Incidental Mutation 'R6387:Trio'
ID 514677
Institutional Source Beutler Lab
Gene Symbol Trio
Ensembl Gene ENSMUSG00000022263
Gene Name triple functional domain (PTPRF interacting)
Synonyms Solo, 6720464I07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6387 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 27730651-28025848 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 27752739 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 1026 (F1026L)
Ref Sequence ENSEMBL: ENSMUSP00000154309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090247] [ENSMUST00000226644]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000090247
AA Change: F2170L

PolyPhen 2 Score 0.726 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000087714
Gene: ENSMUSG00000022263
AA Change: F2170L

DomainStartEndE-ValueType
low complexity region 2 40 N/A INTRINSIC
SEC14 68 207 3.4e-26 SMART
SPEC 221 337 2.48e-9 SMART
SPEC 343 445 1.92e-15 SMART
SPEC 569 671 5.35e-14 SMART
SPEC 674 783 1.18e-6 SMART
SPEC 910 1011 2.6e-12 SMART
SPEC 1141 1243 7e-18 SMART
low complexity region 1249 1258 N/A INTRINSIC
RhoGEF 1296 1466 2.79e-53 SMART
PH 1480 1593 1.53e-9 SMART
SH3 1659 1720 1.9e-8 SMART
low complexity region 1788 1802 N/A INTRINSIC
low complexity region 1837 1863 N/A INTRINSIC
low complexity region 1936 1954 N/A INTRINSIC
RhoGEF 1973 2144 1.32e-63 SMART
PH 2158 2273 3.6e-6 SMART
low complexity region 2291 2341 N/A INTRINSIC
low complexity region 2371 2390 N/A INTRINSIC
low complexity region 2491 2503 N/A INTRINSIC
SH3 2558 2619 1.04e0 SMART
low complexity region 2640 2660 N/A INTRINSIC
IGc2 2701 2770 4e-12 SMART
S_TKc 2800 3054 4.84e-72 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000226644
AA Change: F1026L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000227030
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that functions as a GDP to GTP exchange factor. This protein promotes the reorganization of the actin cytoskeleton, thereby playing a role in cell migration and growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutant mice die during late embryonic development or shortly after birth. They exhibit abnormal skeletal myogenesis and display aberrant organization within the hippocampus and olfactory bulb. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T C 5: 109,737,015 K326E possibly damaging Het
Acot1 A G 12: 84,009,853 D115G probably benign Het
Adm T C 7: 110,628,295 I6T possibly damaging Het
Ahi1 A G 10: 20,969,043 Y349C probably damaging Het
Aldh1a1 A G 19: 20,617,959 E84G probably damaging Het
Ankrd31 A G 13: 96,830,573 D520G probably damaging Het
Ano4 A T 10: 88,971,405 Y736* probably null Het
Atp6v1a A G 16: 44,087,443 F612S possibly damaging Het
Calcb G A 7: 114,719,790 V17I possibly damaging Het
Cfap70 C T 14: 20,448,575 V15M probably damaging Het
Chad C T 11: 94,567,837 H271Y possibly damaging Het
Csgalnact1 C T 8: 68,358,713 G435D probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Eprs T A 1: 185,387,084 M487K possibly damaging Het
Fat4 A G 3: 38,983,785 E3862G probably damaging Het
Gdf10 T A 14: 33,924,004 S37T probably benign Het
Hhatl T A 9: 121,790,401 H39L probably benign Het
Icam4 A C 9: 21,030,209 S215R possibly damaging Het
Ighv1-18 T C 12: 114,682,660 E108G probably damaging Het
Iqcd T C 5: 120,606,855 I416T probably benign Het
Marf1 T A 16: 14,141,640 *577L probably null Het
