Mutagenetix > Incidental Mutation

Incidental Mutation 'R1906:Dnah10'

214363

Institutional Source

Beutler Lab

Gene Symbol

Dnah10

Ensembl Gene

ENSMUSG00000038011

Gene Name

dynein, axonemal, heavy chain 10

Synonyms

Dnahc10

MMRRC Submission

039925-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1906 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

124802149-124911372 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 124878048 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 2654 (V2654D)

Ref Sequence

ENSEMBL: ENSMUSP00000114593 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058440] [ENSMUST00000141137]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000058440
AA Change: V2711D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000062995
Gene: ENSMUSG00000038011
AA Change: V2711D

Domain	Start	End	E-Value	Type
low complexity region	63	72	N/A	INTRINSIC
low complexity region	80	86	N/A	INTRINSIC
coiled coil region	260	282	N/A	INTRINSIC
Pfam:DHC_N1	305	878	9.1e-154	PFAM
coiled coil region	1191	1218	N/A	INTRINSIC
coiled coil region	1337	1360	N/A	INTRINSIC
Pfam:DHC_N2	1374	1782	1.7e-142	PFAM
AAA	1946	2082	2.51e-1	SMART
AAA	2225	2373	6.91e-1	SMART
low complexity region	2444	2464	N/A	INTRINSIC
AAA	2567	2720	2.29e-2	SMART
Pfam:AAA_8	2886	3153	9.8e-87	PFAM
Pfam:MT	3165	3502	9.1e-53	PFAM
Pfam:AAA_9	3522	3747	2.3e-90	PFAM
Pfam:Dynein_heavy	3884	4588	7.6e-240	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126998

Predicted Effect

probably damaging
Transcript: ENSMUST00000141137
AA Change: V2654D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000114593
Gene: ENSMUSG00000038011
AA Change: V2654D

Domain	Start	End	E-Value	Type
low complexity region	63	72	N/A	INTRINSIC
low complexity region	80	86	N/A	INTRINSIC
coiled coil region	260	282	N/A	INTRINSIC
Pfam:DHC_N1	304	607	4.3e-57	PFAM
Pfam:DHC_N1	598	823	1.2e-39	PFAM
coiled coil region	1134	1161	N/A	INTRINSIC
coiled coil region	1280	1303	N/A	INTRINSIC
Pfam:DHC_N2	1315	1727	7.3e-135	PFAM
AAA	1889	2025	4e-3	SMART
AAA	2168	2316	1.1e-2	SMART
low complexity region	2387	2407	N/A	INTRINSIC
AAA	2510	2663	3.6e-4	SMART
Pfam:AAA_8	2829	3096	2.5e-83	PFAM
Pfam:MT	3108	3445	1.2e-50	PFAM
Pfam:AAA_9	3461	3691	6.7e-59	PFAM
Pfam:Dynein_heavy	3821	4532	1.9e-231	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196708

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197824

Coding Region Coverage

1x: 97.3%
3x: 96.7%
10x: 94.9%
20x: 91.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. The axonemal dyneins, found in cilia and flagella, are components of the outer and inner dynein arms attached to the peripheral microtubule doublets. DNAH10 is an inner arm dynein heavy chain (Maiti et al., 2000 [PubMed 11175280]).[supplied by OMIM, Mar 2008]

Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aass	G	A	6: 23,072,984 (GRCm39)	T923I	probably benign	Het
Abhd13	T	A	8: 10,038,170 (GRCm39)	C256S	probably benign	Het
Adamts5	C	T	16: 85,665,573 (GRCm39)	W576*	probably null	Het
Adnp	A	T	2: 168,024,287 (GRCm39)	S1003T	probably benign	Het
AI987944	C	T	7: 41,024,550 (GRCm39)	R146Q	probably benign	Het
Apol6	G	T	15: 76,935,060 (GRCm39)	V110F	probably damaging	Het
Arhgap27	A	G	11: 103,223,751 (GRCm39)	F651L	probably damaging	Het
Atm	T	C	9: 53,417,868 (GRCm39)	D813G	probably damaging	Het
Casd1	T	A	6: 4,641,979 (GRCm39)	I752N	probably damaging	Het
Cdr2	A	G	7: 120,581,224 (GRCm39)	Y18H	probably damaging	Het
Cntn4	T	C	6: 106,330,607 (GRCm39)	F75S	probably benign	Het
Col20a1	G	A	2: 180,640,490 (GRCm39)	R549H	probably benign	Het
Col28a1	A	T	6: 7,999,644 (GRCm39)	N1024K	probably benign	Het
Dnph1	A	T	17: 46,807,787 (GRCm39)	I18F	probably damaging	Het
Dsn1	G	A	2: 156,838,163 (GRCm39)	R334W	probably damaging	Het
Egf	T	A	3: 129,518,873 (GRCm39)	K325N	probably benign	Het
Eps15	T	G	4: 109,181,398 (GRCm39)	S311A	possibly damaging	Het
Fmo3	G	T	1: 162,794,475 (GRCm39)	D198E	probably damaging	Het
Folh1	C	G	7: 86,391,374 (GRCm39)		probably null	Het
Foxn1	A	G	11: 78,262,636 (GRCm39)		probably null	Het
Gm10604	T	G	4: 11,979,989 (GRCm39)	D105A	unknown	Het
Gpx8	A	G	13: 113,182,110 (GRCm39)	C108R	probably damaging	Het
Herc2	A	T	7: 55,764,612 (GRCm39)	I1013L	probably benign	Het
Hyal4	T	G	6: 24,756,110 (GRCm39)	N109K	probably damaging	Het
Il22ra1	T	G	4: 135,478,544 (GRCm39)	C538W	probably damaging	Het
Ints13	A	T	6: 146,453,868 (GRCm39)		probably null	Het
Krt75	T	A	15: 101,481,801 (GRCm39)	T156S	possibly damaging	Het
Lama2	A	C	10: 26,932,523 (GRCm39)		probably null	Het
Lifr	G	T	15: 7,217,612 (GRCm39)	V847L	probably damaging	Het
Lmf1	T	A	17: 25,831,309 (GRCm39)	I185N	probably damaging	Het
Mast1	G	A	8: 85,642,895 (GRCm39)	R967C	probably damaging	Het
Ms4a15	T	C	19: 10,960,644 (GRCm39)	I94V	probably benign	Het
Mycbpap	A	T	11: 94,396,447 (GRCm39)	M131K	probably benign	Het
Ncor1	A	T	11: 62,240,211 (GRCm39)	M920K	possibly damaging	Het
Neb	A	G	2: 52,198,538 (GRCm39)	Y437H	probably damaging	Het
Npy5r	A	T	8: 67,134,125 (GRCm39)	W223R	probably damaging	Het
Or10ak11	G	A	4: 118,687,467 (GRCm39)	H56Y	probably damaging	Het
Or10x4	C	A	1: 174,218,730 (GRCm39)	L32M	probably damaging	Het
Or4c114	A	G	2: 88,905,414 (GRCm39)	V7A	possibly damaging	Het
Or6c6c	T	G	10: 129,541,365 (GRCm39)	V206G	probably benign	Het
Polg	T	C	7: 79,110,070 (GRCm39)	K353E	probably damaging	Het
Proz	C	G	8: 13,123,686 (GRCm39)		probably null	Het
Pus7	T	C	5: 23,983,209 (GRCm39)	D86G	probably damaging	Het
Rhpn1	T	C	15: 75,583,673 (GRCm39)	V386A	probably benign	Het
Rigi	T	C	4: 40,206,054 (GRCm39)	K846R	probably benign	Het
Sptbn4	A	G	7: 27,090,856 (GRCm39)		probably null	Het
Srp68	A	T	11: 116,141,587 (GRCm39)	I424N	probably damaging	Het
Stard9	A	G	2: 120,526,908 (GRCm39)	E1055G	probably benign	Het
Taf4b	A	G	18: 14,955,159 (GRCm39)	I571V	probably benign	Het
Tas2r107	T	C	6: 131,636,951 (GRCm39)	M33V	probably benign	Het
Thap12	T	C	7: 98,365,947 (GRCm39)	L705P	probably damaging	Het
Tom1	T	C	8: 75,778,218 (GRCm39)	V100A	probably damaging	Het
Tox3	A	G	8: 90,975,057 (GRCm39)		probably benign	Het
Vmn2r82	A	G	10: 79,232,344 (GRCm39)	N781S	probably damaging	Het
Vwa5b1	A	T	4: 138,327,547 (GRCm39)	V343E	possibly damaging	Het
Zbbx	A	G	3: 74,979,047 (GRCm39)	Y467H	probably damaging	Het
Zbtb46	G	A	2: 181,065,632 (GRCm39)	R173W	probably damaging	Het
Zfp112	A	G	7: 23,821,720 (GRCm39)	D20G	probably benign	Het
Zfp777	A	C	6: 48,018,995 (GRCm39)	M313R	probably damaging	Het

