Incidental Mutation 'R9456:Ift140'
ID 714609
Institutional Source Beutler Lab
Gene Symbol Ift140
Ensembl Gene ENSMUSG00000024169
Gene Name intraflagellar transport 140
Synonyms Tce5, Wdtc2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9456 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 25016091-25099495 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 25035784 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 413 (F413L)
Ref Sequence ENSEMBL: ENSMUSP00000024983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024983] [ENSMUST00000137386] [ENSMUST00000156945]
AlphaFold E9PY46
Predicted Effect probably benign
Transcript: ENSMUST00000024983
AA Change: F413L

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000024983
Gene: ENSMUSG00000024169
AA Change: F413L

DomainStartEndE-ValueType
WD40 55 89 6.14e1 SMART
WD40 91 131 1.49e0 SMART
Blast:WD40 252 304 3e-15 BLAST
WD40 308 352 2.76e0 SMART
Blast:WD40 364 405 8e-17 BLAST
Blast:WD40 510 547 6e-13 BLAST
Blast:WD40 560 603 3e-7 BLAST
Blast:TPR 863 896 9e-13 BLAST
Blast:TPR 1011 1044 1e-13 BLAST
Blast:TPR 1377 1410 8e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000137386
AA Change: F413L

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000116163
Gene: ENSMUSG00000024169
AA Change: F413L

DomainStartEndE-ValueType
WD40 55 89 6.14e1 SMART
WD40 91 131 1.49e0 SMART
Blast:WD40 252 304 3e-15 BLAST
WD40 308 352 2.76e0 SMART
Blast:WD40 364 405 1e-16 BLAST
Blast:WD40 510 547 5e-13 BLAST
Blast:WD40 560 603 3e-7 BLAST
Blast:TPR 863 896 8e-13 BLAST
Blast:TPR 1011 1044 9e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000156945
AA Change: F144L

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000116689
Gene: ENSMUSG00000024169
AA Change: F144L

