Mutagenetix > Incidental Mutation

Incidental Mutation 'R8708:Trio'

669401

Institutional Source

Beutler Lab

Gene Symbol

Trio

Ensembl Gene

ENSMUSG00000022263

Gene Name

triple functional domain (PTPRF interacting)

Synonyms

Solo, 6720464I07Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8708 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

27730651-28025848 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 27732546 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 3083 (N3083I)

Ref Sequence

ENSEMBL: ENSMUSP00000087714 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090247]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000090247
AA Change: N3083I

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000087714
Gene: ENSMUSG00000022263
AA Change: N3083I

Domain	Start	End	E-Value	Type
low complexity region	2	40	N/A	INTRINSIC
SEC14	68	207	3.4e-26	SMART
SPEC	221	337	2.48e-9	SMART
SPEC	343	445	1.92e-15	SMART
SPEC	569	671	5.35e-14	SMART
SPEC	674	783	1.18e-6	SMART
SPEC	910	1011	2.6e-12	SMART
SPEC	1141	1243	7e-18	SMART
low complexity region	1249	1258	N/A	INTRINSIC
RhoGEF	1296	1466	2.79e-53	SMART
PH	1480	1593	1.53e-9	SMART
SH3	1659	1720	1.9e-8	SMART
low complexity region	1788	1802	N/A	INTRINSIC
low complexity region	1837	1863	N/A	INTRINSIC
low complexity region	1936	1954	N/A	INTRINSIC
RhoGEF	1973	2144	1.32e-63	SMART
PH	2158	2273	3.6e-6	SMART
low complexity region	2291	2341	N/A	INTRINSIC
low complexity region	2371	2390	N/A	INTRINSIC
low complexity region	2491	2503	N/A	INTRINSIC
SH3	2558	2619	1.04e0	SMART
low complexity region	2640	2660	N/A	INTRINSIC
IGc2	2701	2770	4e-12	SMART
S_TKc	2800	3054	4.84e-72	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000226713

