Incidental Mutation 'R9258:Myo3a'
ID 701987
Institutional Source Beutler Lab
Gene Symbol Myo3a
Ensembl Gene ENSMUSG00000025716
Gene Name myosin IIIA
Synonyms 9030416P08Rik
Accession Numbers

Genbank: NM_148413; MGI: 2183924

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9258 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 22227503-22618252 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 22577533 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 1204 (E1204D)
Ref Sequence ENSEMBL: ENSMUSP00000046329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044749] [ENSMUST00000138863]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000044749
AA Change: E1204D

PolyPhen 2 Score 0.604 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000046329
Gene: ENSMUSG00000025716
AA Change: E1204D

DomainStartEndE-ValueType
S_TKc 29 295 1.62e-91 SMART
MYSc 340 1061 2.07e-252 SMART
IQ 1061 1083 2.88e1 SMART
IQ 1088 1110 9.48e-3 SMART
low complexity region 1153 1169 N/A INTRINSIC
low complexity region 1359 1369 N/A INTRINSIC
low complexity region 1496 1505 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000138863
AA Change: E266D

PolyPhen 2 Score 0.604 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000116185
Gene: ENSMUSG00000025716
AA Change: E266D

DomainStartEndE-ValueType
Pfam:Myosin_head 1 110 1.7e-28 PFAM
IQ 123 145 2.88e1 SMART
IQ 150 172 9.48e-3 SMART
low complexity region 215 231 N/A INTRINSIC
low complexity region 421 431 N/A INTRINSIC
low complexity region 558 567 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the myosin superfamily. Myosins are actin-dependent motor proteins and are categorized into conventional myosins (class II) and unconventional myosins (classes I and III through XV) based on their variable C-terminal cargo-binding domains. Class III myosins, such as this one, have a kinase domain N-terminal to the conserved N-terminal motor domains and are expressed in photoreceptors. The protein encoded by this gene plays an important role in hearing in humans. Three different recessive, loss of function mutations in the encoded protein have been shown to cause nonsyndromic progressive hearing loss. Expression of this gene is highly restricted, with the strongest expression in retina and cochlea. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired hearing and cochlear hair cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428F04Rik A G 8: 105,282,143 V414A probably damaging Het
Abcb10 T A 8: 123,982,608 Q69L probably benign Het
Abtb2 A C 2: 103,716,065 Q930P probably null Het
Adam18 G A 8: 24,668,558 T73I probably benign Het
Ankrd54 A T 15: 79,062,796 M1K probably null Het
Anks1 T C 17: 28,058,426 V1106A probably damaging Het
Aox2 A T 1: 58,312,356 I701F probably damaging Het
Arfgef3 C T 10: 18,589,639 R2152H probably damaging Het
Arnt2 C T 7: 84,361,590 G37E probably damaging Het
Arpp21 G A 9: 112,124,888 T581M probably benign Het
Arvcf A G 16: 18,398,207 N428S probably damaging Het
C2cd3 A G 7: 100,448,819 E1471G Het
Cadm1 A G 9: 47,799,432 K211R probably benign Het
Cdh6 A G 15: 13,064,376 S143P probably damaging Het
Cep152 G A 2: 125,579,436 Q1125* probably null Het
Cfap54 A C 10: 92,935,098 S2095A unknown Het
Col12a1 T C 9: 79,706,363 T67A probably benign Het
Col6a3 T C 1: 90,772,981 N3216S unknown Het
Cpeb2 T A 5: 43,234,112 L217Q Het
Ctbp2 A T 7: 132,995,292 N119K probably damaging Het
Des G T 1: 75,363,645 V399L probably benign Het
Dnah2 G T 11: 69,477,253 H1753Q probably damaging Het
Dnajc6 T C 4: 101,618,616 V562A probably benign Het
Dusp13 T C 14: 21,741,087 D99G probably benign Het
Ehd3 A G 17: 73,820,566 I165V probably benign Het
Eme2 C T 17: 24,893,079 V241M probably damaging Het
Eml5 A G 12: 98,844,117 L860P possibly damaging Het
