Mutagenetix > Incidental Mutations

Incidental Mutation 'R1780:Trio'

197479

Institutional Source

Beutler Lab

Gene Symbol

Trio

Ensembl Gene

ENSMUSG00000022263

Gene Name

triple functional domain (PTPRF interacting)

Synonyms

Solo, 6720464I07Rik

MMRRC Submission

039811-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1780 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

27730651-28025848 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 27744038 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 2603 (C2603R)

Ref Sequence

ENSEMBL: ENSMUSP00000087714 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090247] [ENSMUST00000226644]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000090247
AA Change: C2603R

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000087714
Gene: ENSMUSG00000022263
AA Change: C2603R

Domain	Start	End	E-Value	Type
low complexity region	2	40	N/A	INTRINSIC
SEC14	68	207	3.4e-26	SMART
SPEC	221	337	2.48e-9	SMART
SPEC	343	445	1.92e-15	SMART
SPEC	569	671	5.35e-14	SMART
SPEC	674	783	1.18e-6	SMART
SPEC	910	1011	2.6e-12	SMART
SPEC	1141	1243	7e-18	SMART
low complexity region	1249	1258	N/A	INTRINSIC
RhoGEF	1296	1466	2.79e-53	SMART
PH	1480	1593	1.53e-9	SMART
SH3	1659	1720	1.9e-8	SMART
low complexity region	1788	1802	N/A	INTRINSIC
low complexity region	1837	1863	N/A	INTRINSIC
low complexity region	1936	1954	N/A	INTRINSIC
RhoGEF	1973	2144	1.32e-63	SMART
PH	2158	2273	3.6e-6	SMART
low complexity region	2291	2341	N/A	INTRINSIC
low complexity region	2371	2390	N/A	INTRINSIC
low complexity region	2491	2503	N/A	INTRINSIC
SH3	2558	2619	1.04e0	SMART
low complexity region	2640	2660	N/A	INTRINSIC
IGc2	2701	2770	4e-12	SMART
S_TKc	2800	3054	4.84e-72	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000226644

