Phenotypic Mutation 'bullet_gray'

• Allele: bullet_gray
• Mutation Type: critical splice donor site (1 bp from exon)
• Chromosome: 13
• Coordinate: 94,451,087 bp (GRCm38)
• Base Change: G ⇒ T (forward strand)
• Gene: Ap3b1
• Gene Name: adaptor-related protein complex 3, beta 1 subunit
• Synonym(s): recombination induced mutation 2, rim2, Hps2, beta3A, AP-3
• Chromosomal Location: 94,358,960-94,566,317 bp (+)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. The encoded protein is part of the heterotetrameric AP-3 protein complex which interacts with the scaffolding protein clathrin. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2012] ; PHENOTYPE: Homozygous mutants exhibit hypopigmentation, elevated kidney levels of lysosomal enzymes, platelet storage pool deficiency, reduced ipsilateral projections from the retina to brain, reduced sensitivity of dark-adapted retina and shortened life span. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: Q9Z1T1
• SMART Domains: Protein: ENSMUSP00000022196; Gene: ENSMUSG00000021686

Domain	Start	End	E-Value	Type
low complexity region	10	24	N/A	INTRINSIC
Pfam:Adaptin_N	39	586	1.2e-170	PFAM
Pfam:SEEEED	672	812	1.3e-27	PFAM
AP3B1_C	822	969	1.58e-78	SMART
Blast:B2	993	1103	2e-27	BLAST

• Predicted Effect: probably benign
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Possibly nonessential (E-score: 0.408)
• Phenotypic Category: Autosomal Recessive
• Penetrance: 100%
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Embryos, Sperm, gDNA
• MMRRC Submission: 030291-UCD
• Last Updated: 2021-11-22 7:46 AM by Diantha La Vine
• Record Created: unknown
• Record Posted: 2007-09-28
• Science Writers: Alyson Mack, Eva Marie Y. Moresco
• Illustrators: Diantha La Vine, Katherine Timer
• Authors: Sophie Rutschmann, Amanda L. Blasius, Bruce Beutler

Accession Number

NCBI RefSeq: NM_009680; MGI: 1333879

Alleles Listed at MGI

All alleles(51) : Targeted, knock-out(1) Targeted, other(3) Gene trapped(32) Spontaneous(14) Chemically induced(1)

Phenotypic Description

The bullet gray phenotype was detected among ENU-induced homozygous mutant G3 mice. Bullet gray mice display light-colored fur, with a mixture of white and gray-brown hairs. The ears, feet and tail have a light pink color, while the eyes are black (Figure 1). As with the souris, sooty, salt and pepper and toffee phenotypes, bullet gray confers enhanced susceptibility to mouse cytomegalovirus (MCMV) infection (MCMV Susceptibility and Resistance Screen). Bullet gray is allelic to pearl (1;2). Bullet gray and pearl mice also display reduced type I interferon (IFN) responses to CpG DNA challenge in vivo (Figure 2A) (3). This screen is designed to identify mutations that specifically affect plasmacytoid dendritic cell (pDC) development and function as pDCs are the primary type I IFN producing cell type in response to Toll-like receptor 9 (TLR9), which senses CpG DNA.  Further analysis of Ap3b1^pearl/pearl mice revealed that although splenic pDCs are present (Figure 2B) and can be generated in vitro from bone marrow using FLT3 ligand (see the record for warmflash), the cells cannot produce type I IFN and the proinflammatory cytokine tumor necrosis factor (TNF)-α  in response to TLR9 stimulation (Figure 2C). Conventional DCs generated in vitro from GM-CSF treated Ap3b1^pearl/pearl bone marrow are functionally normal (Figure 2D). Treatment of pDCs at the time of CpG stimulation with an inhibitor of the AP-3 activating GTP binding protein ARF1 also results in inhibition of type I IFN gene induction by pDCs (Figure 2E).   

Nature of Mutation

The bullet gray mutation is a G to T transversion in the donor splice site of intron 13 (GTGAGT -> TTGAGT) in the Ap3b1 gene on chromosome 13 (position 92056 in Genbank genomic region NC_000079 for linear genomic DNA sequence of Ap3b1). The mutation is predicted to result in skipping of the 133-nucleotide exon 13 (out of 27 total exons), destroying the reading frame in the middle of the encoded β3A polypeptide chain (aberrant amino acids after position 411), and creating a premature stop codon that would truncate the protein after amino acid 412.  The effect of the mutation at the cDNA and protein level has not been tested.