Other mutations in Dnah10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Dnah10	APN	5	124,905,667 (GRCm39)	missense	probably damaging	1.00
IGL00089:Dnah10	APN	5	124,823,680 (GRCm39)	missense	probably benign	0.01
IGL00471:Dnah10	APN	5	124,871,405 (GRCm39)	missense	probably damaging	1.00
IGL01336:Dnah10	APN	5	124,852,576 (GRCm39)	missense	probably damaging	1.00
IGL01339:Dnah10	APN	5	124,854,276 (GRCm39)	missense	probably damaging	1.00
IGL01372:Dnah10	APN	5	124,856,218 (GRCm39)	missense	probably damaging	1.00
IGL01572:Dnah10	APN	5	124,861,010 (GRCm39)	missense	probably damaging	1.00
IGL01634:Dnah10	APN	5	124,898,405 (GRCm39)	missense	probably damaging	0.98
IGL01649:Dnah10	APN	5	124,809,553 (GRCm39)	missense	probably damaging	0.97
IGL01676:Dnah10	APN	5	124,880,392 (GRCm39)	missense	possibly damaging	0.65
IGL01729:Dnah10	APN	5	124,864,529 (GRCm39)	missense	probably benign	0.10
IGL01757:Dnah10	APN	5	124,845,991 (GRCm39)	missense	probably benign	0.37
IGL01759:Dnah10	APN	5	124,832,850 (GRCm39)	missense	probably benign
IGL01767:Dnah10	APN	5	124,820,801 (GRCm39)	splice site	probably benign
IGL01769:Dnah10	APN	5	124,842,008 (GRCm39)	missense	possibly damaging	0.63
IGL01805:Dnah10	APN	5	124,860,985 (GRCm39)	missense	probably damaging	1.00
IGL02090:Dnah10	APN	5	124,866,876 (GRCm39)	missense	probably damaging	1.00
IGL02162:Dnah10	APN	5	124,881,810 (GRCm39)	missense	probably damaging	1.00
IGL02312:Dnah10	APN	5	124,896,430 (GRCm39)	missense	probably damaging	1.00
IGL02347:Dnah10	APN	5	124,910,487 (GRCm39)	critical splice acceptor site	probably null
IGL02378:Dnah10	APN	5	124,850,131 (GRCm39)	missense	probably damaging	1.00
IGL02440:Dnah10	APN	5	124,850,883 (GRCm39)	missense	probably damaging	1.00
IGL02457:Dnah10	APN	5	124,866,860 (GRCm39)	missense	probably damaging	1.00
IGL02487:Dnah10	APN	5	124,870,916 (GRCm39)	missense	possibly damaging	0.90
IGL02502:Dnah10	APN	5	124,898,351 (GRCm39)	missense	probably damaging	1.00
IGL02516:Dnah10	APN	5	124,864,395 (GRCm39)	missense	probably damaging	1.00
IGL02544:Dnah10	APN	5	124,876,069 (GRCm39)	missense	probably benign	0.26
IGL02709:Dnah10	APN	5	124,850,809 (GRCm39)	nonsense	probably null
IGL02740:Dnah10	APN	5	124,903,927 (GRCm39)	splice site	probably benign
IGL02746:Dnah10	APN	5	124,807,150 (GRCm39)	missense	possibly damaging	0.55
IGL02803:Dnah10	APN	5	124,875,078 (GRCm39)	missense	probably damaging	0.99
IGL02900:Dnah10	APN	5	124,878,886 (GRCm39)	missense	probably damaging	1.00
IGL02957:Dnah10	APN	5	124,840,197 (GRCm39)	missense	probably benign	0.07
IGL03076:Dnah10	APN	5	124,807,226 (GRCm39)	critical splice donor site	probably null
IGL03109:Dnah10	APN	5	124,841,950 (GRCm39)	missense	probably benign	0.10
IGL03181:Dnah10	APN	5	124,825,521 (GRCm39)	missense	probably damaging	0.99