Predicted Effect

probably benign
Transcript: ENSMUST00000226713

Predicted Effect

probably benign
Transcript: ENSMUST00000227030

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227642

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227999

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228084

Meta Mutation Damage Score

0.2366

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.2%
20x: 92.3%

Validation Efficiency

98% (80/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that functions as a GDP to GTP exchange factor. This protein promotes the reorganization of the actin cytoskeleton, thereby playing a role in cell migration and growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutant mice die during late embryonic development or shortly after birth. They exhibit abnormal skeletal myogenesis and display aberrant organization within the hippocampus and olfactory bulb. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrl2	T	C	3: 148,852,593	E493G	probably damaging	Het
Aff3	A	T	1: 38,535,702	S66T	probably damaging	Het
Ankrd17	T	A	5: 90,232,415	K2470N	probably damaging	Het
Ap3m1	T	C	14: 21,041,070	T156A	probably benign	Het
Arhgef4	T	A	1: 34,724,160	S832R	possibly damaging	Het
Asb10	T	C	5: 24,533,676	D423G	possibly damaging	Het
Ash1l	A	G	3: 88,965,984	T25A	probably benign	Het
Atp13a2	T	A	4: 141,002,460	L663I	possibly damaging	Het
Atp9b	A	T	18: 80,776,897	Y174*	probably null	Het
Bche	A	G	3: 73,700,620	I491T	probably benign	Het
Bckdhb	T	C	9: 83,953,783		probably null	Het
Cadps2	C	T	6: 23,320,932		probably null	Het
Cdc42bpb	A	T	12: 111,322,907	V468E	probably damaging	Het
Chrnd	T	C	1: 87,192,548	V33A	possibly damaging	Het
Col6a5	A	T	9: 105,936,878	V645D	unknown	Het
Cpa1	C	T	6: 30,643,008	L312F	probably damaging	Het
Cyp2a5	A	G	7: 26,841,876		probably benign	Het
Cyp2c39	C	A	19: 39,538,851		probably benign	Het
Cyp2d26	T	C	15: 82,794,007	N56S	probably damaging	Het
Ddx21	A	G	10: 62,594,147		probably benign	Het
Dnah11	A	T	12: 118,027,558	C2358S	probably damaging	Het
Entpd8	T	C	2: 25,084,306	S368P	probably benign	Het
Epg5	A	T	18: 78,023,990	Q2222L	probably damaging	Het
Ercc5	T	A	1: 44,167,796	V623E	probably benign	Het
Flg2	A	G	3: 93,202,999	E778G	unknown	Het
Gbe1	C	T	16: 70,495,324	R515*	probably null	Het
Hsd17b6	A	G	10: 127,994,327		probably null	Het
Hyal6	C	T	6: 24,734,032		probably benign	Het
Ifi27l2b	A	G	12: 103,451,319	I203T	probably damaging	Het
Kcnk9	A	C	15: 72,512,401	D309E	unknown	Het
Lrp6	C	T	6: 134,464,451	R1184Q	probably damaging	Het
Mdn1	T	C	4: 32,700,103	F1399L	probably damaging	Het
Mroh2a	C	T	1: 88,230,680	R150*	probably null	Het
Mx1	T	C	16: 97,451,512	*289W	probably null	Het
Myo7b	T	C	18: 31,961,185	E1970G	probably damaging	Het
Mypn	T	C	10: 63,121,964	Y24C	probably damaging	Het
Naxe	G	C	3: 88,057,133	P167A	probably benign	Het
Nmnat2	A	T	1: 153,112,440	K272*	probably null	Het
Nmnat3	C	T	9: 98,354,111	T19M	probably damaging	Het
Olfr1275	T	C	2: 111,231,698	I32V	probably benign	Het
Olfr1412	G	A	1: 92,588,389	V20M	probably benign	Het
Olfr1474	A	G	19: 13,471,362	T131A	probably benign	Het
Olfr64	A	T	7: 103,893,555	F60Y	probably damaging	Het
Olfr66	A	G	7: 103,881,592	V217A	probably benign	Het
Pgm3	T	G	9: 86,556,204	E509D	probably damaging	Het
Phf3	A	T	1: 30,811,942	D1110E	probably damaging	Het
Pkd1	T	G	17: 24,581,569	S3062A	probably benign	Het
Pogz	A	T	3: 94,870,126	K372N	possibly damaging	Het
Pou1f1	A	G	16: 65,523,470	Y15C	probably benign	Het
Ppfia2	A	G	10: 106,896,507	T972A	possibly damaging	Het
Rasip1	A	G	7: 45,635,318	Y703C	possibly damaging	Het
Recql	T	A	6: 142,364,598	Q502L	probably benign	Het
Rgs9	A	T	11: 109,239,499	Y383*	probably null	Het
Rimbp3	T	C	16: 17,212,632	S1307P	probably benign	Het
Rspo1	A	G	4: 125,007,745	T200A	probably damaging	Het
Ryr3	C	T	2: 112,867,292	M922I	probably damaging	Het
Samm50	C	T	15: 84,211,127	A438V	probably damaging	Het
Sec1	A	C	7: 45,678,832	S264A	probably benign	Het
Sec31a	A	T	5: 100,381,336		probably null	Het
Slc13a3	T	C	2: 165,406,699	N553S	unknown	Het
Smg6	T	A	11: 74,946,116	L852Q	probably damaging	Het
Spata13	A	G	14: 60,691,725	N244S	probably damaging	Het
Srbd1	T	C	17: 86,057,685	R648G	probably damaging	Het
Sugct	T	G	13: 17,452,454		probably null	Het
Tmed10	A	G	12: 85,354,879	Y85H	probably damaging	Het
Trim68	A	G	7: 102,684,073	I134T	possibly damaging	Het
Tspyl3	G	A	2: 153,225,256	R21W	probably damaging	Het
Ttn	T	C	2: 76,810,699	I11863V	probably null	Het
Ubp1	G	A	9: 113,964,579	A283T	possibly damaging	Het
Ubtf	A	T	11: 102,314,918	F60L	probably damaging	Het
Vmn1r235	T	C	17: 21,261,737	I108T	probably benign	Het
Vmn2r125	T	C	4: 156,351,373	S349P	probably damaging	Het
Vmn2r25	A	G	6: 123,828,465	S478P	probably damaging	Het
Vmn2r88	T	A	14: 51,418,572	V746D	probably damaging	Het
Zcwpw1	A	G	5: 137,796,652	K37E	probably damaging	Het
Zdhhc24	T	C	19: 4,883,766	S284P	probably damaging	Het
Zswim8	C	A	14: 20,716,327	H841N	probably damaging	Het

