity region	1496	1505	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000138863
AA Change: E266D

PolyPhen 2 Score 0.604 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000116185
Gene: ENSMUSG00000025716
AA Change: E266D

Domain	Start	End	E-Value	Type
Pfam:Myosin_head	1	110	1.7e-28	PFAM
IQ	123	145	2.88e1	SMART
IQ	150	172	9.48e-3	SMART
low complexity region	215	231	N/A	INTRINSIC
low complexity region	421	431	N/A	INTRINSIC
low complexity region	558	567	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the myosin superfamily. Myosins are actin-dependent motor proteins and are categorized into conventional myosins (class II) and unconventional myosins (classes I and III through XV) based on their variable C-terminal cargo-binding domains. Class III myosins, such as this one, have a kinase domain N-terminal to the conserved N-terminal motor domains and are expressed in photoreceptors. The protein encoded by this gene plays an important role in hearing in humans. Three different recessive, loss of function mutations in the encoded protein have been shown to cause nonsyndromic progressive hearing loss. Expression of this gene is highly restricted, with the strongest expression in retina and cochlea. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired hearing and cochlear hair cell degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931428F04Rik	A	G	8: 105,282,143	V414A	probably damaging	Het
Abcb10	T	A	8: 123,982,608	Q69L	probably benign	Het
Abtb2	A	C	2: 103,716,065	Q930P	probably null	Het
Adam18	G	A	8: 24,668,558	T73I	probably benign	Het
Ankrd54	A	T	15: 79,062,796	M1K	probably null	Het
Anks1	T	C	17: 28,058,426	V1106A	probably damaging	Het
Aox2	A	T	1: 58,312,356	I701F	probably damaging	Het
Arfgef3	C	T	10: 18,589,639	R2152H	probably damaging	Het
Arnt2	C	T	7: 84,361,590	G37E	probably damaging	Het
Arpp21	G	A	9: 112,124,888	T581M	probably benign	Het
Arvcf	A	G	16: 18,398,207	N428S	probably damaging	Het
C2cd3	A	G	7: 100,448,819	E1471G		Het
Cadm1	A	G	9: 47,799,432	K211R	probably benign	Het
Cdh6	A	G	15: 13,064,376	S143P	probably damaging	Het
Cep152	G	A	2: 125,579,436	Q1125*	probably null	Het
Cfap54	A	C	10: 92,935,098	S2095A	unknown	Het
Col12a1	T	C	9: 79,706,363	T67A	probably benign	Het
Col6a3	T	C	1: 90,772,981	N3216S	unknown	Het
Cpeb2	T	A	5: 43,234,112	L217Q		Het
Ctbp2	A	T	7: 132,995,292	N119K	probably damaging	Het
Des	G	T	1: 75,363,645	V399L	probably benign	Het
Dnah2	G	T	11: 69,477,253	H1753Q	probably damaging	Het
Dnajc6	T	C	4: 101,618,616	V562A	probably benign	Het
Dusp13	T	C	14: 21,741,087	D99G	probably benign	Het
Ehd3	A	G	17: 73,820,566	I165V	probably benign	Het
Eme2	C	T	17: 24,893,079	V241M	probably damaging	Het
Eml5	A	G	12: 98,844,117	L860P	possibly damaging	Het
Eogt	T	A	6: 97,112,082	K521M	possibly damaging	Het
Epb41l5	T	C	1: 119,578,971	T489A	probably benign	Het