DomainStartEndE-ValueType
Blast:WD40 2 35 6e-12 BLAST
SCOP:d1erja_ 19 131 5e-7 SMART
Blast:WD40 39 83 1e-24 BLAST
Blast:WD40 95 136 2e-18 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the subunits of the intraflagellar transport (IFT) complex A. Intraflagellar transport is involved in the genesis, resorption and signaling of primary cilia. The primary cilium is a microtubule-based sensory organelle at the surface of most quiescent mammalian cells, that receives signals from its environment, such as the flow of fluid, light or odors, and transduces those signals to the nucleus. Loss of the corresponding protein in mouse results in renal cystic disease. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a reporter knock-out allele die at mid-gestation. Mice homozygous for an ENU-induced mutation exhibit cardiovascular defects and situs abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T C 12: 55,338,230 V410A probably damaging Het
Abhd3 T C 18: 10,645,121 D391G probably benign Het
Arhgdia A C 11: 120,579,242 W202G probably damaging Het
Atp2a3 A T 11: 72,980,305 D575V probably benign Het
Cep350 C A 1: 155,868,711 V2121L probably benign Het
Clcn2 CCCGCCGCCGCCGCCGC CCCGCCGCCGCCGC 16: 20,715,952 probably benign Het
Cldn9 A T 17: 23,683,582 V23E probably damaging Het
Cltc G A 11: 86,702,411 S1542F probably benign Het
Cmbl A G 15: 31,589,802 D226G probably damaging Het
Dennd4b C T 3: 90,271,208 T537I probably damaging Het
Dnah7b C A 1: 46,126,793 D539E possibly damaging Het
Fam219a T C 4: 41,521,871 T70A probably damaging Het
Fat4 T A 3: 38,888,422 V488E possibly damaging Het
Gm3336 A G 8: 70,722,091 *96W probably null Het
Hectd1 A G 12: 51,785,801 I930T probably benign Het
Hmcn1 A T 1: 150,630,302 C3824* probably null Het
Itfg1 A G 8: 85,838,937 V90A probably benign Het
Jph4 A T 14: 55,113,633 W309R probably damaging Het
Kdm2a C T 19: 4,343,113 D405N Het
Klhl5 T C 5: 65,148,596 F302S probably damaging Het
Klk8 T C 7: 43,803,753 M256T probably benign Het
Klre1 A T 6: 129,582,405 R99S probably benign Het
Krt79 T C 15: 101,931,469 T364A probably benign Het
Lin7a C T 10: 107,382,622 P131L possibly damaging Het
Lrrc49 A G 9: 60,687,416 Y9H probably benign Het
Lrrc8a T A 2: 30,255,651 I159N probably damaging Het
Mdga2 T C 12: 66,568,758 S692G probably benign Het
Myo15 G A 11: 60,501,842 V1017M Het
Nol4 T C 18: 23,039,840 D68G probably benign Het
Olfr1276 T C 2: 111,258,003 V296A probably benign Het
Olfr790 T C 10: 129,501,646 V254A probably damaging Het
Pigw C A 11: 84,877,214 A430S probably benign Het
Pla2g4c T C 7: 13,343,975 L356P probably damaging Het
Prr5 A G 15: 84,701,481 T226A probably benign Het
Pygo1 C T 9: 72,925,774 probably benign Het
Rnf214 A G 9: 45,867,988 I333T possibly damaging Het
Sept3 A G 15: 82,283,151 I86V probably benign Het
Slc30a3 AGGGCTTACCTGAGCGG AGG 5: 31,089,545 probably null Het
Socs5 C A 17: 87,134,838 T402K probably damaging Het
Speer3 T A 5: 13,796,354 N229K Het
Stk16 T C 1: 75,211,160 probably benign Het
Taar7d T A 10: 24,027,389 F56L probably benign Het
Tcrg-V7 A T 13: 19,178,215 R25* probably null Het
Tmprss2 C T 16: 97,591,469 V93I probably benign Het
Tnpo2 G A 8: 85,047,386 E350K probably benign Het
Tor1aip2 C T 1: 156,061,779 P87S possibly damaging Het
Ush2a A G 1: 188,826,392 E3606G probably benign Het
Zeb1 C T 18: 5,766,709 Q407* probably null Het
Zfp609 A G 9: 65,703,843 S613P Het
Zfp735 A G 11: 73,711,577 N449S possibly damaging Het
Other mutations in Ift140
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Ift140 APN 17 25055644 missense probably damaging 1.00
IGL00966:Ift140 APN 17 25018802 missense probably damaging 1.00
IGL01082:Ift140 APN 17 25048455 missense possibly damaging 0.89
IGL01394:Ift140 APN 17 25094702 missense probably benign 0.02
IGL01816:Ift140 APN 17 25087025 splice site probably null
IGL01994:Ift140 APN 17 25048443 missense probably damaging 1.00
IGL02102:Ift140 APN 17 25033130 missense probably benign 0.03
IGL02207:Ift140 APN 17 25055598 missense probably benign
IGL02493:Ift140 APN 17 25087924 nonsense probably null
IGL02735:Ift140 APN 17 25034035 splice site probably benign
IGL02902:Ift140 APN 17 25090762 missense probably damaging 1.00
IGL03037:Ift140 APN 17 25092394 missense probably benign 0.02
IGL03122:Ift140 APN 17 25086910 missense probably damaging 1.00
IGL03206:Ift140 APN 17 25092826 missense probably damaging 0.98