Predicted Effect

probably benign
Transcript: ENSMUST00000227030

Meta Mutation Damage Score

0.2736

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

98% (99/101)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that functions as a GDP to GTP exchange factor. This protein promotes the reorganization of the actin cytoskeleton, thereby playing a role in cell migration and growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutant mice die during late embryonic development or shortly after birth. They exhibit abnormal skeletal myogenesis and display aberrant organization within the hippocampus and olfactory bulb. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 103 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adra1d	T	C	2: 131,561,480	K230R	probably damaging	Het
Akp3	T	A	1: 87,126,369	Y236*	probably null	Het
Alg11	T	C	8: 22,065,113	F130S	probably damaging	Het
Ankfn1	A	T	11: 89,503,930	S276R	possibly damaging	Het
Ankhd1	T	A	18: 36,594,291	H486Q	probably damaging	Het
Ankrd23	T	C	1: 36,534,088	T68A	probably benign	Het
Arhgap23	A	G	11: 97,452,412	T507A	probably benign	Het
Arid1a	A	T	4: 133,681,834	D1787E	unknown	Het
Atad2b	T	A	12: 4,961,253	D504E	probably damaging	Het
Atg2b	T	A	12: 105,669,428		probably benign	Het
Bptf	C	A	11: 107,073,313	S1685I	probably damaging	Het
Bptf	T	A	11: 107,073,314	S1685C	probably damaging	Het
Cacna1c	A	T	6: 118,627,455	I1437N		Het
Capn1	T	C	19: 6,011,298	K197E	probably damaging	Het
Ccdc177	T	C	12: 80,759,117	T128A	probably benign	Het
Ccdc7b	G	T	8: 129,136,614	M9I	probably benign	Het
Celf1	T	A	2: 91,010,580		probably null	Het
Ckap5	T	A	2: 91,595,478	N1285K	probably benign	Het
Col24a1	C	T	3: 145,545,265	T1673I	probably damaging	Het
Dbp	A	G	7: 45,709,801	E300G	probably damaging	Het
Dchs2	C	A	3: 83,128,742	H265Q	probably benign	Het
Dicer1	A	T	12: 104,728,445	S198T	possibly damaging	Het
Dnase1l2	A	T	17: 24,442,292	F86L	probably benign	Het
Dnhd1	T	G	7: 105,694,280	Y1610*	probably null	Het
Dock5	A	G	14: 67,767,371	V1529A	probably benign	Het
Egfr	G	T	11: 16,867,300		probably benign	Het
Exph5	T	A	9: 53,375,796	H1392Q	probably benign	Het
Fam78b	A	G	1: 167,078,763	K164E	possibly damaging	Het
Fignl2	C	A	15: 101,052,853	R516L	unknown	Het
Fndc7	C	T	3: 108,867,212	E577K	probably benign	Het
Fryl	T	C	5: 73,132,562	E107G	probably benign	Het
Gbp10	A	T	5: 105,220,965	M336K	probably damaging	Het
Gm11444	A	T	11: 85,846,897	C156S		Het
Gm6904	A	T	14: 59,244,813	C164S	probably damaging	Het
Gm996	C	A	2: 25,577,802	R699L	possibly damaging	Het
Golga3	C	A	5: 110,202,855	A752E	probably benign	Het
Gper1	G	T	5: 139,425,935	V12L	probably benign	Het
Hmbox1	G	T	14: 64,823,640	A394E	probably damaging	Het
Ighv1-71	T	A	12: 115,742,335	I77L	probably benign	Het
Ing4	A	T	6: 125,047,932	N214Y	probably damaging	Het
Ints8	A	G	4: 11,208,824		probably null	Het
Itpa	T	A	2: 130,675,719	V129E	probably damaging	Het
Itpripl1	T	A	2: 127,141,342	M287L	probably benign	Het
Klc3	T	C	7: 19,395,859	I362V	probably damaging	Het