Mark2 A G 19: 7,285,902 F167L probably damaging Het
Mpdz T C 4: 81,381,709 T351A possibly damaging Het
Mrps27 A G 13: 99,400,317 I113V possibly damaging Het
Numbl C T 7: 27,276,690 T265I probably damaging Het
Obsl1 C T 1: 75,491,362 A1296T probably benign Het
Olfr979 A G 9: 40,000,852 I125T probably damaging Het
Pcdhb21 A G 18: 37,515,332 I505V probably benign Het
Pfas A G 11: 69,000,465 F269L probably damaging Het
Prkdc G A 16: 15,698,815 V1018I probably benign Het
Prl4a1 T A 13: 28,018,499 V19E possibly damaging Het
Ptpn22 A G 3: 103,885,386 D327G probably benign Het
Smad3 G T 9: 63,654,765 D310E probably benign Het
Sparcl1 T A 5: 104,085,060 D625V probably damaging Het
Spta1 G A 1: 174,231,333 A1945T probably benign Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Sympk T C 7: 19,052,498 Y1009H possibly damaging Het
Uhrf1bp1l C T 10: 89,803,057 Q442* probably null Het
Unc5d T A 8: 28,875,526 K144* probably null Het
Unk A G 11: 116,054,940 N479S possibly damaging Het
Zfp710 T C 7: 80,086,027 I514T probably damaging Het
Zfp993 A G 4: 146,657,518 T100A probably damaging Het
Other mutations in Trio
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Trio APN 15 27912743 splice site probably benign
IGL01011:Trio APN 15 27736489 missense probably damaging 0.96
IGL01090:Trio APN 15 27773007 missense probably damaging 1.00
IGL01145:Trio APN 15 27818167 splice site probably benign
IGL01147:Trio APN 15 27881320 missense probably damaging 1.00
IGL01161:Trio APN 15 27749781 missense probably damaging 1.00
IGL01324:Trio APN 15 27905323 missense probably benign 0.42
IGL01352:Trio APN 15 27901229 missense probably benign 0.01
IGL01366:Trio APN 15 27732868 missense possibly damaging 0.76
IGL01443:Trio APN 15 27838775 splice site probably benign
IGL01454:Trio APN 15 27832985 missense probably benign 0.32
IGL01695:Trio APN 15 27773001 missense probably damaging 1.00
IGL01765:Trio APN 15 27764026 missense possibly damaging 0.85
IGL01860:Trio APN 15 27846810 missense probably damaging 1.00
IGL01879:Trio APN 15 27741033 missense probably benign 0.12
IGL01991:Trio APN 15 27871274 missense possibly damaging 0.95
IGL02106:Trio APN 15 27744158 missense possibly damaging 0.85
IGL02209:Trio APN 15 27744053 missense probably damaging 1.00
IGL02232:Trio APN 15 27902561 missense probably benign 0.24
IGL02304:Trio APN 15 27735436 missense probably damaging 0.96
IGL02504:Trio APN 15 27847390 nonsense probably null
IGL02508:Trio APN 15 27818104 missense possibly damaging 0.65
IGL02541:Trio APN 15 27844930 splice site probably benign
IGL02617:Trio APN 15 27841849 splice site probably benign
IGL02675:Trio APN 15 27768039 unclassified probably benign
IGL02817:Trio APN 15 27902881 missense probably benign 0.01
IGL02993:Trio APN 15 27830239 splice site probably benign
IGL03007:Trio APN 15 27902742 missense probably damaging 0.99
IGL03135:Trio APN 15 27832011 splice site probably benign
IGL03225:Trio APN 15 27902695 missense probably benign 0.30
R0063:Trio UTSW 15 27881437 splice site probably benign
R0063:Trio UTSW 15 27881437 splice site probably benign
R0302:Trio UTSW 15 27902517 missense probably damaging 1.00
R0505:Trio UTSW 15 27767907 missense probably benign 0.00
R0506:Trio UTSW 15 27854963 missense probably benign 0.12
R0564:Trio UTSW 15 27805822 missense probably damaging 1.00