IGL03185:Dnah10	APN	5	124,894,707 (GRCm39)	missense	probably damaging	1.00
IGL03199:Dnah10	APN	5	124,894,761 (GRCm39)	missense	probably benign	0.00
IGL03328:Dnah10	APN	5	124,831,354 (GRCm39)	missense	probably benign	0.06
frosty	UTSW	5	124,905,201 (GRCm39)	missense	probably damaging	1.00
H8562:Dnah10	UTSW	5	124,906,593 (GRCm39)	missense	probably damaging	1.00
I2288:Dnah10	UTSW	5	124,807,164 (GRCm39)	missense	probably benign
P0019:Dnah10	UTSW	5	124,840,130 (GRCm39)	missense	probably benign
P0037:Dnah10	UTSW	5	124,895,056 (GRCm39)	nonsense	probably null
PIT4366001:Dnah10	UTSW	5	124,852,588 (GRCm39)	missense	possibly damaging	0.95
R0004:Dnah10	UTSW	5	124,803,966 (GRCm39)	missense	probably benign
R0032:Dnah10	UTSW	5	124,877,955 (GRCm39)	missense	possibly damaging	0.94
R0032:Dnah10	UTSW	5	124,877,955 (GRCm39)	missense	possibly damaging	0.94
R0050:Dnah10	UTSW	5	124,907,808 (GRCm39)	missense	probably benign	0.00
R0066:Dnah10	UTSW	5	124,840,140 (GRCm39)	missense	probably benign	0.01
R0164:Dnah10	UTSW	5	124,860,898 (GRCm39)	missense	probably damaging	1.00
R0164:Dnah10	UTSW	5	124,860,898 (GRCm39)	missense	probably damaging	1.00
R0196:Dnah10	UTSW	5	124,911,139 (GRCm39)	missense	possibly damaging	0.80
R0312:Dnah10	UTSW	5	124,873,433 (GRCm39)	splice site	probably benign
R0321:Dnah10	UTSW	5	124,900,416 (GRCm39)	missense	probably benign	0.29
R0410:Dnah10	UTSW	5	124,832,799 (GRCm39)	missense	probably benign
R0480:Dnah10	UTSW	5	124,885,915 (GRCm39)	missense	probably damaging	1.00
R0531:Dnah10	UTSW	5	124,889,787 (GRCm39)	critical splice donor site	probably null
R0533:Dnah10	UTSW	5	124,852,314 (GRCm39)	splice site	probably null
R0599:Dnah10	UTSW	5	124,878,017 (GRCm39)	missense	probably damaging	1.00
R0686:Dnah10	UTSW	5	124,824,782 (GRCm39)	missense	possibly damaging	0.95
R0688:Dnah10	UTSW	5	124,824,782 (GRCm39)	missense	possibly damaging	0.95
R0780:Dnah10	UTSW	5	124,827,876 (GRCm39)	missense	possibly damaging	0.87
R0968:Dnah10	UTSW	5	124,906,641 (GRCm39)	missense	probably damaging	0.99
R0989:Dnah10	UTSW	5	124,875,002 (GRCm39)	missense	probably benign	0.00
R1203:Dnah10	UTSW	5	124,837,078 (GRCm39)	splice site	probably null
R1248:Dnah10	UTSW	5	124,832,887 (GRCm39)	splice site	probably benign
R1366:Dnah10	UTSW	5	124,830,390 (GRCm39)	missense	probably benign	0.41
R1434:Dnah10	UTSW	5	124,852,050 (GRCm39)	missense	probably benign	0.03
R1436:Dnah10	UTSW	5	124,839,285 (GRCm39)	missense	probably benign	0.00
R1438:Dnah10	UTSW	5	124,876,009 (GRCm39)	missense	probably benign	0.25
R1446:Dnah10	UTSW	5	124,866,860 (GRCm39)	missense	probably damaging	1.00
R1459:Dnah10	UTSW	5	124,820,750 (GRCm39)	missense	possibly damaging	0.90
R1466:Dnah10	UTSW	5	124,840,160 (GRCm39)	missense	probably benign
R1466:Dnah10	UTSW	5	124,840,160 (GRCm39)	missense	probably benign
R1479:Dnah10	UTSW	5	124,854,953 (GRCm39)	missense	possibly damaging	0.71