Ky	T	A	9: 102,525,391		probably benign	Het
Lasp1	A	G	11: 97,806,883	N43S	possibly damaging	Het
Limk2	A	G	11: 3,350,763	M380T	probably benign	Het
Lrp2	T	A	2: 69,459,613	E3627D	probably damaging	Het
Lrrc25	T	C	8: 70,617,809	L80P	probably damaging	Het
Mcoln3	A	T	3: 146,140,521	K529*	probably null	Het
Mdn1	A	C	4: 32,725,854	D2591A	probably damaging	Het
Med12l	A	G	3: 59,252,330	I1267V	probably benign	Het
Mei4	C	A	9: 81,927,542	S226*	probably null	Het
Mios	G	A	6: 8,234,255	V809M	probably benign	Het
Mmp17	G	A	5: 129,595,422	R146Q	possibly damaging	Het
Mob3a	G	A	10: 80,691,384	Q36*	probably null	Het
Myo3a	T	A	2: 22,291,796		probably benign	Het
Naca	A	T	10: 128,048,074	I2125F	probably damaging	Het
Ndst3	A	C	3: 123,528,915	S840A	probably benign	Het
Nlrp4c	T	C	7: 6,065,604	M168T	probably damaging	Het
Nt5c3	A	G	6: 56,897,773		probably null	Het
Olfr1245	C	A	2: 89,575,279	G149V	probably damaging	Het
Olfr1489	T	C	19: 13,634,037	S309P	probably benign	Het
Olfr366	T	A	2: 37,219,944	S152T	probably damaging	Het
Olfr774	T	A	10: 129,238,809	I220N	possibly damaging	Het
Pcgf3	A	G	5: 108,486,197	D107G	probably benign	Het
Pde2a	A	G	7: 101,510,381	D816G	probably damaging	Het
Phf10	T	A	17: 14,955,999	T131S	possibly damaging	Het
Phrf1	A	G	7: 141,232,533	D70G	unknown	Het
Piezo2	A	G	18: 63,093,015	L850S	probably damaging	Het
Plcg1	T	A	2: 160,754,553		probably benign	Het
Plekhh2	A	T	17: 84,574,993	I676L	probably benign	Het
Ppp1r9a	T	G	6: 5,115,196	V804G	probably damaging	Het
Ppt2	T	C	17: 34,625,639	H180R	possibly damaging	Het
Prdm15	T	C	16: 97,816,866	H398R	unknown	Het
Rab26	A	T	17: 24,529,798	M208K	probably damaging	Het
Rab31	A	C	17: 65,667,864		probably benign	Het
Radil	A	G	5: 142,485,449	V1024A	probably damaging	Het
Rorb	A	G	19: 18,983,416	I65T	probably damaging	Het
Sall1	A	T	8: 89,032,855	V207E	probably damaging	Het
Sart3	A	T	5: 113,744,667	M864K	possibly damaging	Het
Sdcbp2	T	A	2: 151,589,537	S277T	probably benign	Het
Sept5	A	G	16: 18,624,872	V100A	probably benign	Het
Sipa1	C	T	19: 5,660,952	R10Q	probably damaging	Het
Ski	A	T	4: 155,160,662	S376T	probably damaging	Het
Slc15a4	A	T	5: 127,596,651	D566E	probably benign	Het
Srgap2	G	A	1: 131,345,806	Q372*	probably null	Het
Stard9	A	G	2: 120,703,578	T3439A	probably damaging	Het
Tln1	T	C	4: 43,534,769		probably benign	Het
Tmco3	A	G	8: 13,295,998	M279V	probably benign	Het
Tmem39b	T	C	4: 129,676,398		probably benign	Het
Ube3b	G	A	5: 114,393,090	R215Q	probably benign	Het
Ubr1	T	C	2: 120,866,483	N1646S	probably benign	Het
Uqcrc1	T	G	9: 108,947,040	F270C	probably damaging	Het
Vmn2r108	T	A	17: 20,462,425	N839I	probably damaging	Het
Vmn2r75	A	T	7: 86,163,268	S514R	probably damaging	Het
Wdfy4	C	G	14: 32,967,532	V3016L		Het
Wdr11	A	G	7: 129,599,056	N77S	probably benign	Het
Wdr17	C	A	8: 54,640,092		probably benign	Het
Wrn	T	A	8: 33,292,643	N753I	probably damaging	Het
Zan	A	G	5: 137,463,277		probably null	Het
Zfat	T	A	15: 68,084,429	T1203S	possibly damaging	Het
Zfhx2	A	C	14: 55,075,052	S62A	probably benign	Het