R0659:Trio UTSW 15 27831399 missense probably damaging 0.97
R0882:Trio UTSW 15 27732894 missense probably damaging 1.00
R0939:Trio UTSW 15 27741250 critical splice donor site probably null
R1018:Trio UTSW 15 27871171 missense probably damaging 1.00
R1439:Trio UTSW 15 27897914 missense probably damaging 1.00
R1456:Trio UTSW 15 27753804 splice site probably benign
R1488:Trio UTSW 15 27740967 missense probably damaging 1.00
R1522:Trio UTSW 15 27732640 missense probably benign 0.28
R1531:Trio UTSW 15 27832985 missense probably benign 0.32
R1640:Trio UTSW 15 27833044 missense probably damaging 1.00
R1646:Trio UTSW 15 27758347 missense possibly damaging 0.91
R1682:Trio UTSW 15 27744146 splice site probably null
R1780:Trio UTSW 15 27744038 missense possibly damaging 0.93
R1791:Trio UTSW 15 27841756 missense probably damaging 1.00
R1803:Trio UTSW 15 27748340 missense probably benign
R1817:Trio UTSW 15 27742495 nonsense probably null
R1853:Trio UTSW 15 27756536 missense probably damaging 1.00
R1898:Trio UTSW 15 27742380 missense possibly damaging 0.52
R1937:Trio UTSW 15 27833056 missense probably damaging 1.00
R1938:Trio UTSW 15 27732891 missense probably damaging 0.98
R2025:Trio UTSW 15 27744137 missense probably damaging 0.99
R2025:Trio UTSW 15 27773927 missense probably damaging 1.00
R2050:Trio UTSW 15 27851945 missense possibly damaging 0.85
R2186:Trio UTSW 15 27823975 splice site probably null
R2913:Trio UTSW 15 27854912 missense probably damaging 1.00
R3151:Trio UTSW 15 27805776 missense probably damaging 1.00
R3771:Trio UTSW 15 27748091 missense probably damaging 0.98
R3773:Trio UTSW 15 27748091 missense probably damaging 0.98
R3826:Trio UTSW 15 27833070 missense probably damaging 1.00
R4015:Trio UTSW 15 27744101 missense possibly damaging 0.71
R4359:Trio UTSW 15 27749797 nonsense probably null
R4370:Trio UTSW 15 27748337 nonsense probably null
R4547:Trio UTSW 15 27818982 missense possibly damaging 0.89
R4573:Trio UTSW 15 27772998 small deletion probably benign
R4620:Trio UTSW 15 27871171 missense probably damaging 1.00
R4735:Trio UTSW 15 27752789 splice site probably null
R4764:Trio UTSW 15 27732538 nonsense probably null
R4775:Trio UTSW 15 27881342 nonsense probably null
R4942:Trio UTSW 15 27752725 missense probably benign 0.21
R5004:Trio UTSW 15 27755178 missense probably damaging 1.00
R5149:Trio UTSW 15 27754029 missense possibly damaging 0.74
R5183:Trio UTSW 15 27902600 missense probably benign 0.00
R5186:Trio UTSW 15 27897991 missense probably damaging 0.97
R5268:Trio UTSW 15 27748286 missense probably benign 0.02
R5344:Trio UTSW 15 27735532 missense probably benign 0.12
R5407:Trio UTSW 15 27844806 splice site probably null
R5442:Trio UTSW 15 27856194 missense probably benign 0.04
R5617:Trio UTSW 15 27902748 missense probably benign
R5778:Trio UTSW 15 27856164 missense probably benign 0.33
R5986:Trio UTSW 15 27851933 missense possibly damaging 0.88
R5990:Trio UTSW 15 27891459 missense probably benign 0.10
R6011:Trio UTSW 15 27735545 missense probably damaging 0.98
R6063:Trio UTSW 15 27891379 missense possibly damaging 0.94
R6166:Trio UTSW 15 27818071 missense probably damaging 0.96
R6187:Trio UTSW 15 27743952 critical splice donor site probably null
R6402:Trio UTSW 15 27902911 missense probably benign 0.02
R6478:Trio UTSW 15 27856107 missense probably benign 0.01
R6528:Trio UTSW 15 27805870 missense probably damaging 1.00