      <--exon 12  <--exon 13 intron 13-->  exon 14-->
89477  GAATTTCAG……AACAGGGATG GTGAGTTCA……………AAATAGTTGTTG 96377
405    -E--F--Q-……-N--R--D--               -Q--*        412
         correct    deleted                aberrant

The donor splice site of intron 13, which is destroyed by the bullet gray mutation, is indicated in blue lettering; the mutated nucleotide is indicated in red lettering.

Protein Prediction

Figure 3 . The AP-3 molecule consists of β3A-, δ-, μ3-, and σ3- subunits. The β3A and δ-subunits have three domains: the trunk (alternatively, head or core) region, which mediates protein-protein interactions with the other subunits, the hydrophilic hinge region and the ear or appendage region. The protein truncation caused by the bullet gray mutation is indicated by the red, wavy line and removes a portion of the trunk, the hinge and the ear.

AP-3 is one of four different heterotetrameric adaptor protein complexes (AP-1 to AP-4) in mammalian cells that decorate the cytoplasmic surface of membrane-bound vesicles at all levels from the trans-Golgi complex to the plasma membrane and direct subcelluar trafficking of membrane cargo proteins (4).  The subunits of AP complexes are called “adaptins” or “adaptin binding proteins,” and two large, one medium, and one small adaptin subunit are present in each AP complex.  The AP-3 complex is composed of β3, δ, μ3 and σ3 subunits, with each subunit existing in A (ubiquitous) and B (neuronal) isoforms encoded by distinct genes.  The 1105 amino acid β3A protein is one of the large subunits of the AP-3 complex and shares homology with the β1 and β2 subunits of the AP-1 and AP-2 complexes, respectively (5), and β-nonclathrin-associated phosphoprotein (NAP). For more information on the AP-3 complex, please see the record for christian.

 

The AP-1 and AP-2 complexes have an overall shape reminiscent of a “head” with two protruding “ears” separated by a hinge region, and it is believed that AP-3 has the same general shape (Figure 3) (6-8).  The A (“amino terminal” or "head") region (alternatively, the trunk domain) contains 12-13 Armadillo repeats, known to function in other settings as protein-protein interaction domains (9).  The H (“hinge”) region is strongly hydrophilic and rich in serine and acidic residues, and the C (“carboxy terminal”) region corresponds to an “ear” of the holoprotein complex.  The native human ortholog (obtained from M1 cells) has been detected in a phosphorylated state, likely reflecting phosphorylation of serine residues found in the H region (5).

Expression/Localization

Ap3b1 transcript was detected by Northern blot analysis in all human tissues examined, including heart, brain, placenta, lung, liver, skeletal muscle, kidney, and pancreas (5), and is also ubiquitously expressed in the mouse. The distribution of AP-3 complex was examined in NRK and MDBK cells (rat and bovine kidney cell lines, respectively), and found to co-localize with the trans-Golgi network (TGN) (10). AP-3 also decorates budding profiles on tubular endosomal compartments, likely on the way to lysosomes (11). The association of AP-3 with membranes is reportedly promoted by the small GTP-binding protein ARF-1 (ADP ribosylation factor-1) (12), although there has been no genetic confirmation of this interaction.

 

AP-1 and AP-2 bind clathrin directly, linking clathrin lattices to membranes within cells (4).  The human AP-3 complex has been reported to associate with clathrin in vitro and in HeLa cells (11;13;14).  However, another report indicated that it was not associated with clathrin, and controversy remains as to whether AP-3 function is clathrin-dependent (10;15).  Studies in yeast support a clathrin-independent function for AP-3 [reviewed in (16)].

Background

Hermansky-Pudlak syndromes (HPS; OMIM #203300) are a group of heterogeneous, autosomal recessive disorders caused by alterations at numerous independent loci (17).  Oculocutaneous albinism (OCA) and prolonged bleeding due to impaired platelet aggregation are common to all forms of HPS, but additional manifestations characterize specific types of HPS, such as pulmonary fibrosis (HPS-1 and HPS-4), and neutropenia and mild immunodeficiency (HPS-2). At the cellular level, HPS is caused by defects in the biogenesis of lysosome-related organelles, such as melanosomes, platelet dense granules, lamellar bodies of type II alveolar epithelial cells, and lytic granules of cytotoxic T lymphocytes (CTLs) and natural killer (NK) cells. In particular, the pigmentation and bleeding problems associated with all forms of HPS arise from defects in melanosomes and platelet dense granules.