Other mutations in Trio

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00480:Trio	APN	15	27912743	splice site	probably benign
IGL01011:Trio	APN	15	27736489	missense	probably damaging	0.96
IGL01090:Trio	APN	15	27773007	missense	probably damaging	1.00
IGL01145:Trio	APN	15	27818167	splice site	probably benign
IGL01147:Trio	APN	15	27881320	missense	probably damaging	1.00
IGL01161:Trio	APN	15	27749781	missense	probably damaging	1.00
IGL01324:Trio	APN	15	27905323	missense	probably benign	0.42
IGL01352:Trio	APN	15	27901229	missense	probably benign	0.01
IGL01366:Trio	APN	15	27732868	missense	possibly damaging	0.76
IGL01443:Trio	APN	15	27838775	splice site	probably benign
IGL01454:Trio	APN	15	27832985	missense	probably benign	0.32
IGL01695:Trio	APN	15	27773001	missense	probably damaging	1.00
IGL01765:Trio	APN	15	27764026	missense	possibly damaging	0.85
IGL01860:Trio	APN	15	27846810	missense	probably damaging	1.00
IGL01879:Trio	APN	15	27741033	missense	probably benign	0.12
IGL01991:Trio	APN	15	27871274	missense	possibly damaging	0.95
IGL02106:Trio	APN	15	27744158	missense	possibly damaging	0.85
IGL02209:Trio	APN	15	27744053	missense	probably damaging	1.00
IGL02232:Trio	APN	15	27902561	missense	probably benign	0.24
IGL02304:Trio	APN	15	27735436	missense	probably damaging	0.96
IGL02504:Trio	APN	15	27847390	nonsense	probably null
IGL02508:Trio	APN	15	27818104	missense	possibly damaging	0.65
IGL02541:Trio	APN	15	27844930	splice site	probably benign
IGL02617:Trio	APN	15	27841849	splice site	probably benign
IGL02675:Trio	APN	15	27768039	unclassified	probably benign
IGL02817:Trio	APN	15	27902881	missense	probably benign	0.01
IGL02993:Trio	APN	15	27830239	splice site	probably benign
IGL03007:Trio	APN	15	27902742	missense	probably damaging	0.99
IGL03135:Trio	APN	15	27832011	splice site	probably benign
IGL03225:Trio	APN	15	27902695	missense	probably benign	0.30
R0063:Trio	UTSW	15	27881437	splice site	probably benign
R0063:Trio	UTSW	15	27881437	splice site	probably benign
R0302:Trio	UTSW	15	27902517	missense	probably damaging	1.00
R0505:Trio	UTSW	15	27767907	missense	probably benign	0.00
R0506:Trio	UTSW	15	27854963	missense	probably benign	0.12
R0564:Trio	UTSW	15	27805822	missense	probably damaging	1.00
R0659:Trio	UTSW	15	27831399	missense	probably damaging	0.97
R0882:Trio	UTSW	15	27732894	missense	probably damaging	1.00
R0939:Trio	UTSW	15	27741250	critical splice donor site	probably null
R1018:Trio	UTSW	15	27871171	missense	probably damaging	1.00
R1439:Trio	UTSW	15	27897914	missense	probably damaging	1.00
R1456:Trio	UTSW	15	27753804	splice site	probably benign
R1488:Trio	UTSW	15	27740967	missense	probably damaging	1.00
R1522:Trio	UTSW	15	27732640	missense	probably benign	0.28
R1531:Trio	UTSW	15	27832985	missense	probably benign	0.32
R1640:Trio	UTSW	15	27833044	missense	probably damaging	1.00
R1646:Trio	UTSW	15	27758347	missense	possibly damaging	0.91
R1682:Trio	UTSW	15	27744146	splice site	probably null
R1780:Trio	UTSW	15	27744038	missense	possibly damaging	0.93
R1791:Trio	UTSW	15	27841756	missense	probably damaging	1.00
R1803:Trio	UTSW	15	27748340	missense	probably benign
R1817:Trio	UTSW	15	27742495	nonsense	probably null
R1853:Trio	UTSW	15	27756536	missense	probably damaging	1.00
R1898:Trio	UTSW	15	27742380	missense	possibly damaging	0.52
R1937:Trio	UTSW	15	27833056	missense	probably damaging	1.00
R1938:Trio	UTSW	15	27732891	missense	probably damaging	0.98
R2025:Trio	UTSW	15	27744137	missense	probably damaging	0.99
R2025:Trio	UTSW	15	27773927	missense	probably damaging	1.00
R2050:Trio	UTSW	15	27851945	missense	possibly damaging	0.85
R2186:Trio	UTSW	15	27823975	splice site	probably null
R2913:Trio	UTSW	15	27854912	missense	probably damaging	1.00
R3151:Trio	UTSW	15	27805776	missense	probably damaging	1.00
R3771:Trio	UTSW	15	27748091	missense	probably damaging	0.98
R3773:Trio	UTSW	15	27748091	missense	probably damaging	0.98
R3826:Trio	UTSW	15	27833070	missense	probably damaging	1.00
R4015:Trio	UTSW	15	27744101	missense	possibly damaging	0.71
R4359:Trio	UTSW	15	27749797	nonsense	probably null
R4370:Trio	UTSW	15	27748337	nonsense	probably null
R4547:Trio	UTSW	15	27818982	missense	possibly damaging	0.89
R4573:Trio	UTSW	15	27772998	small deletion	probably benign
R4620:Trio	UTSW	15	27871171	missense	probably damaging	1.00
R4735:Trio	UTSW	15	27752789	splice site	probably null
R4764:Trio	UTSW	15	27732538	nonsense	probably null
R4775:Trio	UTSW	15	27881342	nonsense	probably null
R4942:Trio	UTSW	15	27752725	missense	probably benign	0.21
R5004:Trio	UTSW	15	27755178	missense	probably damaging	1.00
R5149:Trio	UTSW	15	27754029	missense	possibly damaging	0.74