IGL03271:Ift140 APN 17 25087906 missense probably damaging 1.00
IGL03358:Ift140 APN 17 25087984 missense probably damaging 1.00
PIT4515001:Ift140 UTSW 17 25086860 missense probably damaging 0.98
R0100:Ift140 UTSW 17 25090954 nonsense probably null
R0100:Ift140 UTSW 17 25090954 nonsense probably null
R0197:Ift140 UTSW 17 25090933 missense probably benign 0.09
R0238:Ift140 UTSW 17 25045523 nonsense probably null
R0238:Ift140 UTSW 17 25045523 nonsense probably null
R0239:Ift140 UTSW 17 25045523 nonsense probably null
R0239:Ift140 UTSW 17 25045523 nonsense probably null
R0355:Ift140 UTSW 17 25048435 nonsense probably null
R0399:Ift140 UTSW 17 25050340 missense possibly damaging 0.77
R0574:Ift140 UTSW 17 25051760 splice site probably null
R0610:Ift140 UTSW 17 25035803 missense probably benign 0.06
R0701:Ift140 UTSW 17 25090933 missense probably benign 0.09
R0883:Ift140 UTSW 17 25090933 missense probably benign 0.09
R0900:Ift140 UTSW 17 25035812 missense probably benign 0.22
R1167:Ift140 UTSW 17 25035745 missense probably benign 0.01
R1295:Ift140 UTSW 17 25088933 critical splice donor site probably null
R1588:Ift140 UTSW 17 25087985 missense probably damaging 1.00
R1619:Ift140 UTSW 17 25088865 missense probably damaging 1.00
R1637:Ift140 UTSW 17 25025634 missense probably benign 0.40
R1854:Ift140 UTSW 17 25035839 missense probably benign 0.05
R2397:Ift140 UTSW 17 25020736 missense probably damaging 1.00
R2510:Ift140 UTSW 17 25036308 missense probably benign 0.02
R2918:Ift140 UTSW 17 25035831 missense possibly damaging 0.66
R3433:Ift140 UTSW 17 25036308 missense probably benign 0.02
R3878:Ift140 UTSW 17 25028944 missense probably benign 0.25
R4559:Ift140 UTSW 17 25090767 missense probably damaging 0.97
R4670:Ift140 UTSW 17 25098961 unclassified probably benign
R4711:Ift140 UTSW 17 25094717 splice site probably null
R4934:Ift140 UTSW 17 25048488 missense probably benign
R4949:Ift140 UTSW 17 25094665 missense probably benign 0.06
R4982:Ift140 UTSW 17 25036994 missense probably damaging 0.99
R5099:Ift140 UTSW 17 25090700 missense probably damaging 1.00
R5223:Ift140 UTSW 17 25035812 missense probably benign 0.22
R5268:Ift140 UTSW 17 25020627 missense possibly damaging 0.48
R5423:Ift140 UTSW 17 25033085 missense probably damaging 0.96
R5480:Ift140 UTSW 17 25020576 missense probably damaging 1.00
R5655:Ift140 UTSW 17 25045064 missense probably damaging 1.00
R5756:Ift140 UTSW 17 25028813 missense possibly damaging 0.62
R5837:Ift140 UTSW 17 25089540 missense probably damaging 1.00
R5894:Ift140 UTSW 17 25033919 missense possibly damaging 0.92
R5907:Ift140 UTSW 17 25092371 missense probably benign 0.02
R5966:Ift140 UTSW 17 25094761 nonsense probably null
R6000:Ift140 UTSW 17 25036960 missense probably benign 0.00
R6046:Ift140 UTSW 17 25055589 missense probably benign 0.00
R6050:Ift140 UTSW 17 25091005 missense probably damaging 1.00
R6103:Ift140 UTSW 17 25093126 missense probably damaging 1.00
R6239:Ift140 UTSW 17 25028972 missense probably benign 0.26
R6287:Ift140 UTSW 17 25050434 missense probably benign
R6539:Ift140 UTSW 17 25094669 missense possibly damaging 0.87
R6656:Ift140 UTSW 17 25032173 missense probably damaging 0.96
R6723:Ift140 UTSW 17 25033116 missense probably benign 0.08
R6749:Ift140 UTSW 17 25098916 missense probably damaging 0.99
R6892:Ift140 UTSW 17 25020546 missense possibly damaging 0.95
R7151:Ift140 UTSW 17 25055725 missense probably damaging 1.00
R7235:Ift140 UTSW 17 25020645 missense possibly damaging 0.88
R7424:Ift140 UTSW 17 25037036 missense possibly damaging 0.81
R7552:Ift140 UTSW 17 25033115 missense probably benign 0.02
R7560:Ift140 UTSW 17 25092341 missense probably benign 0.28
R7660:Ift140 UTSW 17 25051824 missense probably damaging 1.00
R8105:Ift140 UTSW 17 25036975 missense probably benign 0.01
R8415:Ift140 UTSW 17 25092915 missense probably damaging 0.99
R8437:Ift140 UTSW 17 25094677 missense probably damaging 0.99
R8747:Ift140 UTSW 17 25035835 missense probably benign
R8932:Ift140 UTSW 17 25086888 missense probably benign 0.03
R9226:Ift140 UTSW 17 25098865 missense probably benign 0.00
R9347:Ift140 UTSW 17 25094779 missense probably benign 0.00
R9451:Ift140 UTSW 17 25033951 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- ACAAGAAGTGGCTGTGGACC -3'
(R):5'- GGATTAAGCTGCCTCCAAGTCC -3'

Sequencing Primer
(F):5'- CCTCATGGGGGCATCTAAATAC -3'
(R):5'- GTTCTGAATTACACCAATGTCCAGC -3'
Posted On 2022-06-15