Incidental Mutation 'R9389:Baz1a'
ID 710499
Institutional Source Beutler Lab
Gene Symbol Baz1a
Ensembl Gene ENSMUSG00000035021
Gene Name bromodomain adjacent to zinc finger domain 1A
Synonyms Wcrf180, Acf1, Gtl5
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9389 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 54892989-55014348 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 54916823 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 828 (E828D)
Ref Sequence ENSEMBL: ENSMUSP00000039757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038926] [ENSMUST00000173433]
AlphaFold O88379
Predicted Effect probably damaging
Transcript: ENSMUST00000038926
AA Change: E828D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039757
Gene: ENSMUSG00000035021
AA Change: E828D

DomainStartEndE-ValueType
Pfam:WAC_Acf1_DNA_bd 23 122 4.4e-36 PFAM
low complexity region 164 175 N/A INTRINSIC
coiled coil region 312 397 N/A INTRINSIC
Pfam:DDT 423 485 2.3e-14 PFAM
low complexity region 519 530 N/A INTRINSIC
Pfam:WHIM1 593 641 1.5e-8 PFAM
low complexity region 658 696 N/A INTRINSIC
low complexity region 725 738 N/A INTRINSIC
low complexity region 774 796 N/A INTRINSIC
low complexity region 861 873 N/A INTRINSIC
Pfam:WHIM3 894 932 2e-16 PFAM
low complexity region 1058 1073 N/A INTRINSIC
PHD 1151 1197 9.46e-15 SMART
RING 1152 1196 6.88e-1 SMART
low complexity region 1214 1257 N/A INTRINSIC
BROMO 1426 1534 2.18e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173433
AA Change: E825D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133478
Gene: ENSMUSG00000035021
AA Change: E825D

DomainStartEndE-ValueType
Pfam:WAC_Acf1_DNA_bd 22 122 1.1e-37 PFAM
low complexity region 164 175 N/A INTRINSIC
coiled coil region 312 397 N/A INTRINSIC
DDT 422 487 1.54e-19 SMART
low complexity region 518 529 N/A INTRINSIC
Pfam:WHIM1 592 640 1.8e-8 PFAM
low complexity region 657 695 N/A INTRINSIC
low complexity region 722 735 N/A INTRINSIC
low complexity region 771 793 N/A INTRINSIC
low complexity region 858 870 N/A INTRINSIC
low complexity region 1055 1070 N/A INTRINSIC
PHD 1148 1194 9.46e-15 SMART
RING 1149 1193 6.88e-1 SMART
low complexity region 1211 1254 N/A INTRINSIC
BROMO 1423 1531 2.18e-31 SMART
Meta Mutation Damage Score 0.3678 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The BAZ1A gene encodes the accessory subunit of the ATP-dependent chromatin assembly factor (ACF), a member of the ISWI ('imitation switch') family of chromatin remodeling complexes (summarized by Racki et al., 2009 [PubMed 20033039]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and able to repair meiotic double-strand breaks but exhibit teratospermia, oligospermia, asthenospermia, and male infertility due to impaired spermiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik C T 6: 41,033,145 G85D probably benign Het
4931440F15Rik A G 11: 29,825,107 S117P probably damaging Het
Abcb1b G A 5: 8,825,614 V596I probably benign Het
Agtpbp1 A T 13: 59,466,070 M1019K probably damaging Het
Arfgef3 A G 10: 18,603,523 V1448A probably damaging Het
Ces1f A T 8: 93,269,972 probably null Het
Cfap53 T A 18: 74,299,343 probably null Het
Col6a4 T C 9: 106,000,784 Y1998C probably damaging Het
Col9a2 A G 4: 121,054,751 T675A probably benign Het
Dusp6 G A 10: 99,263,977 V96M possibly damaging Het
Elmo1 T G 13: 20,185,491 M22R probably benign Het
Gm19965 A G 1: 116,821,836 N416D Het
Gpr162 A G 6: 124,861,394 Y98H probably damaging Het
Igfals G A 17: 24,881,626 V564I probably benign Het
Il4 C T 11: 53,614,010 R76H probably damaging Het
Itgb1 T A 8: 128,707,156 N50K probably benign Het
Itpr3 A T 17: 27,095,925 Y682F possibly damaging Het
Jak3 C T 8: 71,684,052 P668S probably damaging Het