R1505:Dnah10	UTSW	5	124,831,303 (GRCm39)	missense	possibly damaging	0.82
R1519:Dnah10	UTSW	5	124,838,016 (GRCm39)	missense	probably damaging	0.98
R1565:Dnah10	UTSW	5	124,906,678 (GRCm39)	missense	probably damaging	1.00
R1668:Dnah10	UTSW	5	124,842,626 (GRCm39)	missense	probably benign	0.00
R1709:Dnah10	UTSW	5	124,837,155 (GRCm39)	missense	probably damaging	0.99
R1740:Dnah10	UTSW	5	124,850,254 (GRCm39)	splice site	probably null
R1828:Dnah10	UTSW	5	124,838,343 (GRCm39)	missense	probably benign	0.00
R1854:Dnah10	UTSW	5	124,881,753 (GRCm39)	missense	probably damaging	0.99
R1865:Dnah10	UTSW	5	124,909,590 (GRCm39)	splice site	probably null
R1893:Dnah10	UTSW	5	124,831,381 (GRCm39)	missense	probably benign	0.13
R1895:Dnah10	UTSW	5	124,835,494 (GRCm39)	missense	probably benign	0.00
R1953:Dnah10	UTSW	5	124,859,332 (GRCm39)	missense	probably benign	0.00
R1965:Dnah10	UTSW	5	124,852,267 (GRCm39)	missense	probably damaging	1.00
R2002:Dnah10	UTSW	5	124,911,052 (GRCm39)	missense	probably damaging	1.00
R2006:Dnah10	UTSW	5	124,906,651 (GRCm39)	missense	possibly damaging	0.58
R2037:Dnah10	UTSW	5	124,823,768 (GRCm39)	missense	probably benign	0.30
R2046:Dnah10	UTSW	5	124,873,405 (GRCm39)	missense	probably benign	0.25
R2074:Dnah10	UTSW	5	124,891,738 (GRCm39)	missense	probably damaging	1.00
R2081:Dnah10	UTSW	5	124,852,045 (GRCm39)	missense	possibly damaging	0.88
R2257:Dnah10	UTSW	5	124,838,301 (GRCm39)	missense	probably damaging	1.00
R2272:Dnah10	UTSW	5	124,808,530 (GRCm39)	missense	probably benign	0.00
R2293:Dnah10	UTSW	5	124,896,285 (GRCm39)	missense	probably damaging	0.97
R2323:Dnah10	UTSW	5	124,819,064 (GRCm39)	missense	probably damaging	1.00
R2435:Dnah10	UTSW	5	124,839,929 (GRCm39)	critical splice donor site	probably null
R2571:Dnah10	UTSW	5	124,852,542 (GRCm39)	missense	probably damaging	1.00
R2898:Dnah10	UTSW	5	124,894,734 (GRCm39)	missense	probably damaging	1.00
R2937:Dnah10	UTSW	5	124,896,476 (GRCm39)	critical splice donor site	probably null
R3439:Dnah10	UTSW	5	124,873,322 (GRCm39)	missense	possibly damaging	0.91
R3548:Dnah10	UTSW	5	124,824,694 (GRCm39)	missense	possibly damaging	0.50
R3881:Dnah10	UTSW	5	124,850,095 (GRCm39)	missense	probably benign	0.37
R4015:Dnah10	UTSW	5	124,854,990 (GRCm39)	missense	probably benign	0.25
R4261:Dnah10	UTSW	5	124,807,201 (GRCm39)	missense	possibly damaging	0.95
R4277:Dnah10	UTSW	5	124,809,394 (GRCm39)	missense	probably benign	0.28
R4299:Dnah10	UTSW	5	124,896,989 (GRCm39)	missense	probably damaging	1.00
R4613:Dnah10	UTSW	5	124,839,933 (GRCm39)	splice site	probably null
R4651:Dnah10	UTSW	5	124,806,207 (GRCm39)	missense	probably benign	0.20
R4652:Dnah10	UTSW	5	124,806,207 (GRCm39)	missense	probably benign	0.20
R4664:Dnah10	UTSW	5	124,905,536 (GRCm39)	missense	possibly damaging	0.95