Fmo5	G	T	3: 97,651,486	V421L	probably benign	Het
Gabpa	C	T	16: 84,856,515	P268S	probably benign	Het
Gas2l3	G	T	10: 89,426,453	H136N	probably benign	Het
Gm5592	C	T	7: 41,288,983	A563V	possibly damaging	Het
Gpn3	A	T	5: 122,381,445	D205V	probably benign	Het
H13	T	C	2: 152,681,079	L104S	probably damaging	Het
H2-Q4	T	A	17: 35,380,129	V125E	probably benign	Het
Ifih1	A	G	2: 62,611,898	F374S	probably damaging	Het
Ildr2	A	G	1: 166,303,589	D338G	probably damaging	Het
Kmt2b	A	T	7: 30,582,468	N1162K	probably null	Het
Lmntd1	T	C	6: 145,413,530	D298G	probably damaging	Het
Lrrc32	T	A	7: 98,499,138	V375E	probably benign	Het
Lrrc37a	A	C	11: 103,502,196	I801R	probably benign	Het
Mgam	A	G	6: 40,680,187	E935G	probably benign	Het
Mms22l	A	T	4: 24,588,238	T917S	probably damaging	Het
Nav3	T	A	10: 109,714,382	E1829V	probably damaging	Het
Nccrp1	C	T	7: 28,546,207	G150D	probably damaging	Het
Nlrp4b	G	T	7: 10,710,160	W12L	probably damaging	Het
Nmb	T	C	7: 80,904,253	T71A	possibly damaging	Het
Ogfod2	T	A	5: 124,112,442	H35Q	probably benign	Het
Ola1	A	T	2: 73,099,388	S290R	probably damaging	Het
Olfr1297	A	T	2: 111,621,984	I30N	possibly damaging	Het
Olfr1499	A	T	19: 13,814,735	L285*	probably null	Het
Olfr390	T	G	11: 73,787,455	N172K	probably benign	Het
Olfr493	T	G	7: 108,346,679	T101P	probably benign	Het
Olfr589	C	A	7: 103,155,202	E182*	probably null	Het
Olfr621-ps1	T	G	7: 103,629,336	Y208S	unknown	Het
Pcsk9	T	C	4: 106,458,850	D132G	possibly damaging	Het
Pkhd1	A	T	1: 20,373,950	V2296E	probably damaging	Het
Prl2c5	A	T	13: 13,190,712	I151L	probably damaging	Het
Prl3d3	A	T	13: 27,160,948	D101V	possibly damaging	Het
Prrt1	A	G	17: 34,631,146	Y178C	probably damaging	Het
Rasal1	A	T	5: 120,655,090	I87F	possibly damaging	Het
Rpgrip1l	A	T	8: 91,260,986	Y814*	probably null	Het
Rpl3l	T	G	17: 24,732,473		probably null	Het
Rrbp1	C	A	2: 144,011,241		probably benign	Het
Ryr3	A	G	2: 112,653,019	S4158P	probably damaging	Het
Scube2	G	T	7: 109,799,308	S951Y	probably damaging	Het
Sec14l1	T	C	11: 117,150,176	V396A	probably benign	Het
Sh3gl1	T	A	17: 56,018,911	K173*	probably null	Het
Shank3	A	T	15: 89,504,318	E371V	probably damaging	Het
Slc25a24	A	G	3: 109,159,435	T302A	probably damaging	Het
Slc25a41	A	T	17: 57,041,580	H4Q	probably benign	Het
Slc45a1	A	T	4: 150,638,614	V271D	possibly damaging	Het
Smad6	A	T	9: 64,020,291	L245Q	probably damaging	Het
Smad7	C	A	18: 75,394,246	Q388K	probably damaging	Het
Snx29	G	T	16: 11,714,935	D348Y	possibly damaging	Het
Son	A	T	16: 91,677,682	H2418L	unknown	Het
Sppl3	G	A	5: 115,095,863	V331M	probably damaging	Het
St13	T	G	15: 81,388,368	T92P	probably benign	Het
St3gal4	A	G	9: 35,052,347	W222R	probably damaging	Het
Stk32a	T	A	18: 43,311,934	N264K	probably benign	Het
Stoml3	T	A	3: 53,497,976	I26N	possibly damaging	Het
Taf7	T	C	18: 37,642,968	E182G	probably damaging	Het