 

Figure 5 . The HPS proteins form several protein complexes (AP-3, BLOC-1, BLOC-2, and BLOC-3) that are involved in trafficking of proteins to lysosomal-related organelles (LROs) from the TGN and affect the synthesis of these organelles. Particular HPS complexes may affect only a subset of LROs (see text). It is thought that BLOC-1 and AP-3 mediate early steps of vesicle trafficking from the early endosome, while BLOC-2 and BLOC-3 are likely involved at later stages. Studies have shown physical interactions between BLOC-1 and AP-3, and BLOC-1 and BLOC-2. For simplicity, only the major cargo proteins affected by each HPS complex are shown (ATP7A, tyrosinase, Tyrp1, LAMP1). The presence of ATP7A in maturing melanosomes allows the influx of copper and activates tyrosinase. BLOC-1 is known to bind to the vesicle fusion protein syntaxin 13, which is localized to the stage I melanosome/coated endosome. BLOC-2 and AP-3 may interact with clathrin. Melanosomal maturation is shown separately, along with the stages affected by mutations in each HPS complex. Mutations in the d subunit of the AP-3 complex affect melanosomal maturation between stages III and IV, but, as mentioned above, the AP-3 complex likely mediates early vesicle trafficking.

Each type of HPS is defined by the identity of the causative mutated gene. Eight types of human HPS have been described, and mutations affecting at least 15 loci in mice create HPS-like disease. The human HPS loci and their mouse equivalents are as follows: HPS1/pale ear (18); HPS2/pearl (19); HPS3/cocoa (mutated in pam gray) (20); HPS4/light ear (21); HPS5/ruby-eye 2 (mutated in toffee and dorian gray) (22); HPS6/ruby-eye (mutated in stamper-coat) (21); HPS7/sandy (mutated in salt and pepper) (23); and HPS8/putatively reduced pigmentation (24).  Most HPS genes encode subunits of protein complexes involved in intracellular trafficking (25). Based on biochemical studies, it has been proposed that the HPS proteins assemble into four stable complexes (Figure 3): biogenesis of lysosome-related organelle complex (BLOC)-1, BLOC-2, BLOC-3, and the adaptor protein-3 (AP-3) complex.  The 200-230 kD BLOC-1 complex consists of pallidin, dysbindin, BLOC subunit 1 (BLOS1), BLOS2, BLOS3, cappuccino, muted (mutated in minnie), and snapin.  BLOC-2 (350 kD) is composed of HPS3, HPS5, and HPS6.  The proteins HPS1 and HPS4 comprise BLOC-3 (175 kD).  BLOC-1 has been shown to interact with both BLOC-2 and AP-3 (26). Thus far, no interaction partner for BLOC-3 has been described (27).

 

Mutations in the β3A subunit of the AP-3 complex cause HPS-2 (OMIM #608233) (18;27-30). The AP complexes transport cargo proteins between components of the endocytic pathway, and AP-3 specifically shuttles proteins from the TGN to lysosomes and lysosome-related organelles (16;32).  Mutations of β3A are sufficient to dissociate the AP-3 complex and induce degradation of the other subunits (19;31).  Cargo recognition by AP-3 occurs through both tyrosine-based and dileucine-based lysosomal targeting motifs.  Thus, lysosome-associated membrane protein-1 (LAMP-1), LAMP-2, and CD63, cargo proteins for AP-3 which are sorted via tyrosine-based signals, fail to be recruited to lysosomes and accumulate at the plasma membrane in human fibroblasts with greatly reduced levels of AP-3 due to a mutation in β3A (11;19;20;33). Biochemical experiments demonstrate that AP-3 associates with dileucine-based signals of tyrosinase and lysosomal integral membrane protein-II (LIMP-II), but not other proteins containing dileucine motifs (33;34).  Tyrosinase and LIMP-II also accumulate at the cell membrane in AP-3 deficient cells (33).  

 

In addition to albinism and platelet aggregation deficiency, humans with HPS-2 exhibit neutropenia and immunodeficiency due to defects in NK cells and CTLs (28-30;35). In mice, mutations in the β3A subunit result in the pearl phenotype, which is characterized by hypopigmentation, lysosomal secretion abnormalities, and platelet-dense granules containing reduced levels of adenine nucleotides and serotonin (1).  Mutations in the mouse δ subunit of the AP-3 complex cause the similar mocha phenotype, with coat and eye color dilution, lysosomal abnormalities, platelet defects, and neurological defects (balance problems, deafness) (36). 