Eogt T A 6: 97,112,082 K521M possibly damaging Het
Epb41l5 T C 1: 119,578,971 T489A probably benign Het
Fmo5 G T 3: 97,651,486 V421L probably benign Het
Gabpa C T 16: 84,856,515 P268S probably benign Het
Gas2l3 G T 10: 89,426,453 H136N probably benign Het
Gm5592 C T 7: 41,288,983 A563V possibly damaging Het
Gpn3 A T 5: 122,381,445 D205V probably benign Het
H13 T C 2: 152,681,079 L104S probably damaging Het
H2-Q4 T A 17: 35,380,129 V125E probably benign Het
Ifih1 A G 2: 62,611,898 F374S probably damaging Het
Ildr2 A G 1: 166,303,589 D338G probably damaging Het
Kmt2b A T 7: 30,582,468 N1162K probably null Het
Lmntd1 T C 6: 145,413,530 D298G probably damaging Het
Lrrc32 T A 7: 98,499,138 V375E probably benign Het
Lrrc37a A C 11: 103,502,196 I801R probably benign Het
Mgam A G 6: 40,680,187 E935G probably benign Het
Mms22l A T 4: 24,588,238 T917S probably damaging Het
Nav3 T A 10: 109,714,382 E1829V probably damaging Het
Nccrp1 C T 7: 28,546,207 G150D probably damaging Het
Nlrp4b G T 7: 10,710,160 W12L probably damaging Het
Nmb T C 7: 80,904,253 T71A possibly damaging Het
Ogfod2 T A 5: 124,112,442 H35Q probably benign Het
Ola1 A T 2: 73,099,388 S290R probably damaging Het
Olfr1297 A T 2: 111,621,984 I30N possibly damaging Het
Olfr1499 A T 19: 13,814,735 L285* probably null Het
Olfr390 T G 11: 73,787,455 N172K probably benign Het
Olfr493 T G 7: 108,346,679 T101P probably benign Het
Olfr589 C A 7: 103,155,202 E182* probably null Het
Olfr621-ps1 T G 7: 103,629,336 Y208S unknown Het
Pcsk9 T C 4: 106,458,850 D132G possibly damaging Het
Pkhd1 A T 1: 20,373,950 V2296E probably damaging Het
Prl2c5 A T 13: 13,190,712 I151L probably damaging Het
Prl3d3 A T 13: 27,160,948 D101V possibly damaging Het
Prrt1 A G 17: 34,631,146 Y178C probably damaging Het
Rasal1 A T 5: 120,655,090 I87F possibly damaging Het
Rpgrip1l A T 8: 91,260,986 Y814* probably null Het
Rpl3l T G 17: 24,732,473 probably null Het
Rrbp1 C A 2: 144,011,241 probably benign Het
Ryr3 A G 2: 112,653,019 S4158P probably damaging Het
Scube2 G T 7: 109,799,308 S951Y probably damaging Het
Sec14l1 T C 11: 117,150,176 V396A probably benign Het
Sh3gl1 T A 17: 56,018,911 K173* probably null Het
Shank3 A T 15: 89,504,318 E371V probably damaging Het
Slc25a24 A G 3: 109,159,435 T302A probably damaging Het
Slc25a41 A T 17: 57,041,580 H4Q probably benign Het
Slc45a1 A T 4: 150,638,614 V271D possibly damaging Het
Smad6 A T 9: 64,020,291 L245Q probably damaging Het
Smad7 C A 18: 75,394,246 Q388K probably damaging Het
Snx29 G T 16: 11,714,935 D348Y possibly damaging Het
Son A T 16: 91,677,682 H2418L unknown Het
Sppl3 G A 5: 115,095,863 V331M probably damaging Het
St13 T G 15: 81,388,368 T92P probably benign Het
St3gal4 A G 9: 35,052,347 W222R probably damaging Het
Stk32a T A 18: 43,311,934 N264K probably benign Het
Stoml3 T A 3: 53,497,976 I26N possibly damaging Het
Taf7 T C 18: 37,642,968 E182G probably damaging Het
Tas2r138 A G 6: 40,613,195 V39A probably damaging Het
Tbc1d12 A G 19: 38,901,379 S418G possibly damaging Het
Tbr1 T A 2: 61,812,379 C663S probably benign Het
Tmc5 A T 7: 118,623,278 Y67F probably benign Het
Tnfsf4 A C 1: 161,417,243 I168L probably benign Het
Trav5-1 T G 14: 52,622,890 S51A probably benign Het
Trmt10c A T 16: 56,034,283 C330S possibly damaging Het
Trpm1 T C 7: 64,234,965 M798T probably benign Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 116,068,172 probably benign Het
Unc13d CATGCC CATGCCTCCGATGCC 11: 116,068,181 probably benign Het
Vmn1r199 A G 13: 22,382,652 T39A possibly damaging Het
Vmn1r74 T A 7: 11,847,072 C100S possibly damaging Het
Vmn2r77 T A 7: 86,803,094 I494K possibly damaging Het
Wdr17 G A 8: 54,659,619 Q816* probably null Het