Tas2r138	A	G	6: 40,613,195	V39A	probably damaging	Het
Tbc1d12	A	G	19: 38,901,379	S418G	possibly damaging	Het
Tbr1	T	A	2: 61,812,379	C663S	probably benign	Het
Tmc5	A	T	7: 118,623,278	Y67F	probably benign	Het
Tnfsf4	A	C	1: 161,417,243	I168L	probably benign	Het
Trav5-1	T	G	14: 52,622,890	S51A	probably benign	Het
Trmt10c	A	T	16: 56,034,283	C330S	possibly damaging	Het
Trpm1	T	C	7: 64,234,965	M798T	probably benign	Het
Unc13d	AATGCCTCCCATGCC	AATGCCTCCCATGCCTCCCATGCC	11: 116,068,172		probably benign	Het
Unc13d	CATGCC	CATGCCTCCGATGCC	11: 116,068,181		probably benign	Het
Vmn1r199	A	G	13: 22,382,652	T39A	possibly damaging	Het
Vmn1r74	T	A	7: 11,847,072	C100S	possibly damaging	Het
Vmn2r77	T	A	7: 86,803,094	I494K	possibly damaging	Het
Wdr17	G	A	8: 54,659,619	Q816*	probably null	Het

Other mutations in Myo3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01014:Myo3a	APN	2	22332473	missense	probably benign	0.42
IGL01307:Myo3a	APN	2	22558289	missense	probably damaging	1.00
IGL01413:Myo3a	APN	2	22297600	missense	probably benign	0.25
IGL01655:Myo3a	APN	2	22423326	missense	probably damaging	1.00
IGL01767:Myo3a	APN	2	22423222	missense	probably damaging	0.96
IGL01803:Myo3a	APN	2	22241115	missense	probably damaging	1.00
IGL01969:Myo3a	APN	2	22297688	missense	probably benign	0.03
IGL02043:Myo3a	APN	2	22399965	missense	probably benign	0.01
IGL02124:Myo3a	APN	2	22577526	missense	probably benign	0.01
IGL02174:Myo3a	APN	2	22332393	missense	probably benign	0.04
IGL02649:Myo3a	APN	2	22323607	missense	probably benign
IGL02976:Myo3a	APN	2	22542452	nonsense	probably null
IGL03328:Myo3a	APN	2	22578198	missense	probably benign	0.02
IGL03376:Myo3a	APN	2	22600074	splice site	probably benign
lose	UTSW	2	22558320	nonsense	probably null
snooze	UTSW	2	22282634	missense	probably damaging	0.99
A5278:Myo3a	UTSW	2	22323653	missense	probably benign	0.27
PIT4445001:Myo3a	UTSW	2	22542415	missense	possibly damaging	0.64
R0008:Myo3a	UTSW	2	22579741	missense	probably damaging	0.99
R0099:Myo3a	UTSW	2	22245598	missense	probably benign	0.03
R0103:Myo3a	UTSW	2	22544322	splice site	probably benign
R0103:Myo3a	UTSW	2	22544322	splice site	probably benign
R0212:Myo3a	UTSW	2	22291848	missense	probably damaging	1.00
R0281:Myo3a	UTSW	2	22245598	missense	probably benign	0.03
R0282:Myo3a	UTSW	2	22245598	missense	probably benign	0.03
R0492:Myo3a	UTSW	2	22323636	missense	possibly damaging	0.46
R0498:Myo3a	UTSW	2	22577429	missense	possibly damaging	0.74
R0594:Myo3a	UTSW	2	22544332	splice site	probably benign
R0609:Myo3a	UTSW	2	22333513	missense	probably benign	0.29
R0609:Myo3a	UTSW	2	22396299	missense	possibly damaging	0.95
R0827:Myo3a	UTSW	2	22558215	missense	probably damaging	1.00
R0968:Myo3a	UTSW	2	22558289	missense	probably damaging	1.00
R1157:Myo3a	UTSW	2	22542414	critical splice acceptor site	probably null
R1301:Myo3a	UTSW	2	22267095	splice site	probably benign