R6662:Trio UTSW 15 27854996 missense probably benign 0.00
R6825:Trio UTSW 15 27889308 missense probably damaging 0.98
R6890:Trio UTSW 15 27919288 unclassified probably benign
R6945:Trio UTSW 15 27824090 missense probably damaging 1.00
R7027:Trio UTSW 15 27805654 missense possibly damaging 0.86
R7046:Trio UTSW 15 27832051 missense probably damaging 1.00
R7049:Trio UTSW 15 27749799 missense possibly damaging 0.66
R7075:Trio UTSW 15 27898000 missense unknown
R7094:Trio UTSW 15 27891448 missense unknown
R7123:Trio UTSW 15 27742313 critical splice donor site probably benign
R7130:Trio UTSW 15 27742313 critical splice donor site probably benign
R7214:Trio UTSW 15 27871187 missense probably damaging 0.97
R7292:Trio UTSW 15 27828351 missense possibly damaging 0.63
R7293:Trio UTSW 15 27871289 missense possibly damaging 0.66
R7352:Trio UTSW 15 27732876 missense probably damaging 0.96
R7426:Trio UTSW 15 27856107 missense probably benign 0.01
R7451:Trio UTSW 15 27747913 missense probably benign 0.07
R7558:Trio UTSW 15 27831394 missense possibly damaging 0.90
R7578:Trio UTSW 15 27854939 missense possibly damaging 0.94
R7596:Trio UTSW 15 27749826 missense probably damaging 0.99
R7604:Trio UTSW 15 27736445 critical splice donor site probably null
R7609:Trio UTSW 15 27912642 missense unknown
R7767:Trio UTSW 15 27889418 missense unknown
R7784:Trio UTSW 15 27763994 missense probably damaging 1.00
R7817:Trio UTSW 15 27749866 missense probably benign 0.35
R7833:Trio UTSW 15 27774086 missense probably damaging 0.99
R7873:Trio UTSW 15 27805684 missense possibly damaging 0.83
R7879:Trio UTSW 15 27851924 missense possibly damaging 0.94
R7989:Trio UTSW 15 27772935 missense probably damaging 0.97
R8022:Trio UTSW 15 27749866 missense probably benign 0.35
R8050:Trio UTSW 15 27891454 missense unknown
R8217:Trio UTSW 15 27818969 missense probably damaging 0.97
R8280:Trio UTSW 15 27902910 missense unknown
R8283:Trio UTSW 15 27756542 missense possibly damaging 0.79
R8300:Trio UTSW 15 27855022 missense possibly damaging 0.66
R8321:Trio UTSW 15 27881326 missense possibly damaging 0.90
R8477:Trio UTSW 15 27773952 missense possibly damaging 0.83
R8479:Trio UTSW 15 27901200 missense probably benign 0.25
R8682:Trio UTSW 15 27905192 missense unknown
R8688:Trio UTSW 15 27748238 missense possibly damaging 0.61
R8708:Trio UTSW 15 27732546 missense probably damaging 0.99
R8709:Trio UTSW 15 27919237 missense unknown
R8713:Trio UTSW 15 27743951 critical splice donor site probably benign
R8798:Trio UTSW 15 27851837 missense possibly damaging 0.92
R8812:Trio UTSW 15 27905225 missense unknown
R8816:Trio UTSW 15 27741271 missense probably damaging 0.96
R8828:Trio UTSW 15 27741064 missense possibly damaging 0.93
R8987:Trio UTSW 15 27732687 missense probably benign 0.23
R9051:Trio UTSW 15 27732684 missense possibly damaging 0.78
R9069:Trio UTSW 15 27852011 missense possibly damaging 0.83
R9075:Trio UTSW 15 27773936 nonsense probably null
R9079:Trio UTSW 15 27732937 missense possibly damaging 0.52
R9139:Trio UTSW 15 27749836 nonsense probably null
X0024:Trio UTSW 15 27765726 missense possibly damaging 0.91
Z1176:Trio UTSW 15 27771387 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGACAGATATGTGTGCTGGCAC -3'
(R):5'- TGCCTGGAGCTAGGAATTAATTC -3'

Sequencing Primer
(F):5'- TGCTGGCACATGAAGCTC -3'
(R):5'- CCTGGAGCTAGGAATTAATTCATCAC -3'
Posted On 2018-05-04