Other mutations in Trio

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00480:Trio	APN	15	27912743	splice site	probably benign
IGL01011:Trio	APN	15	27736489	missense	probably damaging	0.96
IGL01090:Trio	APN	15	27773007	missense	probably damaging	1.00
IGL01145:Trio	APN	15	27818167	splice site	probably benign
IGL01147:Trio	APN	15	27881320	missense	probably damaging	1.00
IGL01161:Trio	APN	15	27749781	missense	probably damaging	1.00
IGL01324:Trio	APN	15	27905323	missense	probably benign	0.42
IGL01352:Trio	APN	15	27901229	missense	probably benign	0.01
IGL01366:Trio	APN	15	27732868	missense	possibly damaging	0.76
IGL01443:Trio	APN	15	27838775	splice site	probably benign
IGL01454:Trio	APN	15	27832985	missense	probably benign	0.32
IGL01695:Trio	APN	15	27773001	missense	probably damaging	1.00
IGL01765:Trio	APN	15	27764026	missense	possibly damaging	0.85
IGL01860:Trio	APN	15	27846810	missense	probably damaging	1.00
IGL01879:Trio	APN	15	27741033	missense	probably benign	0.12
IGL01991:Trio	APN	15	27871274	missense	possibly damaging	0.95
IGL02106:Trio	APN	15	27744158	missense	possibly damaging	0.85
IGL02209:Trio	APN	15	27744053	missense	probably damaging	1.00
IGL02232:Trio	APN	15	27902561	missense	probably benign	0.24
IGL02304:Trio	APN	15	27735436	missense	probably damaging	0.96
IGL02504:Trio	APN	15	27847390	nonsense	probably null
IGL02508:Trio	APN	15	27818104	missense	possibly damaging	0.65
IGL02541:Trio	APN	15	27844930	splice site	probably benign
IGL02617:Trio	APN	15	27841849	splice site	probably benign
IGL02675:Trio	APN	15	27768039	unclassified	probably benign
IGL02817:Trio	APN	15	27902881	missense	probably benign	0.01
IGL02993:Trio	APN	15	27830239	splice site	probably benign
IGL03007:Trio	APN	15	27902742	missense	probably damaging	0.99
IGL03135:Trio	APN	15	27832011	splice site	probably benign
IGL03225:Trio	APN	15	27902695	missense	probably benign	0.30
R0063:Trio	UTSW	15	27881437	splice site	probably benign
R0063:Trio	UTSW	15	27881437	splice site	probably benign
R0302:Trio	UTSW	15	27902517	missense	probably damaging	1.00
R0505:Trio	UTSW	15	27767907	missense	probably benign	0.00
R0506:Trio	UTSW	15	27854963	missense	probably benign	0.12
R0564:Trio	UTSW	15	27805822	missense	probably damaging	1.00
R0659:Trio	UTSW	15	27831399	missense	probably damaging	0.97
R0882:Trio	UTSW	15	27732894	missense	probably damaging	1.00
R0939:Trio	UTSW	15	27741250	critical splice donor site	probably null
R1018:Trio	UTSW	15	27871171	missense	probably damaging	1.00
R1439:Trio	UTSW	15	27897914	missense	probably damaging	1.00
R1456:Trio	UTSW	15	27753804	splice site	probably benign
R1488:Trio	UTSW	15	27740967	missense	probably damaging	1.00