 

Interestingly, a particular mutation of AP3B1 in dogs, an insertion of an A residue within a tract of nine A residues in exon 20, results in canine cyclic neutropenia, also known as gray Collie syndrome because the dogs have a diluted coat color (37). The mutation leads to a frameshift and premature termination, and absent mRNA due to nonsense-mediated decay (38). Humans with cyclic neutropenia display three week oscillations in the circulating neutrophil count, with fluctuations between near zero and near normal levels (39). Monocytes also cycle in the opposite phase to neutrophils. In dogs, neutrophil counts cycle every two weeks, and all other blood cells cycle in opposite phase. No pigmentation defects are observed in humans with cyclic neutropenia. Mutations in ELA2, encoding neutrophil elastase (NE), cause all known cases of human cyclic neutropenia (40). The enzyme NE (also known as leukocyte elastase) is a serine protease of neutrophil and monocyte granules, and cleaves many substrates including extracellular matrix proteins, clotting factors, immunoglobulins, and bacterial components, promoting microbe and tissue destruction (41;42). A yeast two-hybrid assay for testing adaptor protein subunit and cargo protein interactions indicates that the μ3A subunit of AP-3 interacts with NE via a tyrosine-based recognition signal, suggesting that NE is an AP-3 cargo protein (37).  The mistrafficking of NE as a result of mutations in either NE (that prevent recognition of the tyrosine-based signal by AP-3) or AP-3 is thought to underlie cyclic neutropenia (43).

Putative Mechanism

The bullet gray mutation creates a premature stop codon early in the Ap3b1 sequence (amino acid 421 out of 1105), possibly resulting in degradation of the protein, and at minimum abrogating most protein function.  Thus, the integrity of the AP-3 complex would likely be compromised. In mammals, melanin pigments conferring skin, hair and eye color are tyrosine-derived polymers synthesized in the melanosomes of melanocytes (16).  Incorrect targeting of AP-3 protein cargo, such as the melanin-biosynthetic enzyme tyrosinase (mutated in ghost) to melanosomes, would account for the hypopigmentation of bullet gray animals.  However, the presence of a significant amount of lysosomal membrane proteins in lysosomes of AP-3-deficient cells suggests the existence of an AP-3-independent pathway (19).

 

The MCMV susceptibility and lack of response to CpG stimulation suggests that the AP-3 complex is necessary for certain aspects of the immune response likely by affecting the trafficking and biogenesis of lytic granules in NK and/or T cells and an undefined subcellular compartment in pDCs (44). DCs are immune cells, whose main function is to process antigen material and present it on the surface to other cells of the immune system, thus functioning as antigen-presenting cells (APCs).  They activate helper T cells, cytotoxic T cells, and B cells, by presenting them with antigens derived from the pathogen, along with non-antigen specific costimulatory signals.  pDCs are a rare subtype of circulating DCs found in the blood as well as in peripheral lymphoid organs.  They are distinguished from conventional DCs by being derived from lymphoid precursors rather than myeloid precursors, and by differences in cell-surface markers (45).  As components of the innate immune system, these cells express endosomally-localized TLR7 and TLR9, which enable the detection of internalized viral and bacterial nucleic acids, such as ssRNA (via TLR7) or CpG DNA (via TLR9).  TLR7 and 9 signaling occurs via the adaptor protein myeloid differentiation (MyD) 88 (see pococurante and lackadaisical) resulting in the activation of the NF-κB pathway and production of proinflammatory cytokines such as TNF-α (see panr1), as well as the production of large amounts of type I IFN.  Type I IFNs are pleiotropic anti-viral proteins mediating a wide range of effects. Both TNF-α and type I IFN production by pDCs depends on components of the MyD88 signaling pathway including interleukin receptor associated kinase (IRAK)-1 and IRAK-4 (see otiose), interferon response factor (IRF) 5, TNF receptor–associated factor 6 (TRAF6), inhibitor of kappa-B kinase-α (IKKα), osteopontin, and IRF7 (see the record for inept) [reviewed in (46,47)].  The multispanning ER membrane protein UNC93B (mutated in 3d), which is required for trafficking of TLRs 3, 7, and 9 to the endosomal compartment (48), is also necessary for pDCs to sense nucleic acids. pDCs from TLR9-deficient or TLR7-deficient mice (see records for CpG1 and rsq1) fail to produce type I IFN in response to various viral and bacterial pathogens [reviewed by (49)].  An acidic endosomal environment has been shown to be essential for appropriate TLR7 and TLR9 signaling (50-52).