R4665:Dnah10	UTSW	5	124,905,536 (GRCm39)	missense	possibly damaging	0.95
R4666:Dnah10	UTSW	5	124,905,536 (GRCm39)	missense	possibly damaging	0.95
R4691:Dnah10	UTSW	5	124,852,581 (GRCm39)	missense	probably damaging	1.00
R4755:Dnah10	UTSW	5	124,824,809 (GRCm39)	missense	probably benign	0.01
R4806:Dnah10	UTSW	5	124,896,408 (GRCm39)	missense	probably damaging	1.00
R4839:Dnah10	UTSW	5	124,850,196 (GRCm39)	missense	probably damaging	1.00
R4903:Dnah10	UTSW	5	124,894,812 (GRCm39)	missense	probably damaging	1.00
R5018:Dnah10	UTSW	5	124,839,260 (GRCm39)	missense	possibly damaging	0.79
R5101:Dnah10	UTSW	5	124,909,577 (GRCm39)	missense	possibly damaging	0.51
R5105:Dnah10	UTSW	5	124,888,546 (GRCm39)	missense	probably benign	0.01
R5119:Dnah10	UTSW	5	124,856,322 (GRCm39)	missense	probably damaging	1.00
R5139:Dnah10	UTSW	5	124,876,024 (GRCm39)	missense	probably damaging	0.99
R5242:Dnah10	UTSW	5	124,864,484 (GRCm39)	missense	probably benign	0.00
R5262:Dnah10	UTSW	5	124,862,220 (GRCm39)	missense	probably damaging	1.00
R5277:Dnah10	UTSW	5	124,905,201 (GRCm39)	missense	probably damaging	1.00
R5293:Dnah10	UTSW	5	124,868,851 (GRCm39)	missense	probably benign	0.01
R5322:Dnah10	UTSW	5	124,850,630 (GRCm39)	missense	probably damaging	1.00
R5371:Dnah10	UTSW	5	124,820,693 (GRCm39)	missense	probably benign	0.16
R5468:Dnah10	UTSW	5	124,907,557 (GRCm39)	missense	probably damaging	1.00
R5470:Dnah10	UTSW	5	124,830,232 (GRCm39)	missense	probably benign
R5587:Dnah10	UTSW	5	124,870,977 (GRCm39)	missense	probably benign	0.10
R5724:Dnah10	UTSW	5	124,819,090 (GRCm39)	missense	probably benign	0.27
R5797:Dnah10	UTSW	5	124,898,450 (GRCm39)	missense	probably benign	0.00
R5812:Dnah10	UTSW	5	124,824,810 (GRCm39)	missense	probably benign	0.01
R5846:Dnah10	UTSW	5	124,900,437 (GRCm39)	missense	possibly damaging	0.80
R5930:Dnah10	UTSW	5	124,868,855 (GRCm39)	critical splice donor site	probably null
R5961:Dnah10	UTSW	5	124,888,546 (GRCm39)	missense	probably benign	0.01
R5970:Dnah10	UTSW	5	124,885,793 (GRCm39)	missense	probably benign
R6021:Dnah10	UTSW	5	124,814,048 (GRCm39)	missense	probably damaging	1.00
R6043:Dnah10	UTSW	5	124,878,924 (GRCm39)	missense	probably damaging	1.00
R6073:Dnah10	UTSW	5	124,896,274 (GRCm39)	missense	probably benign	0.09
R6080:Dnah10	UTSW	5	124,882,961 (GRCm39)	missense	possibly damaging	0.71
R6093:Dnah10	UTSW	5	124,830,238 (GRCm39)	missense	probably benign	0.18
R6155:Dnah10	UTSW	5	124,862,239 (GRCm39)	missense	probably damaging	1.00
R6155:Dnah10	UTSW	5	124,847,663 (GRCm39)	missense	probably damaging	1.00
R6162:Dnah10	UTSW	5	124,900,382 (GRCm39)	missense	probably benign	0.02
R6238:Dnah10	UTSW	5	124,820,743 (GRCm39)	missense	probably damaging	0.97
R6248:Dnah10	UTSW	5	124,871,283 (GRCm39)	splice site	probably null
R6275:Dnah10	UTSW	5	124,862,248 (GRCm39)	missense	probably damaging	1.00