R1522:Trio	UTSW	15	27732640	missense	probably benign	0.28
R1531:Trio	UTSW	15	27832985	missense	probably benign	0.32
R1640:Trio	UTSW	15	27833044	missense	probably damaging	1.00
R1646:Trio	UTSW	15	27758347	missense	possibly damaging	0.91
R1682:Trio	UTSW	15	27744146	splice site	probably null
R1791:Trio	UTSW	15	27841756	missense	probably damaging	1.00
R1803:Trio	UTSW	15	27748340	missense	probably benign
R1817:Trio	UTSW	15	27742495	nonsense	probably null
R1853:Trio	UTSW	15	27756536	missense	probably damaging	1.00
R1898:Trio	UTSW	15	27742380	missense	possibly damaging	0.52
R1937:Trio	UTSW	15	27833056	missense	probably damaging	1.00
R1938:Trio	UTSW	15	27732891	missense	probably damaging	0.98
R2025:Trio	UTSW	15	27744137	missense	probably damaging	0.99
R2025:Trio	UTSW	15	27773927	missense	probably damaging	1.00
R2050:Trio	UTSW	15	27851945	missense	possibly damaging	0.85
R2186:Trio	UTSW	15	27823975	splice site	probably null
R2913:Trio	UTSW	15	27854912	missense	probably damaging	1.00
R3151:Trio	UTSW	15	27805776	missense	probably damaging	1.00
R3771:Trio	UTSW	15	27748091	missense	probably damaging	0.98
R3773:Trio	UTSW	15	27748091	missense	probably damaging	0.98
R3826:Trio	UTSW	15	27833070	missense	probably damaging	1.00
R4015:Trio	UTSW	15	27744101	missense	possibly damaging	0.71
R4359:Trio	UTSW	15	27749797	nonsense	probably null
R4370:Trio	UTSW	15	27748337	nonsense	probably null
R4547:Trio	UTSW	15	27818982	missense	possibly damaging	0.89
R4573:Trio	UTSW	15	27772998	small deletion	probably benign
R4620:Trio	UTSW	15	27871171	missense	probably damaging	1.00
R4735:Trio	UTSW	15	27752789	splice site	probably null
R4764:Trio	UTSW	15	27732538	nonsense	probably null
R4775:Trio	UTSW	15	27881342	nonsense	probably null
R4942:Trio	UTSW	15	27752725	missense	probably benign	0.21
R5004:Trio	UTSW	15	27755178	missense	probably damaging	1.00
R5149:Trio	UTSW	15	27754029	missense	possibly damaging	0.74
R5183:Trio	UTSW	15	27902600	missense	probably benign	0.00
R5186:Trio	UTSW	15	27897991	missense	probably damaging	0.97
R5268:Trio	UTSW	15	27748286	missense	probably benign	0.02
R5344:Trio	UTSW	15	27735532	missense	probably benign	0.12
R5407:Trio	UTSW	15	27844806	splice site	probably null
R5442:Trio	UTSW	15	27856194	missense	probably benign	0.04
R5617:Trio	UTSW	15	27902748	missense	probably benign
R5778:Trio	UTSW	15	27856164	missense	probably benign	0.33
R5986:Trio	UTSW	15	27851933	missense	possibly damaging	0.88
R5990:Trio	UTSW	15	27891459	missense	probably benign	0.10
R6011:Trio	UTSW	15	27735545	missense	probably damaging	0.98
R6063:Trio	UTSW	15	27891379	missense	possibly damaging	0.94
R6166:Trio	UTSW	15	27818071	missense	probably damaging	0.96
R6187:Trio	UTSW	15	27743952	critical splice donor site	probably null