 

LROs share various characteristics with lysosomes and endolysosomes, such as an acidic intralumenal pH (53), and it is possible that trafficking and biogenesis of the endosomal or similar compartment in pDCs is also dependent on HPS proteins including AP-3. Indeed, analysis of DC generated from pearl homozygous mice suggests that AP-3 is required for the type I IFN response by trafficking TLR9 to a specialized subcellular compartment  (44). Interestingly, the pDC-specific phenotypes identified in mice with mutations in Ap3b1 parallel those found in mice homozygous for a mutation in Slc15a4 (see the record for feeble), which encodes PHT1, a proton-dependent oligopeptide transporter (3). PHT1 contains a typical acidic di-leucine motif required for AP-3 transport. PHT1 may regulate endosomal TLR7 and TLR9 signaling either by transporting a critical component into or out of the endosome, or by maintaining the appropriate pH necessary for TLR activation. Thus, AP-3 may be required to transport multiple proteins required for TLR signaling to their appropriate subcellular location. Mice carrying the salt and pepper allele of Dtnbp1, which encodes dysbindin, and the toffee allele of Hps5 also failed to produce type I IFN after in vivo challenge with CpG DNA.

Primers

Primers cannot be located by automatic search.

Genotyping

Bullet gray genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transversion.  This protocol has not been tested.

 

Primers

bullet gray(F): 5’- ACCCTGGCTTGAAAATGTCCCTTTG -3’

bullet gray(R): 5’- CGACTTCCACGCATGACTAGGAAAC -3’

 

PCR program

1) 95°C             2:00

2) 95°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7) 4°C              ∞

 

Primers for sequencing

bullet gray_seq(F): 5’- ACGTTAAGCAATCATTTGGGGC -3’

bullet gray_seq(R): 5’- TATGAAGCAGTGCTTAGTGAATG -3’

 

The following sequence of 621 nucleotides (from Genbank genomic region NC_000079 for linear genomic sequence of Ap3b1) is amplified:

 

91806      accct ggcttgaaaa tgtccctttg ccaaagggac attaagttat aagcgatgaa
91861 agacgttaag caatcatttg gggcccctgt taggcttaag agaattctaa attttttgtc
91921 ctgacaaagc tataaaaatg ggctttgatt cacttgataa cgccaatgtt gaaactaatc
91981 aaactgtttt tagacctacg tgagaagcca ggacaaacag tttgcagcag ccactattca
92041 gaccataggc agatgtgcaa ccagcattag cgaggtcacc gacacatgcc tcaacggcct
92101 ggtctgcctg ctgtccaaca gggatggtga gttcataggt tcactttatt tttatatggt
92161 tcataattgt atattctcag taagtcctat agctgtaatc tattatatta tcttttcggg
92221 tttttctata tatcagtatt ttctcagtaa gtagcagctt tattcttgat ttgcaggaaa
92281 atttatttca aaaaataaat gagataatta atagattttg ttttgctccc attaagacaa
92341 tttatcttac tcattcacta agcactgctt catacccttt ctgcaaaggt tctctgtgac
92401 tgtttcctag tcatgcgtgg aagtcg

 

Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated G is highlighted in red.

References

   1. Feng, L., Seymour, A. B., Jiang, S., To, A., Peden, A. A., Novak, E. K., Zhen, L., Rusiniak, M. E., Eicher, E. M., Robinson, M. S., Gorin, M. B., and Swank, R. T. (1999) The beta3A subunit gene (Ap3b1) of the AP-3 adaptor complex is altered in the mouse hypopigmentation mutant pearl, a model for Hermansky-Pudlak syndrome and night blindness, Hum. Mol. Genet. 8, 323-330.

   2.  Saravella, P. A. (1954) Pearl, a new spontaneous coat and eye color mutation in the house mouse, J Hered 45, 19-20.

   3. Blasius, A. L., Arnold, C. N., Georgel, P., Rutschmann, S., Xia, Y., Lin, P., Ross, C., Li, X., Smart, N. G., and Beutler, B. (2010) Slc15a4, AP-3, and Hermansky-Pudlak Syndrome Proteins are Required for Toll-Like Receptor Signaling in Plasmacytoid Dendritic Cells. Proc. Natl. Acad. Sci. U. S. A.. epub Nov. 2.

   4.  Schmid, S. L. (1997) Clathrin-coated vesicle formation and protein sorting: an integrated process, Annu. Rev. Biochem. 66, 511-548.

   5.  Dell'angelica, E. C., Ooi, C. E., and Bonifacino, J. S. (1997) Beta3A-adaptin, a subunit of the adaptor-like complex AP-3, J Biol. Chem. 272, 15078-15084.

   6.  Keen, J. H. (1990) Clathrin and associated assembly and disassembly proteins, Annu. Rev. Biochem. 59, 415-438.

   7.  Robinson, M. S. (1994) The role of clathrin, adaptors and dynamin in endocytosis, Curr. Opin. Cell Biol. 6, 538-544. 

   8. Heuser, J. E. and Keen, J. (1988) Deep-etch visualization of proteins involved in clathrin assembly, J. Cell Biol. 107, 877-886.