Malrd1 A T 2: 15,703,156 N932I unknown Het
Mast4 C A 13: 103,333,930 R88L probably benign Het
Mfsd11 T G 11: 116,873,335 S381A probably benign Het
Mrm3 A G 11: 76,250,030 D288G probably damaging Het
Myg1 G T 15: 102,336,937 V198F probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Npy6r T C 18: 44,275,692 I60T probably damaging Het
Olfr1109 A T 2: 87,093,046 M117K possibly damaging Het
Olfr1308 G T 2: 111,960,527 P182H probably damaging Het
Olfr1341 A T 4: 118,710,156 M250L probably benign Het
Olfr177 C T 16: 58,872,613 C179Y probably damaging Het
Olfr530 T C 7: 140,373,017 T198A probably benign Het
Olfr811 G A 10: 129,801,671 P285S probably damaging Het
Ovgp1 CCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCATCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGGGTTTCTAAGATCACCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCA CCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGGGTTTCTAAGATCACCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCA 3: 105,986,525 probably benign Het
Oxtr C A 6: 112,489,349 R150L probably damaging Het
Pappa A T 4: 65,180,888 Y548F probably damaging Het
Pip4k2a T C 2: 18,908,079 K73R probably damaging Het
Pla2g4f T A 2: 120,302,300 D685V probably damaging Het
Ppp1r35 T A 5: 137,779,315 L81Q probably damaging Het
Ptprf C A 4: 118,236,039 A469S probably benign Het
Ranbp3l T A 15: 9,057,223 N322K probably damaging Het
Rev3l T A 10: 39,822,971 Y1155N possibly damaging Het
Rfesd T C 13: 76,003,012 Y96C probably damaging Het
Runx1 C T 16: 92,613,680 V283I possibly damaging Het
Sema5b A C 16: 35,645,722 Q125P probably damaging Het
Spef2 A T 15: 9,725,221 M150K probably damaging Het
Srcap T G 7: 127,542,283 L1745W probably damaging Het
Srgap2 A G 1: 131,355,627 Y239H probably damaging Het
Svil T A 18: 5,090,811 H1304Q possibly damaging Het
Syne1 T C 10: 5,229,193 D4427G possibly damaging Het
Tg T A 15: 66,689,324 M1065K probably benign Het
Tgm2 T C 2: 158,117,896 T656A probably benign Het
Ttc37 A G 13: 76,127,039 D403G probably benign Het
Ubr4 A G 4: 139,425,924 K809E Het
Vmn1r88 T C 7: 13,178,619 S301P probably damaging Het
Wdr27 A G 17: 14,891,718 V671A possibly damaging Het
Zbtb17 G A 4: 141,465,820 V550I possibly damaging Het
Zeb2 A T 2: 44,997,908 I379N probably damaging Het
Other mutations in Baz1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Baz1a APN 12 54916731 missense probably benign
IGL01138:Baz1a APN 12 54930325 missense probably damaging 1.00
IGL01298:Baz1a APN 12 54954809 missense probably damaging 1.00
IGL02639:Baz1a APN 12 54896025 splice site probably benign
IGL02995:Baz1a APN 12 54900447 missense probably damaging 1.00
IGL03001:Baz1a APN 12 54923111 missense possibly damaging 0.50
IGL03104:Baz1a APN 12 54894958 missense probably damaging 1.00
IGL03135:Baz1a APN 12 54929590 missense probably damaging 1.00
IGL03151:Baz1a APN 12 54909149 critical splice acceptor site probably null
IGL03235:Baz1a APN 12 54898535 missense probably damaging 1.00
IGL03240:Baz1a APN 12 54927567 nonsense probably null
Bezos UTSW 12 54895031 nonsense probably null
Flavia UTSW 12 54975308 missense probably damaging 1.00
gumdrops UTSW 12 54900448 missense probably damaging 1.00
Kilter UTSW 12 54900532 missense probably damaging 0.99
Kisses UTSW 12 54975137 missense probably damaging 1.00
liverlips UTSW 12 54921143 missense possibly damaging 0.68
smooch UTSW 12 54916823 missense probably damaging 1.00
Smootch UTSW 12 54911385 missense probably damaging 1.00
PIT4458001:Baz1a UTSW 12 54930310 missense probably benign 0.03
R0127:Baz1a UTSW 12 54898706 missense possibly damaging 0.93
R0183:Baz1a UTSW 12 54911387 missense probably damaging 1.00
R0393:Baz1a UTSW 12 54918436 critical splice donor site probably null