R6387:Trio	UTSW	15	27752739	missense	probably damaging	1.00
R6402:Trio	UTSW	15	27902911	missense	probably benign	0.02
R6478:Trio	UTSW	15	27856107	missense	probably benign	0.01
R6528:Trio	UTSW	15	27805870	missense	probably damaging	1.00
R6662:Trio	UTSW	15	27854996	missense	probably benign	0.00
R6825:Trio	UTSW	15	27889308	missense	probably damaging	0.98
R6890:Trio	UTSW	15	27919288	unclassified	probably benign
R6945:Trio	UTSW	15	27824090	missense	probably damaging	1.00
R7027:Trio	UTSW	15	27805654	missense	possibly damaging	0.86
R7046:Trio	UTSW	15	27832051	missense	probably damaging	1.00
R7049:Trio	UTSW	15	27749799	missense	possibly damaging	0.66
R7075:Trio	UTSW	15	27898000	missense	unknown
R7094:Trio	UTSW	15	27891448	missense	unknown
R7123:Trio	UTSW	15	27742313	critical splice donor site	probably benign
R7130:Trio	UTSW	15	27742313	critical splice donor site	probably benign
R7214:Trio	UTSW	15	27871187	missense	probably damaging	0.97
R7292:Trio	UTSW	15	27828351	missense	possibly damaging	0.63
R7293:Trio	UTSW	15	27871289	missense	possibly damaging	0.66
R7352:Trio	UTSW	15	27732876	missense	probably damaging	0.96
R7426:Trio	UTSW	15	27856107	missense	probably benign	0.01
R7451:Trio	UTSW	15	27747913	missense	probably benign	0.07
R7558:Trio	UTSW	15	27831394	missense	possibly damaging	0.90
R7578:Trio	UTSW	15	27854939	missense	possibly damaging	0.94
R7596:Trio	UTSW	15	27749826	missense	probably damaging	0.99
R7604:Trio	UTSW	15	27736445	critical splice donor site	probably null
R7609:Trio	UTSW	15	27912642	missense	unknown
R7767:Trio	UTSW	15	27889418	missense	unknown
R7784:Trio	UTSW	15	27763994	missense	probably damaging	1.00
R7817:Trio	UTSW	15	27749866	missense	probably benign	0.35
R7833:Trio	UTSW	15	27774086	missense	probably damaging	0.99
R7873:Trio	UTSW	15	27805684	missense	possibly damaging	0.83
R7879:Trio	UTSW	15	27851924	missense	possibly damaging	0.94
R7989:Trio	UTSW	15	27772935	missense	probably damaging	0.97
R8022:Trio	UTSW	15	27749866	missense	probably benign	0.35
R8050:Trio	UTSW	15	27891454	missense	unknown
R8217:Trio	UTSW	15	27818969	missense	probably damaging	0.97
R8280:Trio	UTSW	15	27902910	missense	unknown
R8283:Trio	UTSW	15	27756542	missense	possibly damaging	0.79
R8300:Trio	UTSW	15	27855022	missense	possibly damaging	0.66
R8321:Trio	UTSW	15	27881326	missense	possibly damaging	0.90
X0024:Trio	UTSW	15	27765726	missense	possibly damaging	0.91
Z1176:Trio	UTSW	15	27771387	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CAGCCTGTGAATGACGATCCTGTG -3'
(R):5'- AGGCAGCAGCAGTAGCAACATC -3'

Sequencing Primer
(F):5'- AATGACGATCCTGTGTCTCTCAAG -3'
(R):5'- ATCTCCACCATGCTGGTGAC -3'

Posted On

2014-05-23