R5183:Trio	UTSW	15	27902600	missense	probably benign	0.00
R5186:Trio	UTSW	15	27897991	missense	probably damaging	0.97
R5268:Trio	UTSW	15	27748286	missense	probably benign	0.02
R5344:Trio	UTSW	15	27735532	missense	probably benign	0.12
R5407:Trio	UTSW	15	27844806	splice site	probably null
R5442:Trio	UTSW	15	27856194	missense	probably benign	0.04
R5617:Trio	UTSW	15	27902748	missense	probably benign
R5778:Trio	UTSW	15	27856164	missense	probably benign	0.33
R5986:Trio	UTSW	15	27851933	missense	possibly damaging	0.88
R5990:Trio	UTSW	15	27891459	missense	probably benign	0.10
R6011:Trio	UTSW	15	27735545	missense	probably damaging	0.98
R6063:Trio	UTSW	15	27891379	missense	possibly damaging	0.94
R6166:Trio	UTSW	15	27818071	missense	probably damaging	0.96
R6187:Trio	UTSW	15	27743952	critical splice donor site	probably null
R6387:Trio	UTSW	15	27752739	missense	probably damaging	1.00
R6402:Trio	UTSW	15	27902911	missense	probably benign	0.02
R6478:Trio	UTSW	15	27856107	missense	probably benign	0.01
R6528:Trio	UTSW	15	27805870	missense	probably damaging	1.00
R6662:Trio	UTSW	15	27854996	missense	probably benign	0.00
R6825:Trio	UTSW	15	27889308	missense	probably damaging	0.98
R6890:Trio	UTSW	15	27919288	unclassified	probably benign
R6945:Trio	UTSW	15	27824090	missense	probably damaging	1.00
R7027:Trio	UTSW	15	27805654	missense	possibly damaging	0.86
R7046:Trio	UTSW	15	27832051	missense	probably damaging	1.00
R7049:Trio	UTSW	15	27749799	missense	possibly damaging	0.66
R7075:Trio	UTSW	15	27898000	missense	unknown
R7094:Trio	UTSW	15	27891448	missense	unknown
R7123:Trio	UTSW	15	27742313	critical splice donor site	probably benign
R7130:Trio	UTSW	15	27742313	critical splice donor site	probably benign
R7214:Trio	UTSW	15	27871187	missense	probably damaging	0.97
R7292:Trio	UTSW	15	27828351	missense	possibly damaging	0.63
R7293:Trio	UTSW	15	27871289	missense	possibly damaging	0.66
R7352:Trio	UTSW	15	27732876	missense	probably damaging	0.96
R7426:Trio	UTSW	15	27856107	missense	probably benign	0.01
R7451:Trio	UTSW	15	27747913	missense	probably benign	0.07
R7558:Trio	UTSW	15	27831394	missense	possibly damaging	0.90
R7578:Trio	UTSW	15	27854939	missense	possibly damaging	0.94
R7596:Trio	UTSW	15	27749826	missense	probably damaging	0.99
R7604:Trio	UTSW	15	27736445	critical splice donor site	probably null
R7609:Trio	UTSW	15	27912642	missense	unknown
R7767:Trio	UTSW	15	27889418	missense	unknown
R7784:Trio	UTSW	15	27763994	missense	probably damaging	1.00
R7817:Trio	UTSW	15	27749866	missense	probably benign	0.35
R7833:Trio	UTSW	15	27774086	missense	probably damaging	0.99
R7873:Trio	UTSW	15	27805684	missense	possibly damaging	0.83
R7879:Trio	UTSW	15	27851924	missense	possibly damaging	0.94
R7989:Trio	UTSW	15	27772935	missense	probably damaging	0.97
R8022:Trio	UTSW	15	27749866	missense	probably benign	0.35
R8050:Trio	UTSW	15	27891454	missense	unknown
R8217:Trio	UTSW	15	27818969	missense	probably damaging	0.97
R8280:Trio	UTSW	15	27902910	missense	unknown
R8283:Trio	UTSW	15	27756542	missense	possibly damaging	0.79
R8300:Trio	UTSW	15	27855022	missense	possibly damaging	0.66
R8321:Trio	UTSW	15	27881326	missense	possibly damaging	0.90
R8477:Trio	UTSW	15	27773952	missense	possibly damaging	0.83
R8479:Trio	UTSW	15	27901200	missense	probably benign	0.25
R8682:Trio	UTSW	15	27905192	missense	unknown
R8688:Trio	UTSW	15	27748238	missense	possibly damaging	0.61
R8709:Trio	UTSW	15	27919237	missense	unknown
R8713:Trio	UTSW	15	27743951	critical splice donor site	probably benign
R8798:Trio	UTSW	15	27851837	missense	possibly damaging	0.92
R8812:Trio	UTSW	15	27905225	missense	unknown
R8816:Trio	UTSW	15	27741271	missense	probably damaging	0.96
R8828:Trio	UTSW	15	27741064	missense	possibly damaging	0.93
R8987:Trio	UTSW	15	27732687	missense	probably benign	0.23
R9051:Trio	UTSW	15	27732684	missense	possibly damaging	0.78
R9069:Trio	UTSW	15	27852011	missense	possibly damaging	0.83
R9075:Trio	UTSW	15	27773936	nonsense	probably null
R9079:Trio	UTSW	15	27732937	missense	possibly damaging	0.52
R9139:Trio	UTSW	15	27749836	nonsense	probably null
R9494:Trio	UTSW	15	27846757	missense	probably benign	0.00
R9680:Trio	UTSW	15	27744072	missense	possibly damaging	0.93
R9720:Trio	UTSW	15	27847409	missense	probably benign	0.00
R9726:Trio	UTSW	15	27912666	missense	unknown
X0024:Trio	UTSW	15	27765726	missense	possibly damaging	0.91
Z1176:Trio	UTSW	15	27771387	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CTTGGAATGCCATTTCACACG -3'
(R):5'- TCCCAGAGGACTACTTTCAAGG -3'

Sequencing Primer
(F):5'- TGGAATGCCATTTCACACGATGAAC -3'
(R):5'- CTACTTTCAAGGAGTTAGCCAGAAG -3'

Posted On

2021-04-30