   9.  Riggleman, B., Wieschaus, E., and Schedl, P. (1989) Molecular analysis of the armadillo locus: uniformly distributed transcripts and a protein with novel internal repeats are associated with a Drosophila segment polarity gene, Genes Dev. 3, 96-113.

 10. Simpson, F., Peden, A. A., Christopoulou, L., and Robinson, M. S. (1997) Characterization of the adaptor-related protein complex, AP-3, J Cell Biol. 137, 835-845.

 11.  Peden, A. A., Oorschot, V., Hesser, B. A., Austin, C. D., Scheller, R. H., and Klumperman, J. (2004) Localization of the AP-3 adaptor complex defines a novel endosomal exit site for lysosomal membrane proteins, J. Cell Biol. 164, 1065-1076.
 12.  Ooi, C. E., Dell'angelica, E. C., and Bonifacino, J. S. (1998) ADP-Ribosylation factor 1 (ARF1) regulates recruitment of the AP-3 adaptor complex to membranes, J. Cell Biol. 142, 391-402.

 13. Borner, G. H., Harbour, M., Hester, S., Lilley, K. S., and Robinson, M. S. (2006) Comparative proteomics of clathrin-coated vesicles, J. Cell Biol. 175, 571-578.
 14.  Dell'angelica, E. C., Klumperman, J., Stoorvogel, W., and Bonifacino, J. S. (1998) Association of the AP-3 adaptor complex with clathrin, Science 280, 431-434.
 15.  Peden, A. A., Rudge, R. E., Lui, W. W., and Robinson, M. S. (2002) Assembly and function of AP-3 complexes in cells expressing mutant subunits, J. Cell Biol. 156, 327-336.

 16.  Odorizzi, G., Cowles, C. R., and Emr, S. D. (1998) The AP-3 complex: a coat of many colours, Trends Cell Biol. 8, 282-288.
 17.  Huizing, M., Boissy, R. E., and Gahl, W. A. (2002) Hermansky-Pudlak Syndrome: Vesicle Formation from Yeast to Man. Pigment Cell Res. 15, 405-419.
 18.  Oh, J., Bailin, T., Fukai, K., Feng, G. H., Ho, L., Mao, J. I., Frenk, E., Tamura, N., and Spritz, R. A. (1996) Positional cloning of a gene for Hermansky-Pudlak syndrome, a disorder of cytoplasmic organelles, Nat. Genet. 14, 300-306.
 19.  Dell'angelica, E. C., Shotelersuk, V., Aguilar, R. C., Gahl, W. A., and Bonifacino, J. S. (1999) Altered trafficking of lysosomal proteins in Hermansky-Pudlak syndrome due to mutations in the beta 3A subunit of the AP-3 adaptor, Mol. Cell 3, 11-21.
 20.  Anikster, Y., Huizing, M., White, J., Shevchenko, Y. O., Fitzpatrick, D. L., Touchman, J. W., Compton, J. G., Bale, S. J., Swank, R. T., Gahl, W. A., and Toro, J. R. (2001) Mutation of a new gene causes a unique form of Hermansky-Pudlak syndrome in a genetic isolate of central Puerto Rico, Nat. Genet. 28, 376-380.
 21.  Suzuki, T., Li, W., Zhang, Q., Karim, A., Novak, E. K., Sviderskaya, E. V., Hill, S. P., Bennett, D. C., Levin, A. V., Nieuwenhuis, H. K., Fong, C. T., Castellan, C., Miterski, B., Swank, R. T., and Spritz, R. A. (2002) Hermansky-Pudlak syndrome is caused by mutations in HPS4, the human homolog of the mouse light-ear gene, Nat. Genet. 30, 321-324.
 22.  Zhang, Q., Zhao, B., Li, W., Oiso, N., Novak, E. K., Rusiniak, M. E., Gautam, R., Chintala, S., O'Brien, E. P., Zhang, Y., Roe, B. A., Elliott, R. W., Eicher, E. M., Liang, P., Kratz, C., Legius, E., Spritz, R. A., O'Sullivan, T. N., Copeland, N. G., Jenkins, N. A., and Swank, R. T. (2003) Ru2 and Ru encode mouse orthologs of the genes mutated in human Hermansky-Pudlak syndrome types 5 and 6, Nat. Genet. 33, 145-153.
 23.  Li, W., Zhang, Q., Oiso, N., Novak, E. K., Gautam, R., O'Brien, E. P., Tinsley, C. L., Blake, D. J., Spritz, R. A., Copeland, N. G., Jenkins, N. A., Amato, D., Roe, B. A., Starcevic, M., Dell'angelica, E. C., Elliott, R. W., Mishra, V., Kingsmore, S. F., Paylor, R. E., and Swank, R. T. (2003) Hermansky-Pudlak syndrome type 7 (HPS-7) results from mutant dysbindin, a member of the biogenesis of lysosome-related organelles complex 1 (BLOC-1), Nat. Genet. 35, 84-89.
 24.  Morgan, N. V., Pasha, S., Johnson, C. A., Ainsworth, J. R., Eady, R. A., Dawood, B., McKeown, C., Trembath, R. C., Wilde, J., Watson, S. P., and Maher, E. R. (2006) A germline mutation in BLOC1S3/reduced pigmentation causes a novel variant of Hermansky-Pudlak syndrome (HPS8), Am. J Hum. Genet. 78, 160-166.
 25.  Di Pietro, S. M. and Dell'angelica, E. C. (2005) The cell biology of Hermansky-Pudlak syndrome: recent advances, Traffic. 6, 525-533.