R6297:Dnah10	UTSW	5	124,852,144 (GRCm39)	missense	possibly damaging	0.55
R6388:Dnah10	UTSW	5	124,906,710 (GRCm39)	missense	probably benign	0.00
R6458:Dnah10	UTSW	5	124,886,333 (GRCm39)	missense	probably damaging	1.00
R6504:Dnah10	UTSW	5	124,839,846 (GRCm39)	missense	possibly damaging	0.50
R6518:Dnah10	UTSW	5	124,835,419 (GRCm39)	missense	probably damaging	0.99
R6627:Dnah10	UTSW	5	124,907,097 (GRCm39)	missense	probably damaging	1.00
R6701:Dnah10	UTSW	5	124,837,223 (GRCm39)	missense	probably benign	0.45
R6702:Dnah10	UTSW	5	124,882,869 (GRCm39)	missense	probably damaging	1.00
R6745:Dnah10	UTSW	5	124,885,876 (GRCm39)	missense	probably damaging	1.00
R6784:Dnah10	UTSW	5	124,854,890 (GRCm39)	missense	probably damaging	0.99
R6807:Dnah10	UTSW	5	124,867,064 (GRCm39)	splice site	probably null
R6932:Dnah10	UTSW	5	124,898,514 (GRCm39)	missense	possibly damaging	0.75
R7007:Dnah10	UTSW	5	124,864,490 (GRCm39)	missense	probably damaging	1.00
R7091:Dnah10	UTSW	5	124,893,206 (GRCm39)	missense	probably benign	0.37
R7138:Dnah10	UTSW	5	124,900,009 (GRCm39)	missense	probably damaging	1.00
R7144:Dnah10	UTSW	5	124,900,006 (GRCm39)	missense	probably damaging	0.98
R7231:Dnah10	UTSW	5	124,890,892 (GRCm39)	missense	probably benign	0.19
R7278:Dnah10	UTSW	5	124,868,855 (GRCm39)	critical splice donor site	probably null
R7284:Dnah10	UTSW	5	124,909,662 (GRCm39)	missense	probably benign	0.37
R7322:Dnah10	UTSW	5	124,898,333 (GRCm39)	missense	probably benign	0.08
R7523:Dnah10	UTSW	5	124,824,803 (GRCm39)	missense	probably damaging	0.97
R7565:Dnah10	UTSW	5	124,876,095 (GRCm39)	missense	probably damaging	1.00
R7593:Dnah10	UTSW	5	124,823,608 (GRCm39)	missense	probably benign	0.21
R7606:Dnah10	UTSW	5	124,894,776 (GRCm39)	missense	probably benign	0.00
R7835:Dnah10	UTSW	5	124,854,298 (GRCm39)	missense	probably damaging	1.00
R7898:Dnah10	UTSW	5	124,859,425 (GRCm39)	missense	probably damaging	1.00
R7972:Dnah10	UTSW	5	124,803,949 (GRCm39)	missense	probably benign
R7999:Dnah10	UTSW	5	124,802,322 (GRCm39)	missense	probably benign	0.06
R8017:Dnah10	UTSW	5	124,877,949 (GRCm39)	missense	probably benign	0.03
R8032:Dnah10	UTSW	5	124,823,676 (GRCm39)	missense	probably damaging	0.98
R8052:Dnah10	UTSW	5	124,905,575 (GRCm39)	missense	probably benign	0.00
R8088:Dnah10	UTSW	5	124,831,330 (GRCm39)	missense	probably benign	0.00
R8169:Dnah10	UTSW	5	124,877,946 (GRCm39)	missense	probably damaging	1.00
R8178:Dnah10	UTSW	5	124,832,790 (GRCm39)	missense	probably benign	0.11
R8200:Dnah10	UTSW	5	124,905,524 (GRCm39)	missense	probably damaging	1.00
R8210:Dnah10	UTSW	5	124,827,858 (GRCm39)	missense	probably benign	0.29
R8294:Dnah10	UTSW	5	124,859,410 (GRCm39)	missense	probably damaging	1.00
R8338:Dnah10	UTSW	5	124,909,566 (GRCm39)	missense	probably damaging	1.00