R1352:Myo3a	UTSW	2	22323675	critical splice donor site	probably null
R1443:Myo3a	UTSW	2	22282626	missense	probably damaging	0.99
R1465:Myo3a	UTSW	2	22577927	missense	probably benign	0.00
R1465:Myo3a	UTSW	2	22577927	missense	probably benign	0.00
R1517:Myo3a	UTSW	2	22282634	missense	probably damaging	0.99
R1565:Myo3a	UTSW	2	22340280	missense	probably damaging	1.00
R1712:Myo3a	UTSW	2	22564992	missense	probably damaging	1.00
R1722:Myo3a	UTSW	2	22399827	missense	probably benign	0.03
R1822:Myo3a	UTSW	2	22340280	missense	probably damaging	1.00
R1823:Myo3a	UTSW	2	22340280	missense	probably damaging	1.00
R1824:Myo3a	UTSW	2	22396243	missense	probably benign
R1837:Myo3a	UTSW	2	22577592	missense	possibly damaging	0.76
R1867:Myo3a	UTSW	2	22399846	missense	probably benign	0.00
R1917:Myo3a	UTSW	2	22291922	missense	probably damaging	1.00
R1920:Myo3a	UTSW	2	22564996	missense	probably benign	0.02
R1937:Myo3a	UTSW	2	22396315	missense	probably damaging	1.00
R1954:Myo3a	UTSW	2	22241226	missense	probably damaging	1.00
R1988:Myo3a	UTSW	2	22578128	missense	possibly damaging	0.86
R2091:Myo3a	UTSW	2	22333677	missense	probably damaging	0.99
R2115:Myo3a	UTSW	2	22245531	missense	probably damaging	1.00
R2125:Myo3a	UTSW	2	22578174	missense	probably benign	0.42
R2126:Myo3a	UTSW	2	22578174	missense	probably benign	0.42
R2216:Myo3a	UTSW	2	22577771	missense	probably benign	0.00
R2413:Myo3a	UTSW	2	22577912	missense	probably benign	0.00
R2964:Myo3a	UTSW	2	22340256	missense	possibly damaging	0.90
R3196:Myo3a	UTSW	2	22399868	missense	possibly damaging	0.86
R3837:Myo3a	UTSW	2	22565109	splice site	probably benign
R3905:Myo3a	UTSW	2	22558215	missense	probably damaging	1.00
R3926:Myo3a	UTSW	2	22565041	missense	probably damaging	0.99
R4014:Myo3a	UTSW	2	22578170	missense	possibly damaging	0.76
R4015:Myo3a	UTSW	2	22578170	missense	possibly damaging	0.76
R4017:Myo3a	UTSW	2	22578170	missense	possibly damaging	0.76
R4043:Myo3a	UTSW	2	22333539	splice site	probably benign
R4044:Myo3a	UTSW	2	22577700	missense	probably damaging	0.99
R4057:Myo3a	UTSW	2	22266160	missense	probably benign	0.01
R4192:Myo3a	UTSW	2	22407377	missense	probably damaging	1.00
R4282:Myo3a	UTSW	2	22340278	missense	probably benign	0.14
R4321:Myo3a	UTSW	2	22267155	missense	probably damaging	1.00
R4393:Myo3a	UTSW	2	22577854	missense	probably damaging	0.99
R4398:Myo3a	UTSW	2	22577842	missense	probably benign
R4446:Myo3a	UTSW	2	22600137	missense	probably damaging	1.00
R4685:Myo3a	UTSW	2	22407422	missense	probably damaging	1.00
R5032:Myo3a	UTSW	2	22282602	missense	probably damaging	1.00
R5096:Myo3a	UTSW	2	22574242	missense	probably benign	0.16
R5183:Myo3a	UTSW	2	22578158	missense	probably benign	0.05
R5458:Myo3a	UTSW	2	22245550	missense	probably damaging	1.00
R5502:Myo3a	UTSW	2	22558369	missense	probably damaging	1.00
R5522:Myo3a	UTSW	2	22574341	missense	probably damaging	1.00