 26.  Di Pietro, S. M., Falcon-Perez, J. M., Tenza, D., Setty, S. R., Marks, M. S., Raposo, G., and Dell'angelica, E. C. (2006) BLOC-1 interacts with BLOC-2 and the AP-3 complex to facilitate protein trafficking on endosomes, Mol. Biol. Cell 17, 4027-4038.

 27.  Martina, J. A., Moriyama, K., and Bonifacino, J. S. (2003) BLOC-3, a protein complex containing the Hermansky-Pudlak syndrome gene products HPS1 and HPS4, J Biol. Chem. 278, 29376-29384.

 28.  Jung, J., Bohn, G., Allroth, A., Boztug, K., Brandes, G., Sandrock, I., Schaffer, A. A., Rathinam, C., Kollner, I., Beger, C., Schilke, R., Welte, K., Grimbacher, B., and Klein, C. (2006) Identification of a homozygous deletion in the AP3B1 gene causing Hermansky-Pudlak syndrome, type 2, Blood 108, 362-369.

 29.  Huizing, M., Scher, C. D., Strovel, E., Fitzpatrick, D. L., Hartnell, L. M., Anikster, Y., and Gahl, W. A. (2002) Nonsense mutations in ADTB3A cause complete deficiency of the beta3A subunit of adaptor complex-3 and severe Hermansky-Pudlak syndrome type 2, Pediatr. Res. 51, 150-158.

 30.  Enders, A., Zieger, B., Schwarz, K., Yoshimi, A., Speckmann, C., Knoepfle, E. M., Kontny, U., Muller, C., Nurden, A., Rohr, J., Henschen, M., Pannicke, U., Niemeyer, C., Nurden, P., and Ehl, S. (2006) Lethal hemophagocytic lymphohistiocytosis in Hermansky-Pudlak syndrome type II, Blood 108, 81-87.

 31.  Clark, R. H., Stinchcombe, J. C., Day, A., Blott, E., Booth, S., Bossi, G., Hamblin, T., Davies, E. G., and Griffiths, G. M. (2003) Adaptor Protein 3-Dependent Microtubule-Mediated Movement of Lytic Granules to the Immunological Synapse. Nat. Immunol. 4, 1111-1120.
 32.  Obermuller, S., Kiecke, C., von Figura, K., and Honing, S. (2002) The Tyrosine Motifs of Lamp 1 and LAP Determine their Direct and Indirect Targetting to Lysosomes. J. Cell. Sci. 115, 185-194.
 33.  Le, B. R., Alconada, A., Bauer, U., and Hoflack, B. (1998) The mammalian AP-3 adaptor-like complex mediates the intracellular transport of lysosomal membrane glycoproteins, J. Biol. Chem. 273, 29451-29461.

 34.  Honing, S., Sandoval, I. V., and von, F. K. (1998) A di-leucine-based motif in the cytoplasmic tail of LIMP-II and tyrosinase mediates selective binding of AP-3, EMBO J. 17, 1304-1314

 35.  Kotzot, D., Richter, K., and Gierth-Fiebig, K. (1994) Oculocutaneous albinism, immunodeficiency, hematological disorders, and minor anomalies: a new autosomal recessive syndrome?, Am. J. Med. Genet. 50, 224-227.
 36.  Kantheti, P., Qiao, X., Diaz, M. E., Peden, A. A., Meyer, G. E., Carskadon, S. L., Kapfhamer, D., Sufalko, D., Robinson, M. S., Noebels, J. L., and Burmeister, M. (1998) Mutation in AP-3 delta in the mocha mouse links endosomal transport to storage deficiency in platelets, melanosomes, and synaptic vesicles, Neuron 21, 111-122.