Other mutations in Myo3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Myo3a APN 2 22332473 missense probably benign 0.42
IGL01307:Myo3a APN 2 22558289 missense probably damaging 1.00
IGL01413:Myo3a APN 2 22297600 missense probably benign 0.25
IGL01655:Myo3a APN 2 22423326 missense probably damaging 1.00
IGL01767:Myo3a APN 2 22423222 missense probably damaging 0.96
IGL01803:Myo3a APN 2 22241115 missense probably damaging 1.00
IGL01969:Myo3a APN 2 22297688 missense probably benign 0.03
IGL02043:Myo3a APN 2 22399965 missense probably benign 0.01
IGL02124:Myo3a APN 2 22577526 missense probably benign 0.01
IGL02174:Myo3a APN 2 22332393 missense probably benign 0.04
IGL02649:Myo3a APN 2 22323607 missense probably benign
IGL02976:Myo3a APN 2 22542452 nonsense probably null
IGL03328:Myo3a APN 2 22578198 missense probably benign 0.02
IGL03376:Myo3a APN 2 22600074 splice site probably benign
lose UTSW 2 22558320 nonsense probably null
snooze UTSW 2 22282634 missense probably damaging 0.99
A5278:Myo3a UTSW 2 22323653 missense probably benign 0.27
PIT4445001:Myo3a UTSW 2 22542415 missense possibly damaging 0.64
R0008:Myo3a UTSW 2 22579741 missense probably damaging 0.99
R0099:Myo3a UTSW 2 22245598 missense probably benign 0.03
R0103:Myo3a UTSW 2 22544322 splice site probably benign
R0103:Myo3a UTSW 2 22544322 splice site probably benign
R0212:Myo3a UTSW 2 22291848 missense probably damaging 1.00
R0281:Myo3a UTSW 2 22245598 missense probably benign 0.03
R0282:Myo3a UTSW 2 22245598 missense probably benign 0.03
R0492:Myo3a UTSW 2 22323636 missense possibly damaging 0.46
R0498:Myo3a UTSW 2 22577429 missense possibly damaging 0.74
R0594:Myo3a UTSW 2 22544332 splice site probably benign
R0609:Myo3a UTSW 2 22333513 missense probably benign 0.29
R0609:Myo3a UTSW 2 22396299 missense possibly damaging 0.95
R0827:Myo3a UTSW 2 22558215 missense probably damaging 1.00
R0968:Myo3a UTSW 2 22558289 missense probably damaging 1.00
R1157:Myo3a UTSW 2 22542414 critical splice acceptor site probably null
R1301:Myo3a UTSW 2 22267095 splice site probably benign
R1352:Myo3a UTSW 2 22323675 critical splice donor site probably null
R1443:Myo3a UTSW 2 22282626 missense probably damaging 0.99
R1465:Myo3a UTSW 2 22577927 missense probably benign 0.00
R1465:Myo3a UTSW 2 22577927 missense probably benign 0.00
R1517:Myo3a UTSW 2 22282634 missense probably damaging 0.99
R1565:Myo3a UTSW 2 22340280 missense probably damaging 1.00
R1712:Myo3a UTSW 2 22564992 missense probably damaging 1.00
R1722:Myo3a UTSW 2 22399827 missense probably benign 0.03
R1822:Myo3a UTSW 2 22340280 missense probably damaging 1.00
R1823:Myo3a UTSW 2 22340280 missense probably damaging 1.00
R1824:Myo3a UTSW 2 22396243 missense probably benign
R1837:Myo3a UTSW 2 22577592 missense possibly damaging 0.76
R1867:Myo3a UTSW 2 22399846 missense probably benign 0.00
R1917:Myo3a UTSW 2 22291922 missense probably damaging 1.00
R1920:Myo3a UTSW 2 22564996 missense probably benign 0.02
R1937:Myo3a UTSW 2 22396315 missense probably damaging 1.00
R1954:Myo3a UTSW 2 22241226 missense probably damaging 1.00
R1988:Myo3a UTSW 2 22578128 missense possibly damaging 0.86
R2091:Myo3a UTSW 2 22333677 missense probably damaging 0.99
R2115:Myo3a UTSW 2 22245531 missense probably damaging 1.00
R2125:Myo3a UTSW 2 22578174 missense probably benign 0.42
R2126:Myo3a UTSW 2 22578174 missense probably benign 0.42
R2216:Myo3a UTSW 2 22577771 missense probably benign 0.00
R2413:Myo3a UTSW 2 22577912 missense probably benign 0.00
R2964:Myo3a UTSW 2 22340256 missense possibly damaging 0.90
R3196:Myo3a UTSW 2 22399868 missense possibly damaging 0.86
R3837:Myo3a UTSW 2 22565109 splice site probably benign
R3905:Myo3a UTSW 2 22558215 missense probably damaging 1.00
R3926:Myo3a UTSW 2 22565041 missense probably damaging 0.99