R6462:Myo3a	UTSW	2	22558411	missense	probably damaging	1.00
R6479:Myo3a	UTSW	2	22577865	missense	probably benign	0.00
R6513:Myo3a	UTSW	2	22407332	missense	probably damaging	1.00
R6520:Myo3a	UTSW	2	22399926	missense	possibly damaging	0.90
R6602:Myo3a	UTSW	2	22577787	missense	probably damaging	0.96
R6671:Myo3a	UTSW	2	22294522	missense	probably damaging	1.00
R6743:Myo3a	UTSW	2	22361664	missense	probably benign	0.24
R6865:Myo3a	UTSW	2	22574301	missense	probably benign	0.00
R6961:Myo3a	UTSW	2	22245558	missense	probably benign	0.00
R7001:Myo3a	UTSW	2	22332377	missense	probably benign	0.04
R7215:Myo3a	UTSW	2	22245567	missense	possibly damaging	0.78
R7301:Myo3a	UTSW	2	22544466	critical splice donor site	probably null
R7318:Myo3a	UTSW	2	22558320	nonsense	probably null
R7447:Myo3a	UTSW	2	22544426	missense	probably benign	0.27
R7456:Myo3a	UTSW	2	22407444	missense	probably benign	0.08
R7528:Myo3a	UTSW	2	22266114	nonsense	probably null
R7731:Myo3a	UTSW	2	22282589	missense	probably damaging	1.00
R7768:Myo3a	UTSW	2	22241143	missense	probably damaging	0.99
R8054:Myo3a	UTSW	2	22574317	missense	probably benign	0.00
R8140:Myo3a	UTSW	2	22407346	missense	probably damaging	1.00
R8143:Myo3a	UTSW	2	22282665	critical splice donor site	probably null
R8346:Myo3a	UTSW	2	22558422	critical splice donor site	probably null
R8421:Myo3a	UTSW	2	22362124	missense	probably benign	0.07
R8495:Myo3a	UTSW	2	22396273	missense	probably damaging	0.96
R8551:Myo3a	UTSW	2	22332466	missense	probably benign	0.00
R8708:Myo3a	UTSW	2	22291796	splice site	probably benign
R8757:Myo3a	UTSW	2	22558307	missense	possibly damaging	0.49
R8759:Myo3a	UTSW	2	22558307	missense	possibly damaging	0.49
R8779:Myo3a	UTSW	2	22245593	nonsense	probably null
R8828:Myo3a	UTSW	2	22241053	missense	probably benign	0.01
R8910:Myo3a	UTSW	2	22574268	missense	probably benign	0.01
R8916:Myo3a	UTSW	2	22567692	missense	probably damaging	1.00
R8926:Myo3a	UTSW	2	22396263	missense	possibly damaging	0.95
R9028:Myo3a	UTSW	2	22600087	missense	possibly damaging	0.79
R9046:Myo3a	UTSW	2	22558355	missense	probably damaging	0.99
R9120:Myo3a	UTSW	2	22544426	missense	probably benign	0.27
R9153:Myo3a	UTSW	2	22399933	missense	probably benign	0.02
R9191:Myo3a	UTSW	2	22579829	missense	probably benign	0.24
R9436:Myo3a	UTSW	2	22407424	nonsense	probably null
R9464:Myo3a	UTSW	2	22227572	start gained	probably benign
R9487:Myo3a	UTSW	2	22241051	missense	probably benign
R9719:Myo3a	UTSW	2	22544455	missense	probably benign	0.02
R9799:Myo3a	UTSW	2	22600169	missense	probably damaging	1.00
Z1177:Myo3a	UTSW	2	22618140	missense	possibly damaging	0.58

Predicted Primers

PCR Primer
(F):5'- GCACAGGGAATCTTTTGTGAAG -3'
(R):5'- ATCTCCTCAGTCAGCCACAG -3'

Sequencing Primer
(F):5'- GGGAATCTTTTGTGAAGAAACAGAC -3'
(R):5'- TCAGTCAGCCACAGCCCTG -3'

Posted On

2022-03-25