 37.  Benson, K. F., Li, F. Q., Person, R. E., Albani, D., Duan, Z., Wechsler, J., Meade-White, K., Williams, K., Acland, G. M., Niemeyer, G., Lothrop, C. D., and Horwitz, M. (2003) Mutations Associated with Neutropenia in Dogs and Humans Disrupt Intracellular Transport of Neutrophil Elastase. Nat. Genet. 35, 90-96.

 38.  Benson, K. F., Person, R. E., Li, F. Q., Williams, K., and Horwitz, M. (2004) Paradoxical Homozygous Expression from Heterozygotes and Heterozygous Expression from Homozygotes as a Consequence of Transcriptional Infidelity through a Polyadenine Tract in the AP3B1 Gene Responsible for Canine Cyclic Neutropenia. Nucleic Acids Res. 32, 6327-6333.

 39.  Lange, R. D. (1983) Cyclic Hematopoiesis: Human Cyclic Neutropenia. Exp. Hematol. 11, 435-451.
 40.  Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A. G., and Dale, D. C. (1999) Mutations in ELA2, Encoding Neutrophil Elastase, Define a 21-Day Biological Clock in Cyclic Haematopoiesis. Nat. Genet. 23, 433-436.
 41.  Doring, G. (1994) The Role of Neutrophil Elastase in Chronic Inflammation. Am. J. Respir. Crit. Care Med. 150, S114-7.
 42.  Belaaouaj, A., McCarthy, R., Baumann, M., Gao, Z., Ley, T. J., Abraham, S. N., and Shapiro, S. D. (1998) Mice Lacking Neutrophil Elastase Reveal Impaired Host Defense Against Gram Negative Bacterial Sepsis. Nat. Med. 4, 615-618.
 43.  Horwitz, M., Benson, K. F., Duan, Z., Li, F. Q., and Person, R. E. (2004) Hereditary Neutropenia: Dogs Explain Human Neutrophil Elastase Mutations. Trends Mol. Med. 10, 163-170.

 44. Sasai, M., Linehan, M. M., and Iwasaki, A. (2010) Bifurcation of Toll-like receptor 9 signaling by adaptor protein 3. Science. 329,1530-1534.

 45. Kaisho, T. (2008) Type I interferon production by nucleic acid-stimulated dendritic cells, Front Biosci. 13, 6034-6042.

 46. Beutler, B., Jiang, Z., Georgel, P., Crozat, K., Croker, B., Rutschmann, S., Du, X., and Hoebe, K. (2006) Genetic analysis of host resistance: Toll-Like receptor signaling and immunity at large, Annu. Rev. Immunol. 24, 353-389.

 47. Kawai, T. and Akira, S. (2006) Innate immune recognition of viral infection, Nat. Immunol. 7, 131-137.

 48. Brinkmann, M. M., Spooner, E., Hoebe, K., Beutler, B., Ploegh, H. L., and Kim, Y. M. (2007) The interaction between the ER membrane protein UNC93B and TLR3, 7, and 9 is crucial for TLR signaling, J. Cell Biol. 177, 265-275.

 49. Gilliet, M., Cao, W., and Liu, Y. J. (2008) Plasmacytoid Dendritic Cells: Sensing Nucleic Acids in Viral Infection and Autoimmune Diseases. Nat. Rev. Immunol. 8, 594-606.

 50. Hacker, H., Mischak, H., Miethke, T., Liptay, S., Schmid, R., Sparwasser, T., Heeg, K., Lipford, G. B., and Wagner, H. (1998) CpG-DNA-specific activation of antigen-presenting cells requires stress kinase activity and is preceded by non-specific endocytosis and endosomal maturation, EMBO J. 17, 6230-6240.

 51. Diebold, S. S., Kaisho, T., Hemmi, H., Akira, S., and Reis y Sousa, C. (2004) Innate Antiviral Responses by Means of TLR7-Mediated Recognition of Single-Stranded RNA, Science 303, 1529-1531.

 52. Park, B., Brinkmann, M. M., Spooner, E., Lee, C. C., Kim, Y. M., and Ploegh, H. L. (2008) Proteolytic cleavage in an endolysosomal compartment is required for activation of Toll-like receptor 9, Nat. Immunol. 9, 1407-1414.

 53. Cutler, D. F. (2002) Introduction: Lysosome-Related Organelles. Semin. Cell Dev. Biol.. 13, 261-262.