R8404:Dnah10	UTSW	5	124,850,606 (GRCm39)	missense	probably damaging	1.00
R8469:Dnah10	UTSW	5	124,813,895 (GRCm39)	missense	probably damaging	1.00
R8537:Dnah10	UTSW	5	124,893,164 (GRCm39)	missense	probably damaging	0.97
R8701:Dnah10	UTSW	5	124,803,911 (GRCm39)	missense	probably benign	0.00
R8723:Dnah10	UTSW	5	124,891,685 (GRCm39)	missense	probably damaging	0.99
R8770:Dnah10	UTSW	5	124,852,410 (GRCm39)	missense	possibly damaging	0.94
R8838:Dnah10	UTSW	5	124,842,614 (GRCm39)	missense	probably benign	0.09
R8879:Dnah10	UTSW	5	124,895,181 (GRCm39)	missense	probably damaging	1.00
R8928:Dnah10	UTSW	5	124,866,828 (GRCm39)	missense	probably damaging	0.98
R8932:Dnah10	UTSW	5	124,878,015 (GRCm39)	missense	possibly damaging	0.96
R8945:Dnah10	UTSW	5	124,891,006 (GRCm39)	missense	probably damaging	0.99
R8990:Dnah10	UTSW	5	124,814,057 (GRCm39)	missense
R9001:Dnah10	UTSW	5	124,852,515 (GRCm39)	missense	probably damaging	1.00
R9006:Dnah10	UTSW	5	124,820,783 (GRCm39)	missense	probably benign	0.23
R9060:Dnah10	UTSW	5	124,905,141 (GRCm39)	missense	probably damaging	1.00
R9085:Dnah10	UTSW	5	124,839,237 (GRCm39)	missense
R9133:Dnah10	UTSW	5	124,859,423 (GRCm39)	missense	probably damaging	1.00
R9155:Dnah10	UTSW	5	124,907,475 (GRCm39)	missense	probably damaging	0.99
R9220:Dnah10	UTSW	5	124,871,437 (GRCm39)	missense	probably benign	0.05
R9234:Dnah10	UTSW	5	124,818,989 (GRCm39)	missense	possibly damaging	0.94
R9264:Dnah10	UTSW	5	124,813,900 (GRCm39)	missense	probably damaging	1.00
R9266:Dnah10	UTSW	5	124,845,990 (GRCm39)	missense	probably benign	0.00
R9386:Dnah10	UTSW	5	124,871,507 (GRCm39)	critical splice donor site	probably null
R9446:Dnah10	UTSW	5	124,823,677 (GRCm39)	missense	probably damaging	1.00
R9484:Dnah10	UTSW	5	124,900,508 (GRCm39)	missense	probably damaging	1.00
R9594:Dnah10	UTSW	5	124,907,107 (GRCm39)	missense	probably damaging	1.00
R9691:Dnah10	UTSW	5	124,852,249 (GRCm39)	missense	probably damaging	0.98
RF015:Dnah10	UTSW	5	124,895,141 (GRCm39)	missense	probably damaging	1.00
RF021:Dnah10	UTSW	5	124,854,971 (GRCm39)	missense	probably damaging	1.00
T0975:Dnah10	UTSW	5	124,840,130 (GRCm39)	missense	probably benign
U24488:Dnah10	UTSW	5	124,891,044 (GRCm39)	missense	probably damaging	1.00
X0017:Dnah10	UTSW	5	124,842,761 (GRCm39)	missense	probably benign	0.22
Z1176:Dnah10	UTSW	5	124,852,419 (GRCm39)	missense	probably benign	0.11
Z1177:Dnah10	UTSW	5	124,819,019 (GRCm39)	missense	probably damaging	1.00
Z1177:Dnah10	UTSW	5	124,895,052 (GRCm39)	critical splice acceptor site	probably null
Z1177:Dnah10	UTSW	5	124,824,683 (GRCm39)	missense	possibly damaging	0.64

Predicted Primers

PCR Primer
(F):5'- AGGTGGATGAGTATGGTACCC -3'
(R):5'- GGTTAAACACAGCATCAGGC -3'

Sequencing Primer
(F):5'- ATGAGTATGGTACCCAGCAGCC -3'
(R):5'- GGCAAGGCTTGAAATTCCTC -3'

Posted On

2014-07-14