R0532:Baz1a UTSW 12 54934820 missense possibly damaging 0.55
R0614:Baz1a UTSW 12 54941519 nonsense probably null
R0626:Baz1a UTSW 12 54975270 missense probably damaging 0.99
R0654:Baz1a UTSW 12 54911397 missense probably benign 0.01
R0782:Baz1a UTSW 12 54894488 missense probably damaging 1.00
R0826:Baz1a UTSW 12 54930312 nonsense probably null
R0855:Baz1a UTSW 12 54900563 splice site probably benign
R0927:Baz1a UTSW 12 54894988 missense probably damaging 1.00
R0941:Baz1a UTSW 12 54898431 missense probably benign 0.00
R1079:Baz1a UTSW 12 54895000 missense possibly damaging 0.91
R1157:Baz1a UTSW 12 54929564 missense probably damaging 1.00
R1647:Baz1a UTSW 12 54975198 missense probably damaging 1.00
R1731:Baz1a UTSW 12 54918545 missense possibly damaging 0.83
R1739:Baz1a UTSW 12 54898788 nonsense probably null
R1762:Baz1a UTSW 12 54909020 missense probably damaging 1.00
R1770:Baz1a UTSW 12 54898508 missense probably damaging 1.00
R1968:Baz1a UTSW 12 54900337 missense possibly damaging 0.91
R2037:Baz1a UTSW 12 54929646 missense probably damaging 1.00
R2111:Baz1a UTSW 12 54911385 missense probably damaging 1.00
R2215:Baz1a UTSW 12 54975369 nonsense probably null
R2282:Baz1a UTSW 12 54916812 nonsense probably null
R2875:Baz1a UTSW 12 54923119 missense probably damaging 1.00
R2890:Baz1a UTSW 12 54898517 missense probably benign
R2971:Baz1a UTSW 12 54923439 missense probably damaging 1.00
R3404:Baz1a UTSW 12 54916989 missense probably benign 0.00
R3419:Baz1a UTSW 12 54946899 missense probably benign 0.05
R3699:Baz1a UTSW 12 54917046 missense probably benign 0.09
R3899:Baz1a UTSW 12 54934804 missense probably benign 0.01
R3927:Baz1a UTSW 12 54921143 missense possibly damaging 0.68
R4050:Baz1a UTSW 12 54929619 missense probably benign 0.00
R4072:Baz1a UTSW 12 54941560 missense probably benign 0.18
R4196:Baz1a UTSW 12 54911415 missense probably damaging 1.00
R4289:Baz1a UTSW 12 54900448 missense probably damaging 1.00
R4455:Baz1a UTSW 12 54911368 missense probably benign 0.26
R4583:Baz1a UTSW 12 54922540 missense probably damaging 0.99
R4622:Baz1a UTSW 12 54941515 missense probably benign 0.00
R4807:Baz1a UTSW 12 54898482 missense probably benign 0.28
R4998:Baz1a UTSW 12 54975137 missense probably damaging 1.00
R5239:Baz1a UTSW 12 54898344 missense probably damaging 0.99
R5379:Baz1a UTSW 12 54894348 missense probably damaging 1.00
R5408:Baz1a UTSW 12 54923050 missense probably damaging 1.00
R5678:Baz1a UTSW 12 54900532 missense probably damaging 0.99
R5810:Baz1a UTSW 12 54927715 intron probably benign
R6092:Baz1a UTSW 12 54909083 missense possibly damaging 0.88
R6317:Baz1a UTSW 12 54954800 missense possibly damaging 0.92
R6332:Baz1a UTSW 12 54918554 missense probably benign 0.01
R6803:Baz1a UTSW 12 54941555 missense probably null 0.99
R7185:Baz1a UTSW 12 54975308 missense probably damaging 1.00
R7248:Baz1a UTSW 12 54900508 missense probably damaging 1.00
R7392:Baz1a UTSW 12 54898765 missense probably damaging 1.00
R8009:Baz1a UTSW 12 54895031 nonsense probably null
R8025:Baz1a UTSW 12 54909136 missense probably benign 0.34
R8392:Baz1a UTSW 12 54923123 missense probably damaging 1.00
R8862:Baz1a UTSW 12 54985839 unclassified probably benign
R8949:Baz1a UTSW 12 54894453 missense probably damaging 1.00
R9340:Baz1a UTSW 12 54916587 missense probably damaging 0.97
R9401:Baz1a UTSW 12 54916554 missense probably damaging 1.00
R9666:Baz1a UTSW 12 54941560 missense probably benign 0.18
R9722:Baz1a UTSW 12 54900097 missense probably benign 0.43
R9746:Baz1a UTSW 12 54975110 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCAGCTGTGCACAAGAACTG -3'
(R):5'- TAAAGCAGGAGCCTCTGAGTG -3'

Sequencing Primer
(F):5'- AAGCACCACCGATTTGGCTTATG -3'
(R):5'- AGCCTCTGAGTGCCGAC -3'
Posted On 2022-04-18