R4014:Myo3a UTSW 2 22578170 missense possibly damaging 0.76
R4015:Myo3a UTSW 2 22578170 missense possibly damaging 0.76
R4017:Myo3a UTSW 2 22578170 missense possibly damaging 0.76
R4043:Myo3a UTSW 2 22333539 splice site probably benign
R4044:Myo3a UTSW 2 22577700 missense probably damaging 0.99
R4057:Myo3a UTSW 2 22266160 missense probably benign 0.01
R4192:Myo3a UTSW 2 22407377 missense probably damaging 1.00
R4282:Myo3a UTSW 2 22340278 missense probably benign 0.14
R4321:Myo3a UTSW 2 22267155 missense probably damaging 1.00
R4393:Myo3a UTSW 2 22577854 missense probably damaging 0.99
R4398:Myo3a UTSW 2 22577842 missense probably benign
R4446:Myo3a UTSW 2 22600137 missense probably damaging 1.00
R4685:Myo3a UTSW 2 22407422 missense probably damaging 1.00
R5032:Myo3a UTSW 2 22282602 missense probably damaging 1.00
R5096:Myo3a UTSW 2 22574242 missense probably benign 0.16
R5183:Myo3a UTSW 2 22578158 missense probably benign 0.05
R5458:Myo3a UTSW 2 22245550 missense probably damaging 1.00
R5502:Myo3a UTSW 2 22558369 missense probably damaging 1.00
R5522:Myo3a UTSW 2 22574341 missense probably damaging 1.00
R6462:Myo3a UTSW 2 22558411 missense probably damaging 1.00
R6479:Myo3a UTSW 2 22577865 missense probably benign 0.00
R6513:Myo3a UTSW 2 22407332 missense probably damaging 1.00
R6520:Myo3a UTSW 2 22399926 missense possibly damaging 0.90
R6602:Myo3a UTSW 2 22577787 missense probably damaging 0.96
R6671:Myo3a UTSW 2 22294522 missense probably damaging 1.00
R6743:Myo3a UTSW 2 22361664 missense probably benign 0.24
R6865:Myo3a UTSW 2 22574301 missense probably benign 0.00
R6961:Myo3a UTSW 2 22245558 missense probably benign 0.00
R7001:Myo3a UTSW 2 22332377 missense probably benign 0.04
R7215:Myo3a UTSW 2 22245567 missense possibly damaging 0.78
R7301:Myo3a UTSW 2 22544466 critical splice donor site probably null
R7318:Myo3a UTSW 2 22558320 nonsense probably null
R7447:Myo3a UTSW 2 22544426 missense probably benign 0.27
R7456:Myo3a UTSW 2 22407444 missense probably benign 0.08
R7528:Myo3a UTSW 2 22266114 nonsense probably null
R7731:Myo3a UTSW 2 22282589 missense probably damaging 1.00
R7768:Myo3a UTSW 2 22241143 missense probably damaging 0.99
R8054:Myo3a UTSW 2 22574317 missense probably benign 0.00
R8140:Myo3a UTSW 2 22407346 missense probably damaging 1.00
R8143:Myo3a UTSW 2 22282665 critical splice donor site probably null
R8346:Myo3a UTSW 2 22558422 critical splice donor site probably null
R8421:Myo3a UTSW 2 22362124 missense probably benign 0.07
R8495:Myo3a UTSW 2 22396273 missense probably damaging 0.96
R8551:Myo3a UTSW 2 22332466 missense probably benign 0.00
R8708:Myo3a UTSW 2 22291796 splice site probably benign
R8757:Myo3a UTSW 2 22558307 missense possibly damaging 0.49
R8759:Myo3a UTSW 2 22558307 missense possibly damaging 0.49
R8779:Myo3a UTSW 2 22245593 nonsense probably null
R8828:Myo3a UTSW 2 22241053 missense probably benign 0.01
R8910:Myo3a UTSW 2 22574268 missense probably benign 0.01
R8916:Myo3a UTSW 2 22567692 missense probably damaging 1.00
R8926:Myo3a UTSW 2 22396263 missense possibly damaging 0.95
R9028:Myo3a UTSW 2 22600087 missense possibly damaging 0.79
R9046:Myo3a UTSW 2 22558355 missense probably damaging 0.99
R9120:Myo3a UTSW 2 22544426 missense probably benign 0.27
R9153:Myo3a UTSW 2 22399933 missense probably benign 0.02
R9191:Myo3a UTSW 2 22579829 missense probably benign 0.24
R9436:Myo3a UTSW 2 22407424 nonsense probably null
R9464:Myo3a UTSW 2 22227572 start gained probably benign
Z1177:Myo3a UTSW 2 22618140 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- GCACAGGGAATCTTTTGTGAAG -3'
(R):5'- ATCTCCTCAGTCAGCCACAG -3'

Sequencing Primer
(F):5'- GGGAATCTTTTGTGAAGAAACAGAC -3'
(R):5'- TCAGTCAGCCACAGCCCTG -3'
Posted On 2022-03-25